scholarly journals First report of Sclerotium rolfsii causing collar rot on Berseem (Trifolium alexandrinum) in India

Plant Disease ◽  
2020 ◽  
Author(s):  
H. S. Mahesha ◽  
M. C. Keerthi ◽  
N. Manjunatha ◽  
Tejveer Singh ◽  
H. D. Vinaykumar ◽  
...  
Keyword(s):  
Large Subunit ◽  
Sclerotium Rolfsii ◽  
Winter Season ◽  
Small Subunit ◽  
Molecular Characteristics ◽  
Trifolium Alexandrinum ◽  
Collar Rot ◽  
First Report ◽  
Collar Region ◽  
Athelia Rolfsii

Berseem (Trifolium alexandrinum) is a winter season legume fodder crop widely cultivated in the central and northern parts of India. It is considered the ‘King of fodder’ for its high quality green fodder, which is a rich source of protein and low in fibre. Symptoms similar to collar rot were observed in experimental sites at the ICAR-Indian Grassland and Fodder Research institute (IGFRI), Jhansi (N25º 52′ 749.20″, E78º 55′ 452.70″), Uttar Pradesh, India in March 2019. The incidence of disease was ranged from 18 to 22% during 2019. Symptoms included dark colored water-soaked lesions at the base of stems, stem thinning (resembles wire stem) and eventually wilting of the whole plant. A white mycelial mat was observed on the stem and collar region and light brown to tan colored sclerotial bodies formed as disease progressed. To determine the etiology of the infection, 30 diseased plants with typical symptoms were collected from the 3 different fields and used for the isolation of causal agent. Infected stem portion were cut in to small pieces (5mm), surface sterilized with 2% sodium hypochlorite (NaOCl) for 2 minutes, washed three times with sterile distilled water and air dried. The sterilized infected tissues were cultured on potato dextrose agar amended with streptomycin sulphate @ 50µg/ml and incubated at 28±1º C for 3 days. After four days, hyaline septate mycelia ranging 2-3µm in diameter grow radially over the whole plate (90 mm). Sclerotia formation started 6 days after incubation. Sclerotia were initially white and later turned brownish to tan as they matured. The number of sclerotia per plate ranged from 55 to 120 (n=5) at 12 days after inoculation. The diameter of matured sclerotial bodies ranged from 0.1mm to 1.35mm (n=25). Genomic DNA was extracted from mycelium using the CTAB method (Murray and Thompson, 1980). Three regions of rDNA viz., internal transcribed spacer (ITS), large subunit (LSU), and small subunit (SSU) were used to identify the etiology of the disease. The isolate was amplified with ITS1 (5’CGGATCTCTTGGTTCTGGGA3’)/ ITS4 (5’GACGCTCGAACATGCC3’) described by White et al. (1990) and sequenced. The ITS sequence (NCBI GenBank Accession No: MT026581) showed 98.21 % similar to Athelia rolfsii (MH514001.1). The isolate also amplified with primers LSU (LROR: ACCCGCTGAACTTAAGC/ LR5: TCCTGAGGGAAACTTCG) and SSU (NS1: GTAGTCATATGCTTGTCTC/ NS4: CTTCCGTCAATTCCTTTAAG). The LSU (MT225781) and SSU (MT225782) sequences showed 99.90 % and 100 % similarity to Athelia rolfsii (AY635773.1) and Athelia rolfsii (AY635773.1) respectively. Based on the morphological and molecular characteristics, the pathogen responsible for collar rot in berseem was identified as Athelia rolfsii (Anamorph: Sclerotium rolfsii) (Mordue, 1974). To confirm pathogenicity, inoculum was prepared by inoculating mycelial plugs of pathogen into autoclaved corn sand meal (5:95) and incubated at 28±1º C for 12 days. The inoculum (30g) was placed at stem portion of 15 day old seedlings (n=30) of berseem (Cv. Wardan) raised in pots filled with sterilized soil. Seedlings (n=25) inoculated with sterilized corn sand meal (30g) served as the control. The pots were placed inside of a plant growth chamber (26±2º C, 65% RH) for 15 days. Water soaked spots with white mycelium were observed on the collar region after 3 days. After 7 days, stems were completely covered by mycelia and death of seedlings was observed 14 days after inoculation. The pathogen was recovered from the artificially inoculated berseem seedlings (n=15). No symptoms were observed in control plants. Based on morphological and molecular characterization, the present isolate was confirmed as Sclerotium rolfsii. To the best of our knowledge, this is the first report of S. rolfsii causing collar rot of berseem in India.

