Case Report: A Novel Gross Deletion in PAX3 (10.26 kb) Identified in a Chinese Family With Waardenburg Syndrome by Third-Generation Sequencing

Waardenburg syndrome (WS) is a group of autosomal-dominant hereditary conditions with a global incidence of 1/42,000. WS can be categorized into at least four types: WS1–4, and these are characterized by heterochromia iridis, white forelock, prominent nasal root, dystopia canthorum, hypertrichosis of the medial part of the eyebrows, and deaf-mutism. WS3 is extremely rare, with a unique phenotype (upper limb abnormality). Heterozygous mutations of PAX3 are commonly associated with WS1, whereas partial or total deletions of PAX3 are often observed in WS3 cases. Deletions, together with insertions, translocations, inversions, mobile elements, tandem duplications, and complexes, constitute structural variants (SVs), which can be fully and accurately detected by third-generation sequencing (TGS), a new generation of high-throughput DNA sequencing technology. In this study, after failing to identify the causative gene by Sanger sequencing, SNP-array, and whole-exome sequencing (WES), we finally detected a heterozygous gross deletion of PAX3 (10.26kb, chr2: 223153899-223164405) in a WS family by TGS. Our description would enrich the genetic map of WS and help us to further understand this disease. Our findings also demonstrated the value of TGS in clinical genetics researches.

Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis

Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung’s disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung’s disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung’s disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype–phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype–phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Waardenburg Syndrome: A Case Report

Waardenburg syndrome is an uncommon autosomal dominant or recessive disorder, distinguished by hypopigmentation of either skin or hairs or both, segmental, partial or complete heterochromia iridis or isohypochromia, hypertrichosis of eyebrow, synophrys, dystopia canthorum, broad and high nasal root and congenital deafness. The diagnostic criteria consist of major and minor criteria; major includes congenital sensorineural hearing loss, pigmentary abnormality in iris, segmental, partial or complete heterochromia iridis, isohypochromia, fore hair’s achromia, dystopia canthorum and affected first degree relative while minor criteria include congenital leukoderma, synophrys, broad and high nasal root, hypoplasia of nasal alae and premature graying of hair. Herein we report a case of two days old baby boy having uncommon pigmentation of hair and iris beside dystopia canthorum. He was diagnosed as a case of Waardenburg Syndrome type1 (WS1).

Gejala Klinis Sindroma Waardenburg Laporan Kasus

sindroma Waardenburg adalah kelainan bawaan yang jarang ditemukan, dengan prevalensi di Amerika Serikat 1 per 42000 orang. Ditandai dengan ketulian sensorineural, berhubungan dengan kelainan pigmen dan kecacatan jaringan yang berasal dari neural crest. Berdasarkan gejala yang menyertai, sindroma Waardenburg terbagi menjadi 4 tipe, insidensi tersering adalah tipe 1 dan 2. Gejala klinis kelainan ini diantaranya adalah: dystopia canthorum, kelainan pigmen (white forelock, kelainan pada alis mata, bulu mata, rambut tubuh dan heterochromia iris), ketulian sensorineural, pangkal hidung yang menonjol dan rambut memutih pada usia muda (<30 tahun). Tujuan: mempresentasikan 3 kasus sindroma Waardenburg di poli audiovestibuler RS Hasan Sadikin Bandung pada periode Januari 2015-Desember 2015. Kasus: Tiga anak dengan dugaan sindroma Waardenburg tipe 2, keluhan utama belum dapat berbicara. Pemeriksaan audiologi didapatkan ketulian sensorineural, pemeriksaan fisik didapatkan kelainan pigmen iris. Kesimpulan: sindroma Waardenburg merupakan kelainan bawaan yang jarang ditemukan, diagnosis dapat ditegakan dengan mudah. Intervensi dini dapat menghasilkan perkembangan bicara dan bahasa yang lebih baik.Kata Kunci: keterlambatan bicara, dystopia canthorum, sindroma Waardenburg tipe 2.

THE ORAL-FACIAL-DIGITAL SYNDROME: A MALE-LETHAL CONDITION IN A BOY WITH 47/XXY CHROMOSOMES

A male infant is described showing all the major features of the oral-facial-digital syndrome (OFD): lobulated tongue with hypertrophic frena, fibrous bands extending into alveolar clefts, pseudocleft of upper lip, cleft palate, hypoplastic alae nasi, dystopia canthorum, various digital anomalies, and typical X-ray appearance of the skull. A partial agenesis of the corpus callosum with a lipoma was indicated by pneumoencephalography and angiography. The OFD syndrome is confined to females. In the present case an XXY chromosome constitution was demonstrated by cytogenetic studies. The occurrence of OFD and Klinefelter's syndrome in one and the same person is ascribed to a very rare coincidence. OFD is considered to be due to an X-linked dominant mutant gene, with a recessive lethal effect. X-linkage is supported by the pattern of a more extreme lethal expression in hemizygous males versus viability of heterozygous females. An XXY individual is viable, presumably because of the normal allele which is active in a fraction of its cells. Other reports of males with OFD are critically evaluated.