scholarly journals First report of Athelia rolfsii (Sclerotium rolfsii Sacc.) causing collar rot disease on sunflower in Turkey

2020 ◽  
Vol 102 (3) ◽  
pp. 931-931
Author(s):  
Ceren Cer ◽  
Ayşe Uysal Morca
Keyword(s):  
Sclerotium Rolfsii ◽  
Collar Rot ◽  
First Report ◽  
Athelia Rolfsii ◽  
Rot Disease

scholarly journals First report of Sclerotium rolfsii causing collar rot on Berseem (Trifolium alexandrinum) in India

Plant Disease ◽  
2020 ◽  
Author(s):  
H. S. Mahesha ◽  
M. C. Keerthi ◽  
N. Manjunatha ◽  
Tejveer Singh ◽  
H. D. Vinaykumar ◽  
...  
Keyword(s):  
Large Subunit ◽  
Sclerotium Rolfsii ◽  
Winter Season ◽  
Small Subunit ◽  
Molecular Characteristics ◽  
Trifolium Alexandrinum ◽  
Collar Rot ◽  
First Report ◽  
Collar Region ◽  
Athelia Rolfsii

Berseem (Trifolium alexandrinum) is a winter season legume fodder crop widely cultivated in the central and northern parts of India. It is considered the ‘King of fodder’ for its high quality green fodder, which is a rich source of protein and low in fibre. Symptoms similar to collar rot were observed in experimental sites at the ICAR-Indian Grassland and Fodder Research institute (IGFRI), Jhansi (N25º 52′ 749.20″, E78º 55′ 452.70″), Uttar Pradesh, India in March 2019. The incidence of disease was ranged from 18 to 22% during 2019. Symptoms included dark colored water-soaked lesions at the base of stems, stem thinning (resembles wire stem) and eventually wilting of the whole plant. A white mycelial mat was observed on the stem and collar region and light brown to tan colored sclerotial bodies formed as disease progressed. To determine the etiology of the infection, 30 diseased plants with typical symptoms were collected from the 3 different fields and used for the isolation of causal agent. Infected stem portion were cut in to small pieces (5mm), surface sterilized with 2% sodium hypochlorite (NaOCl) for 2 minutes, washed three times with sterile distilled water and air dried. The sterilized infected tissues were cultured on potato dextrose agar amended with streptomycin sulphate @ 50µg/ml and incubated at 28±1º C for 3 days. After four days, hyaline septate mycelia ranging 2-3µm in diameter grow radially over the whole plate (90 mm). Sclerotia formation started 6 days after incubation. Sclerotia were initially white and later turned brownish to tan as they matured. The number of sclerotia per plate ranged from 55 to 120 (n=5) at 12 days after inoculation. The diameter of matured sclerotial bodies ranged from 0.1mm to 1.35mm (n=25). Genomic DNA was extracted from mycelium using the CTAB method (Murray and Thompson, 1980). Three regions of rDNA viz., internal transcribed spacer (ITS), large subunit (LSU), and small subunit (SSU) were used to identify the etiology of the disease. The isolate was amplified with ITS1 (5’CGGATCTCTTGGTTCTGGGA3’)/ ITS4 (5’GACGCTCGAACATGCC3’) described by White et al. (1990) and sequenced. The ITS sequence (NCBI GenBank Accession No: MT026581) showed 98.21 % similar to Athelia rolfsii (MH514001.1). The isolate also amplified with primers LSU (LROR: ACCCGCTGAACTTAAGC/ LR5: TCCTGAGGGAAACTTCG) and SSU (NS1: GTAGTCATATGCTTGTCTC/ NS4: CTTCCGTCAATTCCTTTAAG). The LSU (MT225781) and SSU (MT225782) sequences showed 99.90 % and 100 % similarity to Athelia rolfsii (AY635773.1) and Athelia rolfsii (AY635773.1) respectively. Based on the morphological and molecular characteristics, the pathogen responsible for collar rot in berseem was identified as Athelia rolfsii (Anamorph: Sclerotium rolfsii) (Mordue, 1974). To confirm pathogenicity, inoculum was prepared by inoculating mycelial plugs of pathogen into autoclaved corn sand meal (5:95) and incubated at 28±1º C for 12 days. The inoculum (30g) was placed at stem portion of 15 day old seedlings (n=30) of berseem (Cv. Wardan) raised in pots filled with sterilized soil. Seedlings (n=25) inoculated with sterilized corn sand meal (30g) served as the control. The pots were placed inside of a plant growth chamber (26±2º C, 65% RH) for 15 days. Water soaked spots with white mycelium were observed on the collar region after 3 days. After 7 days, stems were completely covered by mycelia and death of seedlings was observed 14 days after inoculation. The pathogen was recovered from the artificially inoculated berseem seedlings (n=15). No symptoms were observed in control plants. Based on morphological and molecular characterization, the present isolate was confirmed as Sclerotium rolfsii. To the best of our knowledge, this is the first report of S. rolfsii causing collar rot of berseem in India.