scholarly journals First report of Southern blight, caused by Athelia rolfsii (syn. Sclerotium rolfsii Sacc.), on Hellebores in North America

Plant Disease ◽  
2021 ◽  
Author(s):  
Richard Jones ◽  
Frances Perez
Keyword(s):  
North America ◽  
Fungal Pathogens ◽  
Large Subunit ◽  
Sclerotium Rolfsii ◽  
Australasian Plant ◽  
Bacterial Disease ◽  
First Report ◽  
Southern Blight ◽  
Plastic Bags ◽  
Athelia Rolfsii

Lenten rose (Hellebores hybridus) is an herbaceous perennial grown in landscapes and valued for early spring flowers and high levels of deer resistance. An additional benefit as a landscape plant comes from the high level of disease resistance, with only three fungal pathogens reported in North America. In August of 2021, a Lenten rose plant within a mature landscape in Silver Spring, MD, USA, (lat 39.116629 long 77.043198) was found with a collapsed canopy and brown stems near the soil line. Small clusters of brown sclerotia-like objects were seen along the stem. Samples of the sclerotia and diseased tissue were dipped in 70 percent ethanol for 15 sec, transferred to 5 percent NaClO for 30 sec, immersed in sterile water for one minute, then plated onto Potato Dextrose Agar. Sclerotia-like objects germinated and white mycelia covered the plates within five days of germination. Hyphae emerged from diseased tissue within two days and also grew rapidly. Cultures from sclerotia-like objects and diseased tissue produced white sclerotia which melanized to brown spherical sclerotia ranging in size from two to four mm. Culture samples (1 cm square) were excised from the culture plates and transferred to the base of three two-year old potted hellebore plants. Control plants had blocks of PDA placed at the base of the plants. Plants were placed in plastic bags for two days to maintain humidity, then maintained at room temperature without plastic bags. Petioles turned brown and collapsed within seven days of inoculation. White, fan-like hyphae were present along with maturing sclerotia. Samples from surface sterilized tissue and sclerotia produced the same culture morphology as the originally isolated cultures. Non-inoculated plants remained healthy, and the pathogen was not isolated from non-inoculated plants. Individual DNA samples were prepared from original cultures and the re-isolated cultures. Molecular identification was performed by amplification of the internal rRNA transcribed spacer region (ITS1/4, White et al. 1990 ), the large subunit rRNA (LSU), and the elongation factor-1A (EF1a). Amplification products were cloned into TOPO-TA pcr4 vector and sequenced (Macrogen USA). Sequences were submitted to GenBank for IT1/4 (OK172559) and LSU (OK172560). Homology to ITS1/4 was found with Athelia rolfsii (MN622806), to LSU with Athelia rolfsii (MT225781) and for EF1a with Athelia rolfsii (MW322687). This is the first report of Athelia rolfsii on Hellebores in North America (Farr, D.F & Rossman, A.Y. Fungal Databases, U.S. National Fungus Collections, ARS, USDA. Retrieved September 10, 2021). This report is unique in that few pathogens are known to infect Hellebores(Taylor et al. 2011) and southern blight is not commonly isolated in landscape plantings at Maryland latitudes. 1. White et al. PCR Protocols: A Guide to Methods and Amplifications. Academic Press, San Diego, 1990 2. Taylor, R.K., Romberg, M.K. & Alexander, B.J.R. A bacterial disease of hellebore caused by Pseudomonas viridiflava in New Zealand. Australasian Plant Dis. Notes 6, 28–29, 2011.

