scholarly journals FILOGENI MOLEKULER ISOLAT BAKTERI F0-0-3-1 DARI MEDIA PEMELIHARAAN ROTIFER

2020 ◽  
Vol 8 (2) ◽  
pp. 73
Author(s):  
Oktavianus Dalenoh ◽  
Stenly Wullur ◽  
Elvy L Ginting ◽  
Veibe Warouw ◽  
Detty N Rumampuk ◽  
...  

The aim of this study was to construct molecular phylogeny of bacteria suspected to involve in decomposing the fishery waste as diet for rotifer culture. The bacteria were isolated from culture of rotifer and propagated for molecular analysis. Genomic DNA of the bacteria was extracted using DNeasy Blood and Tissue Kit (Qiagen). The 16S rRNA gene was amplified using primer pairs i.e. 8F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCCT GTTACGACTT) and sequenced. The sequences were analyzed using Sequence Scanner and MEGA 7, and BLASTed on the NCBI website (www.ncbi.nml.nih.gov). Molecular phylogeny of the isolate was constructed using Neighbor Joining Tree method. Isolate bacteria F0-0-3-1 from culture of rotifer fed with fish waste diet was successfully propagated for molecular analysis. 16S rRNA gene of the isolate bacteria was successfully amplified and showed a DNA band at 1400 bp. Nucleotides sequence quality of the 16S rRNA gene i.,e QV+20 and CRL were 995 and 941 nucletides. BLAST result of the 16S rRNA gene showed 98.87% percent identity of the isolate bacteria F0- 0-3-1 with bacterial species in the genus Bacillus i.e. Bacillus weidmanni, Bacillus cereus dan Bacillus proteolyticus. Molecular phylogeny analysis showed that the three species was in the same clade.Keywords: Phylogeny, molecular, bacteria, rotifer, 16S rRNA gene Penelitian ini bertujuan untuk mengkonstruksi filogeni molekuler bakteri yang diduga terlibat dalam proses penguraian limbah perikanan sebagai pakan untuk kultur rotifer. Isolat bakteri yang diperoleh dari kultur rotifer tersebut, dibiakkan dan DNA genomnya diekstrak menggunakan DNeasy Blood and Tissue Kit (Qiagen). Gen 16S rRNA isolat bakteri tersebut, diamplifikasi menggunakan primer 8F (AGAGTTTGATCCTGGCTCAG) dan 1492R (GGTTACCCT GTTACGACTT) selanjutnya, disekuens dan urutan nukleotida hasil sekuens dianalisis menggunakan program Sequence Scanner dan MEGA 7. Analisis homologi sekuens dilakukan dengan program BLAST nucleotide blast, pada situs NCBI (www.ncbi.nml.nih.gov) dan dilanjutkan dengan konstruksi filogeni molekuler menggunakan metode Neigbor Joining Tree. Isolat bakteri F0-0-3-1 berhasil disolasi dari kultur rotifer yang diberi pakan limbah ikan. Hasil amplifikasi Gen 16S rRNA isolat bakteri F0-0-3-1 terdeteksi dalam bentuk pita DNA pada posisi sekitar 1400 bp. Kualitas nukleotida gen 16S rRNA hasil sekuens menunjukan nilai QV 995 dan CRL 941. Hasil BLAST sekuens gen 16S rRNA isolat bakteri F0-0-3-1 pada database menunjukkan kemiripan 98% dengan spesies Bacillus wiedmanni. Hasil kontruksi filogeni menggunakan metode Neighbor Joining Tree menunjukan posisi isolat bakteri F0-0-3-1 berada pada clade yang sama dengan Bacillus weidmanni, Bacillus cereus dan Bacillus proteolyticus. Kata kunci: Filogeni, molekuler, bakteri, rotifer, Gen 16S rRNA

2010 ◽  
Vol 56 (12) ◽  
pp. 1040-1049 ◽  
Author(s):  
Michal Slany ◽  
Martina Vanerkova ◽  
Eva Nemcova ◽  
Barbora Zaloudikova ◽  
Filip Ruzicka ◽  
...  