Management of collar rot disease in chickpea by Trichoderma species

2020 ◽  
Vol 7 (03) ◽  
Author(s):  
PREM PANDEY ◽  
G. C. SAGAR ◽  
SUNDARMAN SHRESTHA2 ◽  
HIRAKAJI MANANDHAR ◽  
RITESH K. YADAV ◽  
...  
Keyword(s):  
Growth Inhibition ◽  
Mycelial Growth ◽  
Sclerotium Rolfsii ◽  
Maximum Growth ◽  
Pot Experiment ◽  
Trichoderma Spp ◽  
Trichoderma Species ◽  
Collar Rot ◽  
Rot Disease

Nine isolates of Trichoderma spp. were isolated from different agro- ecological regions of Nepal viz; Jumla, Palpa, Chitwan, Tarahara, Banke, Illam and Salyan and screened against Sclerotium rolfsii Sacc. Adreded soil borne phytopathogen causing collar rot of chickpea in chickpea; In-vitro efficacy of nine fungal antagonist (Trichoderma spp.) against Sclerotium rolfsii were screened. Pot experiment was done to find out the effective management of S. rolfsi through Tricoderma using different methods i.e. Seed treatment, soil drenching and soil application. All the tested isolates of Trichoderma spp. were found effective on mycelial growth inhibition and sclerotial parasitization of S. rolfsii. Trichoderma isolated from Palpa district showed maximum growth inhibition (%) of pathogen periodically after 48(93.78%), 72(96.00%), 96(97.96%) and 120(100.00%) hours of inoculation. Parasitized sclerotium showed minimum sclerotial germination on agar plates. Moreover, Trichoderma species isolated from Palpa districts showed second best percent mycelial growth inhibition periodically at 72(25.00%), 120(29.16%), 168(29.16%) and 216(29.16%).In pot experiment at 40 days after sowing, Seedling height was maximum in soil drenching with 30g per 100ml of water (22.27cm) and Mortality percentage of seedlings was least or highest disease control was observed in seed treated with 109cfu/ml (0.000%).

First report of Athelia rolfsii causing collar rot of Phalaenopsis orchid in Taiwan

2021 ◽  
Author(s):  
Shih-Ya Chiu ◽  
Yi-Ru Lai ◽  
Wen-Shi Tsai ◽  
Chien-Jui Huang
Keyword(s):  
Collar Rot ◽  
First Report ◽  
Athelia Rolfsii

scholarly journals First report of the seed-borne nature of root and collar rot disease caused byRhizoctonia solaniin sunflower from India

2010 ◽  
Vol 5 (1) ◽  
pp. 11 ◽  
Author(s):  
N. Lakshmidevi ◽  
J. Sudisha ◽  
S. Mahadevamurthy ◽  
H. S. Prakash ◽  
H. Shekar Shetty
Keyword(s):  
Collar Rot ◽  
First Report ◽  
Rot Disease

First report of Sclerotium rolfsii (=Athelia rolfsii) associated with root rot and leaf spot on clove basil (Ocimum gratissimum L.) in India

2021 ◽  
Author(s):  
Shivannegowda Mahadevakumar ◽  
Yelandur Somaraju Deepika ◽  
Kandikere Ramaiah Sridhar ◽  
Kestur Nagaraj Amruthesh ◽  
Nanjaiah Lakshmidevi
Keyword(s):  
Leaf Spot ◽  
Root Rot ◽  
Sclerotium Rolfsii ◽  
First Report ◽  
Ocimum Gratissimum ◽  
Athelia Rolfsii

scholarly journals Use of Trichoderma in Biological Control of Collar Rot of Soybean and Chickpea

2020 ◽  
pp. 25-31
Author(s):  
Mahbuba Kaniz Hasna ◽  
Md. Abul Kashem ◽  
Farid Ahmed
Keyword(s):  
Seed Treatment ◽  
Field Experiments ◽  
Disease Incidence ◽  
Sclerotium Rolfsii ◽  
Antagonistic Activity ◽  
Root Weight ◽  
Dual Culture ◽  
Collar Rot ◽  
Rot Disease

