Inducible Responses and Protective Functions of Mammalian Cells Upon Exposure to UV Light and Ionizing Radiation

UV light produces lesions, predominantly pyrimidine dimers, which inhibit DNA replication in mammalian cells. The mechanism of inhibition is controversial: is synthesis of a daughter strand halted at a lesion while the replication fork moves on and reinitiates downstream, or is fork progression itself blocked for some time at the site of a lesion? We directly addressed this question by using electron microscopy to examine the distances of replication forks from the origin in unirradiated and UV-irradiated simian virus 40 chromosomes. If UV lesions block replication fork progression, the forks should be asymmetrically located in a large fraction of the irradiated molecules; if replication forks move rapidly past lesions, the forks should be symmetrically located. A large fraction of the simian virus 40 replication forks in irradiated molecules were asymmetrically located, demonstrating that UV lesions present at the frequency of pyrimidine dimers block replication forks. As a mechanism for this fork blockage, we propose that polymerization of the leading strand makes a significant contribution to the energetics of fork movement, so any lesion in the template for the leading strand which blocks polymerization should also block fork movement.

Download Full-text

DNA-binding protein activated by gamma radiation in human cells

Molecular and Cellular Biology ◽

10.1128/mcb.10.10.5279-5285.1990 ◽

1990 ◽

Vol 10 (10) ◽

pp. 5279-5285

Author(s):

S P Singh ◽

M F Lavin

Keyword(s):

Dna Binding ◽

Ionizing Radiation ◽

Mammalian Cells ◽

Binding Protein ◽

Simian Virus 40 ◽

Dna Binding Protein ◽

Simian Virus ◽

Human Cells ◽

Binding Motif ◽

Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

Download Full-text

Radioprotective Role of Peroxiredoxin 6

Antioxidants ◽

10.3390/antiox8010015 ◽

2019 ◽

Vol 8 (1) ◽

pp. 15 ◽

Cited By ~ 15

Author(s):

Mars G. Sharapov ◽

Vladimir I. Novoselov ◽

Sergey V. Gudkov

Keyword(s):

Ionizing Radiation ◽

Mammalian Cells ◽

Redox Homeostasis ◽

Phospholipid Metabolism ◽

Pathological Effect ◽

Peroxiredoxin 6 ◽

Leading Role ◽

Wide Range ◽

Radiosensitive Organs ◽

Peroxidase Enzymes

Peroxiredoxin 6 (Prdx6) is a member of an evolutionary ancient family of peroxidase enzymes with diverse functions in the cell. Prdx6 is an important enzymatic antioxidant. It reduces a wide range of peroxide substrates in the cell, thus playing a leading role in the maintenance of the redox homeostasis in mammalian cells. Beside peroxidase activity, Prdx6 has been shown to possess an activity of phospholipase A2, an enzyme playing an important role in membrane phospholipid metabolism. Moreover, Prdx6 takes part in intercellular and intracellular signal transduction due to its peroxidase and phospholipase activity, thus facilitating the initiation of regenerative processes in the cell, suppression of apoptosis, and activation of cell proliferation. Being an effective and important antioxidant enzyme, Prdx6 plays an essential role in neutralizing oxidative stress caused by various factors, including action of ionizing radiation. Endogenous Prdx6 has been shown to possess a significant radioprotective potential in cellular and animal models. Moreover, intravenous infusion of recombinant Prdx6 to animals before irradiation at lethal or sublethal doses has shown its high radioprotective effect. Exogenous Prdx6 effectively alleviates the severeness of radiation lesions, providing normalization of the functional state of radiosensitive organs and tissues, and leads to a significant elevation of the survival rate of animals. Prdx6 can be considered as a potent and promising radioprotective agent for reducing the pathological effect of ionizing radiation on mammalian organisms. The radioprotective properties and mechanisms of radioprotective action of Prdx6 are discussed in the current review.

Download Full-text

Stress response genes induced in mammalian cells by ionizing radiation

Radiation Oncology Investigations ◽

10.1002/roi.2970010203 ◽

1993 ◽

Vol 1 (2) ◽

pp. 81-93 ◽

Cited By ~ 14

Author(s):

Zvi Fuks ◽

Adriana Haimovitz-Friedman ◽

Dennis E. Hallahan ◽

Donald W. Kufe ◽

Ralph R. Weichselbaum

Keyword(s):

Stress Response ◽

Ionizing Radiation ◽

Mammalian Cells ◽

Stress Response Genes

Download Full-text

DNA-binding protein activated by gamma radiation in human cells.

Molecular and Cellular Biology ◽

10.1128/mcb.10.10.5279 ◽

1990 ◽

Vol 10 (10) ◽

pp. 5279-5285 ◽

Cited By ~ 40

Author(s):

S P Singh ◽

M F Lavin

Keyword(s):

Dna Binding ◽

Ionizing Radiation ◽

Mammalian Cells ◽

Binding Protein ◽

Simian Virus 40 ◽

Dna Binding Protein ◽

Simian Virus ◽

Human Cells ◽

Binding Motif ◽

Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

Download Full-text