First report of Athelia rolfsii causing collar rot of Phalaenopsis orchid in Taiwan

2021 ◽  
Author(s):  
Shih-Ya Chiu ◽  
Yi-Ru Lai ◽  
Wen-Shi Tsai ◽  
Chien-Jui Huang
Keyword(s):  
Collar Rot ◽  
First Report ◽  
Athelia Rolfsii

Morphological and molecular characteristics of Bastiania sinensis sp. n., Tripyla aquatica Brzeski & Winiszewska-Ślipińska, 1993 and T. setifera Bütschli, 1873 (Nematoda: Triplonchida) from Shanxi Province, North China

Nematology ◽  
2021 ◽  
pp. 1-23
Author(s):  
Mei Na Liu ◽  
Yu Mei Xu ◽  
Zeng Qi Zhao ◽  
Jian Ming Wang
Keyword(s):  
North China ◽  
Large Subunit ◽  
Small Subunit ◽  
Rrna Genes ◽  
Shanxi Province ◽  
Molecular Characteristics ◽  
Separate Species ◽  
Using Data ◽  
First Time ◽  
Respective Species

Summary This paper describes a new species of Bastiania, presents a new record and redescribes a known species of Tripyla. These nematodes are all in the order Triplonchida and were collected from Shanxi Province, North China. Bastiania sinensis sp. n. is characterised by having the female with a relatively slender body 1049-1295 μm long, dorsally arcuate after heat relaxation, with outer labial setae and cephalic setae in a single circle, an oval amphid, 7-8 laterodorsal cervical setae scattered in the pharyngeal region, orthometamenes and pseudocoelomocytes present, tail conoid with a mucron 1-2 μm long, two pairs of caudal setae present, a = 58.1-75.5, b = 4.0-4.6, c = 12.7-19.7, c′ = 4.1-7.8 and V = 61.1-67.7. Males were not found. Tripyla aquatica is recorded for the first time from China, and is redescribed. Tripyla setifera has been reported from China but without a detailed description – now provided. In addition, phylogenetic relationships among the species were analysed using data from the near full length small subunit (SSU) and D2-D3 segments of large subunit (LSU) of rRNA genes. Bastiania sinensis sp. n. is monophyletic with the Bastiania sequences available in GenBank, but is on an independent branch supporting its status as a separate species; T. aquatica and T. setifera are monophyletically clustered with known Tripyla species and grouped together with sequences from their respective species.

First report of Sclerotium rolfsii (=Athelia rolfsii) associated with root rot and leaf spot on clove basil (Ocimum gratissimum L.) in India

2021 ◽  
Author(s):  
Shivannegowda Mahadevakumar ◽  
Yelandur Somaraju Deepika ◽  
Kandikere Ramaiah Sridhar ◽  
Kestur Nagaraj Amruthesh ◽  
Nanjaiah Lakshmidevi
Keyword(s):  
Leaf Spot ◽  
Root Rot ◽  
Sclerotium Rolfsii ◽  
First Report ◽  
Ocimum Gratissimum ◽  
Athelia Rolfsii

Observations on Malenchus geraerti n. sp. (Rhabditida: Tylenchidae), a morphological and molecular phylogenetic study

Zootaxa ◽  
2018 ◽  
Vol 4369 (3) ◽  
pp. 406 ◽  
Author(s):  
MAJID PEDRAM ◽  
MAHYA SOLEYMANZADEH ◽  
EBRAHIM POURJAM ◽  
MAHYAR MOBASSERI
Keyword(s):  
New Species ◽  
Large Subunit ◽  
Small Subunit ◽  
Phylogenetic Study ◽  
Molecular Characteristics ◽  
Lsu Rdna ◽  
Northern Iran ◽  
Lateral Field ◽  
Molecular Phylogenetic ◽  
Short Body