An in vitro and field experiments for two consecutive years were conducted at Bangladesh Institute of Nuclear Agriculture, Mymensingh, aiming to investigate the efficacy of Trichoderma harzianum against Sclerotium rolfsii causing collar rot disease of soybean and chickpea. In in vitro the antagonistic activity of T. harzianum against S. rolfsii was observed through dual culture. In field experiment Trichoderma was applied as soil treatment and seed treatment. The percent inhibition of S. rolfsii induced by T. harzianum was found upto 78.9% in in vitro. The maximum reduction of collar rot disease incidence over control was 82.4% in soybean and 77.6% in chickpea which was recorded in the plot where T. harzianum was applied in the soil. The highest seed germination: 86.3% in soybean and 84.8% in chickpea, maximum fresh shoot weight: 94.5 g plant-1 in soybean, 62.5 g plant-1 in chickpea, maximum fresh root weight: 10.7 g plant-1 in soybean, 9.3 g plant-1 in chickpea and the highest yield: 2830 kg ha-1 in soybean, 1836 kg ha-1 in chickpea were obtained by the application of Trichoderma in soil. The study indicated that the tested isolate of T. harzianum had potential in controlling collar rot disease of soybean and chickpea. For the reduction of collar rot incidence application of T. harzianum in soil was found more effective than seed treatment. 

scholarly journals First Report of Root and Collar Rot by Sclerotium rolfsii on Apple Trees in Italy

Plant Disease ◽  
1999 ◽  
Vol 83 (7) ◽  
pp. 695-695
Author(s):  
L. Corazza ◽  
A. Belisario ◽  
E. Forti
Keyword(s):  
Apple Tree ◽  
Sclerotium Rolfsii ◽  
Apple Trees ◽  
Collar Rot ◽  
Athelia Rolfsii ◽  
Leaf Chlorosis ◽  
General Decline ◽  
Summer Temperatures ◽  
Ground Plate ◽  
Mycelial Strands

Sclerotium rolfsii Sacc. (teleomorph Athelia rolfsii (Curzi) Tu & Kimbrough) is a polyphagous, soilborne plant pathogen. In summer 1998, a sudden death of 2-year-old apple trees (Malus domestica Borkh.) cv. Royal Gala grafted on M9 rootstock was observed in an orchard near Rome, Italy. Symptoms were stunted vegetation, leaf chlorosis, and root and collar rot. A fungus identified as S. rolfsii was observed producing sclerotia and whitish mycelial strands on root and collar bark. Isolations from roots and at the margin of subcortical necrosis on the collar consistently yielded S. rolfsii colonies on potato dextrose agar (PDA); sclerotia developed within 7 days. Koch's postulates were fulfilled by inoculating 10 1-year-old apple tree cv. M9 rootstocks, grown in 3.5-liter pots, with an S. rolfsii isolate grown for 1 week on PDA at 25°C. One ground plate per plant was used, placed around collar and main roots. Five control plants were treated with PDA only. Rootstocks were kept in the greenhouse at 26 ± 2°C. Within 2 months, 70% of inoculated plants died, with marked necrosis girdling the collar. The other inoculated plants showed a general decline, with widespread necrosis on collars and main roots. Control plants remained healthy. S. rolfsii was reisolated from collars and roots of symptomatic plants. S. rolfsii has been recorded on apple trees in the U.S., India, China, and Israel. In Italy, it is destructive on several crops, and was recently recorded on walnut (1). This first outbreak of S. rolfsii on apple in Italy may have been favored by exceptionally warm late spring and summer temperatures. Reference: (1) A. Belisario and L. Corazza. Plant Dis. 80:824, 1996.

scholarly journals First Report of Stem Rot Disease of Miracle Plant (Bryophyllum pinnatum) Caused by Athelia rolfsii in Tripura, India

Plant Disease ◽  
2021 ◽  
pp. PDIS-05-20-1086
Author(s):  
D. Kamil ◽  
A. Bahadur ◽  
P. Debnath ◽  
A. Kumari ◽  
S. P. Choudhary ◽  
...  
Keyword(s):  
Stem Rot ◽  
First Report ◽  
Athelia Rolfsii ◽  
Rot Disease ◽  
Bryophyllum Pinnatum
Sign in / Sign up

Export Citation Format

Share Document