High-resolution melting analysis (HRMA) is a fast (post-PCR) high-throughput method to scan for sequence variations in a target gene. The aim of this study was to test the potential of HRMA to distinguish particular bacterial species of the Staphylococcus genus even when using a broad-range PCR within the 16S rRNA gene where sequence differences are minimal. Genomic DNA samples isolated from 12 reference staphylococcal strains ( Staphylococcus aureus , Staphylococcus capitis , Staphylococcus caprae , Staphylococcus epidermidis , Staphylococcus haemolyticus , Staphylococcus hominis , Staphylococcus intermedius , Staphylococcus saprophyticus , Staphylococcus sciuri , Staphylococcus simulans , Staphylococcus warneri , and Staphylococcus xylosus ) were subjected to a real-time PCR amplification of the 16S rRNA gene in the presence of fluorescent dye EvaGreen™, followed by HRMA. Melting profiles were used as molecular fingerprints for bacterial species differentiation. HRMA of S. saprophyticus and S. xylosus resulted in undistinguishable profiles because of their identical sequences in the analyzed 16S rRNA region. The remaining reference strains were fully differentiated either directly or via high-resolution plots obtained by heteroduplex formation between coamplified PCR products of the tested staphylococcal strain and phylogenetically unrelated strain.


2012 ◽  
Vol 62 (Pt_3) ◽  
pp. 632-637 ◽  
Author(s):  
Song-Ih Han ◽  
Hyo-Jin Lee ◽  
Hae-Ran Lee ◽  
Ki-Kwang Kim ◽  
Kyung-Sook Whang

Three exopolysaccharide-producing bacteria, designated strains DRP28T, DRP29 and DRP31, were isolated from the rhizoplane of Angelica sinensis from the Geumsan, Republic of Korea. Cells were straight rods, Gram reaction-negative, aerobic, non-motile, and catalase- and oxidase- positive. Flexirubin-type pigments were absent. Phylogenetic analysis of the 16S rRNA gene indicated that these bacteria belong to the genus Mucilaginibacter in the phylum Bacteroidetes. 16S rRNA gene sequence similarities to strains of recognized species of the genus Mucilaginibacter were 93.8–97.4 %. The major fatty acids were iso-C15 : 0 and summed feature 3 (C16 : 1ω7c and/or iso-C15 : 0 2-OH). The strains contained MK-7 as the major isoprenoid quinone. Strains DRP28T, DRP29 and DRP31 formed a single, distinct genomospecies with DNA G+C contents of 41.9–42.7 mol% and DNA hybridization values of 82.6–86.8 %; the strains exhibited DNA–DNA hybridization values of only 20.4–41.3 % with related species of the genus Mucilaginibacter. On the basis of evidence presented in this study, strains DRP28T, DRP29 and DRP31 were considered to represent a novel species of the genus Mucilaginibacter, for which the name Mucilaginibacter polysacchareus sp. nov. is proposed. The type strain is DRP28T ( = KACC 15075T  = NBRC 107757T).


2022 ◽  
Vol 16 (1) ◽  
pp. 102
Author(s):  
Nur Alifah Ilyana Mohamad Naim ◽  
Nabihah Raihanah Tajul Anuar ◽  
Lyena Watty Zuraine Ahmad ◽  
Roziah Kambol ◽  
Sharifah Aminah Syed Mohamad ◽  
...  

