Molecular phylogeny of the crab genus Brachynotus (Brachyura: Varunidae) based on the 16S rRNA gene

2001 ◽  
pp. 41-46 ◽  
Author(s):  
Christoph D. Schubart ◽  
José A. Cuesta ◽  
Antonio Rodríguez
Keyword(s):  
16S Rrna ◽  
Molecular Phylogeny ◽  
16S Rrna Gene ◽  
Rrna Gene ◽  
The 16S Rrna Gene

scholarly journals FILOGENI MOLEKULER ISOLAT BAKTERI F0-0-3-1 DARI MEDIA PEMELIHARAAN ROTIFER

2020 ◽  
Vol 8 (2) ◽  
pp. 73
Author(s):  
Oktavianus Dalenoh ◽  
Stenly Wullur ◽  
Elvy L Ginting ◽  
Veibe Warouw ◽  
Detty N Rumampuk ◽  
...  
Keyword(s):  
16S Rrna ◽  
Molecular Phylogeny ◽  
16S Rrna Gene ◽  
Bacillus Cereus ◽  
Molecular Analysis ◽  
Bacterial Species ◽  
Rrna Gene ◽  
Neighbor Joining ◽  
Sequence Quality ◽  
The 16S Rrna Gene

The aim of this study was to construct molecular phylogeny of bacteria suspected to involve in decomposing the fishery waste as diet for rotifer culture. The bacteria were isolated from culture of rotifer and propagated for molecular analysis. Genomic DNA of the bacteria was extracted using DNeasy Blood and Tissue Kit (Qiagen). The 16S rRNA gene was amplified using primer pairs i.e. 8F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCCT GTTACGACTT) and sequenced. The sequences were analyzed using Sequence Scanner and MEGA 7, and BLASTed on the NCBI website (www.ncbi.nml.nih.gov). Molecular phylogeny of the isolate was constructed using Neighbor Joining Tree method. Isolate bacteria F0-0-3-1 from culture of rotifer fed with fish waste diet was successfully propagated for molecular analysis. 16S rRNA gene of the isolate bacteria was successfully amplified and showed a DNA band at 1400 bp. Nucleotides sequence quality of the 16S rRNA gene i.,e QV+20 and CRL were 995 and 941 nucletides. BLAST result of the 16S rRNA gene showed 98.87% percent identity of the isolate bacteria F0- 0-3-1 with bacterial species in the genus Bacillus i.e. Bacillus weidmanni, Bacillus cereus dan Bacillus proteolyticus. Molecular phylogeny analysis showed that the three species was in the same clade.Keywords: Phylogeny, molecular, bacteria, rotifer, 16S rRNA gene Penelitian ini bertujuan untuk mengkonstruksi filogeni molekuler bakteri yang diduga terlibat dalam proses penguraian limbah perikanan sebagai pakan untuk kultur rotifer. Isolat bakteri yang diperoleh dari kultur rotifer tersebut, dibiakkan dan DNA genomnya diekstrak menggunakan DNeasy Blood and Tissue Kit (Qiagen). Gen 16S rRNA isolat bakteri tersebut, diamplifikasi menggunakan primer 8F (AGAGTTTGATCCTGGCTCAG) dan 1492R (GGTTACCCT GTTACGACTT) selanjutnya, disekuens dan urutan nukleotida hasil sekuens dianalisis menggunakan program Sequence Scanner dan MEGA 7. Analisis homologi sekuens dilakukan dengan program BLAST nucleotide blast, pada situs NCBI (www.ncbi.nml.nih.gov) dan dilanjutkan dengan konstruksi filogeni molekuler menggunakan metode Neigbor Joining Tree. Isolat bakteri F0-0-3-1 berhasil disolasi dari kultur rotifer yang diberi pakan limbah ikan. Hasil amplifikasi Gen 16S rRNA isolat bakteri F0-0-3-1 terdeteksi dalam bentuk pita DNA pada posisi sekitar 1400 bp. Kualitas nukleotida gen 16S rRNA hasil sekuens menunjukan nilai QV 995 dan CRL 941. Hasil BLAST sekuens gen 16S rRNA isolat bakteri F0-0-3-1 pada database menunjukkan kemiripan 98% dengan spesies Bacillus wiedmanni. Hasil kontruksi filogeni menggunakan metode Neighbor Joining Tree menunjukan posisi isolat bakteri F0-0-3-1 berada pada clade yang sama dengan Bacillus weidmanni, Bacillus cereus dan Bacillus proteolyticus. Kata kunci: Filogeni, molekuler, bakteri, rotifer, Gen 16S rRNA

Molecular phylogeny based on the 16S rRNA gene of elite rhizobial strains used in Brazilian commercial inoculants