Malenchus geraerti n. sp., recovered from natural regions of northern Iran, is described and illustrated based on morphological, morphometric and molecular data. The new species is characterized by having females with a short body, an anteriorly wide S-shaped amphidial opening narrowing posteriorly, cuticle with prominent annuli, lateral field a plain band with smooth margins, muscular metacorpus with well-developed valve and corresponding plates, spermatheca filled with small spheroid sperm cells, vulva sunken in body with large epiptygma and no flap, and conical tail tapering gradually to a more or less pointed tip. Males of the new species are characterized by having a short body, tylenchoid spicules, adcloacal bursa with smooth margin and tail similar to that of the female. Morphologically, the new species is similar to five known species of the genus: M. fusiformis, M. machadoi, M. pachycephalus, M. solovjovae and M. undulatus. It most closely resembles M. pachycephalus, but as a cryptic species it can be differentiated using morphological and molecular characteristics. Comparisons with the four other aforementioned species are also discussed. Molecular phylogenetic studies using partial sequences of small and large subunit ribosomal DNA fragments reveal that the new species forms a clade with the species M. neosulcus in the small subunit (SSU) rDNA, and two species of Lelenchus in the large subunit (LSU) rDNA tree. 

scholarly journals First Report of Root and Collar Rot by Sclerotium rolfsii on Apple Trees in Italy

Plant Disease ◽  
1999 ◽  
Vol 83 (7) ◽  
pp. 695-695
Author(s):  
L. Corazza ◽  
A. Belisario ◽  
E. Forti
Keyword(s):  
Apple Tree ◽  
Sclerotium Rolfsii ◽  
Apple Trees ◽  
Collar Rot ◽  
Athelia Rolfsii ◽  
Leaf Chlorosis ◽  
General Decline ◽  
Summer Temperatures ◽  
Ground Plate ◽  
Mycelial Strands

Sclerotium rolfsii Sacc. (teleomorph Athelia rolfsii (Curzi) Tu & Kimbrough) is a polyphagous, soilborne plant pathogen. In summer 1998, a sudden death of 2-year-old apple trees (Malus domestica Borkh.) cv. Royal Gala grafted on M9 rootstock was observed in an orchard near Rome, Italy. Symptoms were stunted vegetation, leaf chlorosis, and root and collar rot. A fungus identified as S. rolfsii was observed producing sclerotia and whitish mycelial strands on root and collar bark. Isolations from roots and at the margin of subcortical necrosis on the collar consistently yielded S. rolfsii colonies on potato dextrose agar (PDA); sclerotia developed within 7 days. Koch's postulates were fulfilled by inoculating 10 1-year-old apple tree cv. M9 rootstocks, grown in 3.5-liter pots, with an S. rolfsii isolate grown for 1 week on PDA at 25°C. One ground plate per plant was used, placed around collar and main roots. Five control plants were treated with PDA only. Rootstocks were kept in the greenhouse at 26 ± 2°C. Within 2 months, 70% of inoculated plants died, with marked necrosis girdling the collar. The other inoculated plants showed a general decline, with widespread necrosis on collars and main roots. Control plants remained healthy. S. rolfsii was reisolated from collars and roots of symptomatic plants. S. rolfsii has been recorded on apple trees in the U.S., India, China, and Israel. In Italy, it is destructive on several crops, and was recently recorded on walnut (1). This first outbreak of S. rolfsii on apple in Italy may have been favored by exceptionally warm late spring and summer temperatures. Reference: (1) A. Belisario and L. Corazza. Plant Dis. 80:824, 1996.

scholarly journals First report of collar rot on Ananas lucidus caused by Athelia rolfsii in Brazil

