Correlation Studies in Ashwagandha [Withania somnifera (L.) Dunal]

In the present study entitled “Variability and Correlation Studies in Ashwagandha [Withania somnifera (L.) Dunal]”, 74 genotypes along with three standard checks viz., JA-20 (Jawahar Asgandh-20), JA-134 (Jawahar Asgandh-134) and RVA-100 were evaluated in augmented RBD design during late kharif 2019-20 at the Instructional Farm, Rajasthan College of Agriculture, Maharana Pratap University of Agriculture and Technology, Udaipur (Rajasthan). The observations were recorded on ten randomly selected competitive plants for fifteen characters, viz. days to 50% flowering, days to 75 per cent maturity, plant height, number of primary branches per plant, number of secondary branches per plant, leaf area index, root length, root diameter in collar region, fresh root yield per plant, dry root yield per plant, fresh plant weight per plant, dry plant weight per plant, 100 seed weight, harvest index and total alkaloid. Analysis of variance, correlation coefficient and path analysis were performed for the mean data. The dry root yield per plant exhibited significant and positive correlation with dry plant weight, fresh root yield and harvest index at both genotypic and phenotypic level. While with, root diameter in collar region at genotypic level and fresh plant weight at phenotypic level. Positive and significant correlation among dry root yield per plant and contributing characters would help in indirect selection for dry root yield per plant in the crop like ashwagandha where economic part (dry root yield per plant) remain underground up till uprooting.

Response of Chickpea (Cicer arietinum L.) Genotypes against Collar Rot Disease Caused by Sclerotium rolfsii Sacc.

Aims: Collar rot is a fast spreading and destructive disease and is becoming more serious at seedling stage causing rot at collar region especially in area where paddy based cropping system is followed. Lack of sources of resistant in present cultivar against Sclerotium rolfsii cause serious threat to chickpea production. Therefore, the present study was carried out to evaluate the chickpea genotypes against S. rolfsii to the identification of resistant sources for further breeding program. Study Design: Randomized Block Design (RBD) with two replications were used. Place and Duration of Study: Regional Rice Research Station, Navsari Agricultural University, Vyara, between October 2019 to April 2020. Methodology: Pathogen was isolated from infected collar region of chickpea plant by directly transfer of sclerotia and infected bits on potato dextrose agar (PDA) medium. After purification, pathogen was identified by observed the colony character and sclerotia formation. The morphological characters viz., mycelial growth and mycelial characteristic were studied under high power magnification (40X) and sclerotia formation, shape and colour were studied under low power magnification (10X) from 10 days old culture. 39 chickpea genotypes were used for the studies. A field experiment was conducted during Rabi -2019-20 season. The inoculum was thoroughly broadcasted in soil @ 10g/ row. Germination per cent and disease incidence were observed. Results: Chickpea (Cicer arietinum L.) collar rot disease caused by Sclerotium rolfsii Sacc. was exhibited initial white fluffy mycelium appearance on potato dextrose agar medium. Microscopic view of mycelium was hyaline, branching, compact with septate and had a clamp connection. White sclerotia were formed after 4th days of incubation and later within 10 days after incubation it became mature and colour changed from brown to dark brown. Sclerotia appeared shiny due to presence of gummy material. Out of 39 chickpea genotypes only five viz., GJG-1713, GG-6, GJG-1509, Phule Vikram and JGK-1 were identified as moderate resistant against collar rot disease caused by S. rolfsii under inoculums inoculated rice fellow cropping system. Conclusion: Chickpea genotypes viz., GJG-1713, GG-6, GJG-1509, Phule Vikram and JGK-1 were showed moderate resistant reaction against collar rot disease caused by S. rolfsii.

Fungal pathogens associated with wilting of Neolitsea cassia trees

Neolitsea cassia, a tree species, belongs to family Lauraceae, is endemic to Sri Lanka. Few planted trees of Neolitsea cassia were severely affected by wilt disease. Two fungal pathogens were consistently isolated from collar region and roots of symptomatic trees. These two fungal species were identified as Colletotrichum and Pestalotiopsis by microscopic observations of conidia and culture characters of isolates on PDA. This is the first report of Colletotrichum and Pestalotiopsis species causing tree wilting of Neolitsea cassia in Sri Lanka. Application of 25 l of fungicide, Thiram + Thiophanate Methyl, 50+30% WP (Homai) solution (1g/l) around the base of each infected plant as a soil drenching was effectively controlled wilting of Neolitsea cassia caused by both pathogenic fungi.

SURVEY ON THE INCIDENCE OF FUSARIUM WILT OF TOMATO INCITED BY FUSARIUM OXYSPORUM F.SP. LYCOPERSICI (FOL) IN MAJOR TOMATO GROWING AREAS OF KRISHNAGIRI DISTRICT

Tomato is one of the most important, commercial and widely grown vegetable crop in the world. It is affected by several fungal, bacterial and viral diseases. Among these Fusarium wilt caused by the fungus Fusarium oxysporum f.sp. lycopersici causes 30-40% yield loss. A survey was conducted to investigate the incidence and severity of Fusarium wilt incited by Fusarium oxysporum f.sp. lycopersici in ten major tomato growing areas of Krishnagiri district. The occurrence of wilt disease incidence ranged from 18 % to 49% was noticed. Plant showing typical symptoms were taken from 10 fields and identified based on symptom appearance as well as morphological characteristics. The result of the survey revealed that wide range of infection and severity of wilt disease were occurred in the major tomato growing areas in Krishnagiri district. Isolation of the pathogen associated with tomato wilt was made from the diseased tissues in roots and collar region of the plant on the Potato dextrose agar (PDA) medium. Fol3 recorded the maximum wilt incidence followed by Fol4 and the minimum wilt incidence was recorded by Fol6 . The pathogenicity of the fungal pathogen was also proved after artificial inoculation of the tomato seedlings