2006 ◽  
Vol 29 (4) ◽  
pp. 315-332 ◽  
Author(s):  
Pâmela Menna ◽  
Mariangela Hungria ◽  
Fernando G. Barcellos ◽  
Eliane V. Bangel ◽  
Pablo N. Hess ◽  
...  
Keyword(s):  
16S Rrna ◽  
Molecular Phylogeny ◽  
16S Rrna Gene ◽  
Rrna Gene ◽  
Commercial Inoculants ◽  
The 16S Rrna Gene

scholarly journals Phyllobacterium loti sp. nov. isolated from nodules of Lotus corniculatus

2014 ◽  
Vol 64 (Pt_3) ◽  
pp. 781-786 ◽  
Author(s):  
Maximo Sánchez ◽  
Martha-Helena Ramírez-Bahena ◽  
Alvaro Peix ◽  
María J. Lorite ◽  
Juan Sanjuán ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Sequence Similarity ◽  
Carbon Sources ◽  
Lotus Corniculatus ◽  
Culture Conditions ◽  
Rrna Gene ◽  
Content Type ◽  
Link Type ◽  
The 16S Rrna Gene

Strain S658T was isolated from a Lotus corniculatus nodule in a soil sample obtained in Uruguay. Phylogenetic analysis of the 16S rRNA gene and atpD gene showed that this strain clustered within the genus Phyllobacterium . The closest related species was, in both cases, Phyllobacterium trifolii PETP02T with 99.8 % sequence similarity in the 16S rRNA gene and 96.1 % in the atpD gene. The 16S rRNA gene contains an insert at the beginning of the sequence that has no similarities with other inserts present in the same gene in described rhizobial species. Ubiquinone Q-10 was the only quinone detected. Strain S658T differed from its closest relatives through its growth in diverse culture conditions and in the assimilation of several carbon sources. It was not able to reproduce nodules in Lotus corniculatus. The results of DNA–DNA hybridization, phenotypic tests and fatty acid analyses confirmed that this strain should be classified as a representative of a novel species of the genus Phyllobacterium , for which the name Phyllobacterium loti sp. nov. is proposed. The type strain is S658T( = LMG 27289T = CECT 8230T).

scholarly journals Diagnosis of Fulminant Pneumonia Caused by Legionella pneumophila Serogroup 8 with the Sequence Analysis of the 16S rRNA Gene

2011 ◽  
Vol 225 (1) ◽  
pp. 65-69 ◽  
Author(s):  
Toshinori Kawanami ◽  
Kazuhiro Yatera ◽  
Kazumasa Fukuda ◽  
Kei Yamasaki ◽  
Masamizu Kunimoto ◽  
...  
Keyword(s):  
Sequence Analysis ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Legionella Pneumophila ◽  
Rrna Gene ◽  
The 16S Rrna Gene

scholarly journals The Western Progression of Lyme Disease: Infectious and NonclonalBorrelia burgdorferi Sensu LatoPopulations in Grand Forks County, North Dakota

2014 ◽  
Vol 81 (1) ◽  
pp. 48-58 ◽  
Author(s):  
Brandee L. Stone ◽  
Nathan M. Russart ◽  
Robert A. Gaultney ◽  
Angela M. Floden ◽  
Jefferson A. Vaughan ◽  
...  
Keyword(s):  
Lyme Disease ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
North Dakota ◽  
Intergenic Spacer ◽  
Rrna Gene ◽  
Content Type ◽  
Intergenic Spacer Region ◽  
Grand Forks ◽  
The 16S Rrna Gene

ABSTRACTScant attention has been paid to Lyme disease,Borrelia burgdorferi,Ixodes scapularis, or reservoirs in eastern North Dakota despite the fact that it borders high-risk counties in Minnesota. Recent reports ofB. burgdorferiandI. scapularisin North Dakota, however, prompted a more detailed examination. Spirochetes cultured from the hearts of five rodents trapped in Grand Forks County, ND, were identified asB. burgdorferi sensu latothrough sequence analyses of the 16S rRNA gene, the 16S rRNA gene-ileTintergenic spacer region,flaB,ospA,ospC, andp66. OspC typing revealed the presence of groups A, B, E, F, L, and I. Two rodents were concurrently carrying multiple OspC types. Multilocus sequence typing suggested the eastern North Dakota strains are most closely related to those found in neighboring regions of the upper Midwest and Canada. BALB/c mice were infected withB. burgdorferiisolate M3 (OspC group B) by needle inoculation or tick bite. Tibiotarsal joints and ear pinnae were culture positive, andB. burgdorferiM3 was detected by quantitative PCR (qPCR) in the tibiotarsal joints, hearts, and ear pinnae of infected mice. Uninfected larvalI. scapularisticks were able to acquireB. burgdorferiM3 from infected mice; M3 was maintained inI. scapularisduring the molt from larva to nymph; and further, M3 was transmitted from infectedI. scapularisnymphs to naive mice, as evidenced by cultures and qPCR analyses. These results demonstrate that isolate M3 is capable of disseminated infection by both artificial and natural routes of infection. This study confirms the presence of unique (nonclonal) and infectiousB. burgdorferipopulations in eastern North Dakota.

Sign in / Sign up

Export Citation Format

Share Document