The 16S rRNA gene is a housekeeping genetic marker that is available in almost all bacterial species and it is used in bacterial phylogeny and taxonomy studies. In many studies, the 16S rRNA gene is used in identification of certain bacterial species. Being a less conserved genetic marker, certain studies found it is a useful tool to infer the genome-wide similarity levels among the closely related prokaryotic organisms. Thus, this study aimed to compare the variation in the 16S rRNA partial region of Burkholderia spp. that infect the panicle of rice from eight different geographical areas. 58 sequences with total of 688 base pairs (bp) of 16S rRNA gene in B. glumae and B. gladioli were retrieved from public database based on several countries namely United State, Panama, Ecuador, Thailand, China, India, Korea and Malaysia. Then, the data sequences were analysed and validated using MEGAX and ABGD software respectively. The result of phylogenetic tree confirmed that B. glumae and B. gladioli were species that present in the panicle blight of rice. However, Data Analysis in Molecular Biology and Evolution (DAMBE) and Automatic Barcode Gap Discovery (ABGD) software were not able to detect substitution saturation and divergence between B. glumae and B. gladioli respectively based on the 58 sequences of the 16S rRNA partial region. Hence, it proves that 16S rRNA gene is an ineffective genetic marker to be used to differentiate the closely related species of bacteria from similar genus.


2007 ◽  
Vol 73 (12) ◽  
pp. 4055-4065 ◽  
Author(s):  
Natalia V. Ivanikova ◽  
Linda C. Popels ◽  
R. Michael L. McKay ◽  
George S. Bullerjahn

ABSTRACT Very little is known about the biodiversity of freshwater autotrophic picoplankton (APP) in the Laurentian Great Lakes, a system comprising 20% of the world's lacustrine freshwater. In this study, the genetic diversity of Lake Superior APP was examined by analyzing 16S rRNA gene and cpcBA PCR amplicons from water samples. By neighbor joining, the majority of 16S rRNA gene sequences clustered within the “picocyanobacterial clade” consisting of freshwater and marine Synechococcus and Prochlorococcus. Two new groups of Synechococcus spp., the pelagic Lake Superior clusters I and II, do not group with any of the known freshwater picocyanobacterial clusters and were the most abundant species (50 to 90% of the sequences) in samples collected from offshore Lake Superior stations. Conversely, at station Portage Deep (PD), located in a nearshore urbanized area, only 4% of the sequences belonged to these clusters and the remaining clones reflected the freshwater Synechococcus diversity described previously at sites throughout the world. Supporting the 16S rRNA gene data, the cpcBA library from nearshore station PD revealed a cosmopolitan diversity, whereas the majority of the cpcBA sequences (97.6%) from pelagic station CD1 fell within a unique Lake Superior cluster. Thus far, these picocyanobacteria have not been cultured, although their phylogenetic assignment suggests that they are phycoerythrin (PE) rich, consistent with the observation that PE-rich APP dominate Lake Superior picoplankton. Lastly, flow cytometry revealed that the summertime APP can exceed 105 cells ml−1 and suggests that the APP shifts from a community of PE and phycocyanin-rich picocyanobacteria and picoeukaryotes in winter to a PE-rich community in summer.


2021 ◽  
Vol 9 (1) ◽  
pp. 38
Author(s):  
Herlin S Hubu ◽  
Stenly Wullur ◽  
Veibe Warouw ◽  
Elvy L Ginting ◽  
Robert A Bara ◽  
...  

This study aims to identify and construct molecular phylogeny of an isolate bacteria from culture media of rotifer Brachionus rotudiforis supplied with processed fishery waste feed as nutritional source. The use of fish waste-based food for rotifer showed positive effects on growth and nutrient content of the rotifers. Genomic DNA of the isolate bacteria BRLI- 01 was extracted and the 16S rRNA gene was amplified using primers (8F and 1492F) and further sequenced using Sanger sequence technique. The 16S rRNA gene was analysed using SeqScanner® and MEGA® followed with BLAST (Basic Local Alignment Search Tool) analyses in the NCBI (National Centre for Biotechnology Information). Amplification result of 16S rRNA gene bacteria s NCBI site as a reference for identification and phylogeny of bacterial species. BRLI-01 was successfully cultured on rotifer rearing media. The results of the 16S rRNA gene amplification of the isolate bacteria showed a DNA band with a length of 1400 bp. The BLAST result on the NCBI showed that the isolate bacteria BRLI-01 had a percent identity (98.46%) and is in the same phylogony branching position with Vibrio rotiferianus Keywords: Rotifers, Bacteria, Fish waste, 16S rRNA Genes, Phylogeny identification


2006 ◽  
Vol 29 (4) ◽  
pp. 315-332 ◽  
Author(s):  
Pâmela Menna ◽  
Mariangela Hungria ◽  
Fernando G. Barcellos ◽  
Eliane V. Bangel ◽  
Pablo N. Hess ◽  
...  