2021 ◽  
Author(s):  
Lucas Matheus Fonseca Almeida ◽  
Naylla Cristina Oliveira Pinho ◽  
Juliana Barral Moreira ◽  
Aricléia de Moraes Catarino ◽  
Cristiana Araujo Soares ◽  
...  
Keyword(s):  
Collar Rot ◽  
First Report ◽  
Athelia Rolfsii

scholarly journals First Report of Athelia rolfsii Causing Southern Blight on Sarcandra glabra in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Ling Lei ◽  
Yan-Yun Hong ◽  
Tu-Yong Yi ◽  
Xiaoying Nie ◽  
Shengeng Xiao
Keyword(s):  
Disease Incidence ◽  
Market Price ◽  
Hunan Province ◽  
Molecular Characteristics ◽  
Post Inoculation ◽  
First Report ◽  
Southern Blight ◽  
Athelia Rolfsii ◽  
Pathogenicity Tests ◽  
Artificial Cultivation

Sarcandra glabra, belonging to the family Chloranthaceae, is a Chinese medicinal plant. The whole dry plant can be used as a medicine; it is rich in bioactive phytochemicals that possess anti-bacterial, anti-inflammatory, anti-oxidant, and anti-tumor properties (Xie et al. 2020). The current market price of S. glabra is around US$5/kg, and the annual demand is 3 500 000~4 000 000 kg in China (Pan et al. 2007). To meet consumer demand for safe and high-quality herbal products, the artificial cultivation of S. glabra has been vigorously promoted. In 2020, it was observed that a plant disease affected S. glabra growth in Hunan province. The disease symptoms included constriction at the base of the stem, with decay and a white mycelium covering. The plants finally died with a disease incidence ranging from 15% to 20%. Using our previously published methods (Yi et al. 2019), one fungal isolate was isolated from the cultured symptomatic stem tissue on potato dextrose agar (PDA) medium and was named as Kb. The isolate was subsequently transferred into 70% glycerol for preservation. The Kb colony varied in color from white to light yellow. The septate hyphae grew rapidly on PDA medium, at approximately 25 mm/day, at 28 °C. On the fifth day, rhizomorphs were formed at the edge and on the center of the PDA plate. On the sixth day, sclerotia developed into a rapeseed shape (d = 1.2~2.3 mm) with a smooth surface, and with white, yellow, or chestnut brown coloring. Morphologically, Kb was similar to Sclerotium rolfsii (Sun et al. 2020). Vigorously growing aerial hyphae were selected for molecular identification. The internal transcribed spacers (ITS) were amplified using the primer pairs ITS1/ITS4 (Glass et al. 1995). BLAST searches against Genbank indicated that Kb’s ITS sequence shared 97% similarity with that of Athelia rolfsii (MN696630.1). Based on morphological and molecular characteristics, Kb was identified as A. rolfsii. The sequence was deposited in GenBank (MW288292). Pathogenicity tests were carried out using the following procedures. Three healthy S. glabra seedlings were inoculated at the stem base with a PDA plug (5 mm in diameter) covered with 5-day-old fungal mycelium cultured at 28 °C, while the remaining three seedlings were inoculated with distilled water only, as the control. Plants were incubated in a greenhouse at 28 °C. At 7 days post inoculation, the inoculated sites infected with the putative pathogen displayed identical constrictions as previously observed in the field. In contrast, the controls remained symptomless. The pathogen was reisolated from these infected seedlings, and its culture showed the same morphological and molecular traits as the original isolates. No pathogens were isolated from the control plants. Pathogenicity tests were repeated three times. Koch’s postulates were fulfilled. Although S. rolfsii has been previously reported to cause Southern Blight on mung bean crops in China (Sun et al. 2020), this is the first report on A. rolfsii causing similar symptoms of Southern Blight on S. glabra in Hunan Province, China. Identification of the pathogens causing each disease is important for the development of effective disease management strategies and for extensive artificial cultivation.

Sign in / Sign up

Export Citation Format

Share Document