PHARMACON ◽  
2021 ◽  
Vol 10 (1) ◽  
pp. 649
Author(s):  
Engjinia Frenny Kandio ◽  
Adithya Yudistira ◽  
John M.R. Runtuwene

ABSTRACTSponges are porous animals that are filter feeders and they become a habitat for microorganisms to nest in their bodies. The result of the symbiosis between sponges and microorganisms, especially in bacteria is the ability of the sponge to produce bioactive compounds. One of the potentials derived from these bioactive compounds is antibacterial. This study aims to isolate and test the antibacterial activity of the endophytic symbiont bacteria Stylissa sp., as well as to carry out molecular identification using the 16S rRNA gene of symbiont bacteria isolates that show the greatest antibacterial power. Three isolates of endophytic symbiont bacteria were successfully obtained through the purification stage. Each isolate was coded E1, E2, and E3. With the average inhibition zone against Escherichia coli bacteria, E1 (7.26 mm) is in the moderate category, E2 (5.42 mm) is in the moderate category and E3 (0.96 mm) is in the weak category. While the antibacterial power against Staphylococcus aureus bacteria, E1 (10.26 mm) in the moderate category, E2 (2.10 mm) in the moderate category, and E3 (0.17 mm) in the weak category. The endophytic bacteria that have the greatest antibacterial power is in isolate E1 which is based on molecular analysis using the 16S rRNA gene identified as Bacillus cereus bacteria. Keywords: Stylissa sp. Sponge, endophytic symbiont bacteria, antibacterial activity,                                          molecular identification, 16S rRNA Gene   ABSTRAKSpons adalah hewan berpori yang bersifat filter feeder sehingga menjadi habitat bagi mikroorganisme untuk bersarang di dalam tubuhnya. Hasil dari simbiosis antara spons dan mikroorganisme dalam hal ini bakteri yaitu kemampuan spons dalam menghasilkan senyawa bioaktif. Salah satu potensi yang berasal dari senyawa bioaktif tersebut adalah antibakteri. Penelitian ini bertujuan untuk mengisolasi dan melakukan pengujian aktivitas antibakteri dari bakteri simbion endofit spons Stylissa sp., serta melakukan identifikasi secara molekuler menggunakan gen 16S rRNA terhadap isolat bakteri simbion yang menunjukkan daya antibakteri terbesar. Sebanyak 3 isolat bakteri simbion endofit berhasil diperoleh melalui tahap purifikasi. Masing-masing isolat diberi kode E1, E2, dan E3. Dengan rata-rata zona hambat terhadap bakteri Escherchia coli yaitu, E1 (7,26 mm) termasuk kategori sedang, E2 (5,42 mm) termasuk kategori sedang, E3 (0,96 mm) dengan kategori lemah. Sedagkan daya antibakteri terhadap bakteri Staphylococcus aureus yaitu, E1 (10,26 mm) dengan kategori sedang, E2 (2,10 mm) termasuk kategori sedang, dan E3 (0,17 mm) pada kategori lemah. Bakteri endofit yang memiliki daya antibakteri terbesar yaitu isolat E1 yang berdasarkan analisis secara molekuler dengan menggunakan gen 16S rRNA teridentifikasi sebagai Bacillus cereus. Kata kunci: Spons Stylissa sp., bakteri simbion endofit, aktivitas antibakteri, identifikasi molekuler, gen 16S  rRNA.


Sign in / Sign up

Export Citation Format

Share Document