First report of Sclerotium rolfsii causing collar rot on Berseem (Trifolium alexandrinum) in India

Berseem (Trifolium alexandrinum) is a winter season legume fodder crop widely cultivated in the central and northern parts of India. It is considered the ‘King of fodder’ for its high quality green fodder, which is a rich source of protein and low in fibre. Symptoms similar to collar rot were observed in experimental sites at the ICAR-Indian Grassland and Fodder Research institute (IGFRI), Jhansi (N25º 52′ 749.20″, E78º 55′ 452.70″), Uttar Pradesh, India in March 2019. The incidence of disease was ranged from 18 to 22% during 2019. Symptoms included dark colored water-soaked lesions at the base of stems, stem thinning (resembles wire stem) and eventually wilting of the whole plant. A white mycelial mat was observed on the stem and collar region and light brown to tan colored sclerotial bodies formed as disease progressed. To determine the etiology of the infection, 30 diseased plants with typical symptoms were collected from the 3 different fields and used for the isolation of causal agent. Infected stem portion were cut in to small pieces (5mm), surface sterilized with 2% sodium hypochlorite (NaOCl) for 2 minutes, washed three times with sterile distilled water and air dried. The sterilized infected tissues were cultured on potato dextrose agar amended with streptomycin sulphate @ 50µg/ml and incubated at 28±1º C for 3 days. After four days, hyaline septate mycelia ranging 2-3µm in diameter grow radially over the whole plate (90 mm). Sclerotia formation started 6 days after incubation. Sclerotia were initially white and later turned brownish to tan as they matured. The number of sclerotia per plate ranged from 55 to 120 (n=5) at 12 days after inoculation. The diameter of matured sclerotial bodies ranged from 0.1mm to 1.35mm (n=25). Genomic DNA was extracted from mycelium using the CTAB method (Murray and Thompson, 1980). Three regions of rDNA viz., internal transcribed spacer (ITS), large subunit (LSU), and small subunit (SSU) were used to identify the etiology of the disease. The isolate was amplified with ITS1 (5’CGGATCTCTTGGTTCTGGGA3’)/ ITS4 (5’GACGCTCGAACATGCC3’) described by White et al. (1990) and sequenced. The ITS sequence (NCBI GenBank Accession No: MT026581) showed 98.21 % similar to Athelia rolfsii (MH514001.1). The isolate also amplified with primers LSU (LROR: ACCCGCTGAACTTAAGC/ LR5: TCCTGAGGGAAACTTCG) and SSU (NS1: GTAGTCATATGCTTGTCTC/ NS4: CTTCCGTCAATTCCTTTAAG). The LSU (MT225781) and SSU (MT225782) sequences showed 99.90 % and 100 % similarity to Athelia rolfsii (AY635773.1) and Athelia rolfsii (AY635773.1) respectively. Based on the morphological and molecular characteristics, the pathogen responsible for collar rot in berseem was identified as Athelia rolfsii (Anamorph: Sclerotium rolfsii) (Mordue, 1974). To confirm pathogenicity, inoculum was prepared by inoculating mycelial plugs of pathogen into autoclaved corn sand meal (5:95) and incubated at 28±1º C for 12 days. The inoculum (30g) was placed at stem portion of 15 day old seedlings (n=30) of berseem (Cv. Wardan) raised in pots filled with sterilized soil. Seedlings (n=25) inoculated with sterilized corn sand meal (30g) served as the control. The pots were placed inside of a plant growth chamber (26±2º C, 65% RH) for 15 days. Water soaked spots with white mycelium were observed on the collar region after 3 days. After 7 days, stems were completely covered by mycelia and death of seedlings was observed 14 days after inoculation. The pathogen was recovered from the artificially inoculated berseem seedlings (n=15). No symptoms were observed in control plants. Based on morphological and molecular characterization, the present isolate was confirmed as Sclerotium rolfsii. To the best of our knowledge, this is the first report of S. rolfsii causing collar rot of berseem in India.

Validation of Screening Technique for Cotton Bacterial Blight Resistance under Controlled Condition

Seven different methods of artificial inoculation such as 1. Carborundum injury, 2. Pin prick injury 3. Sand paper injury, 4. Syringe inoculation on lower surface of leaf without needle, 5. Syringe inoculation of veins on lower surface of leaf with needle, 6. Tooth picks inoculation on collar region and 7. Pressurized spray inoculation were evaluated to find out the efficient and precise screening method for cotton bacterial blight caused by Xanthomonas citri pv. malvacearum under controlled conditions (plant growth chamber). Inoculated seedlings were incubated at 28°C, 90% RH and 3000 LUX light intensity during day time and 22°C, 90% RH and absence of light during night time for symptom development. Among them, pin prick injury recorded maximum PDI (64.25) in 20-24 days post inoculation followed by sand paper injury (56.50 PDI) in 23-27 days post inoculation on 20 day old LRA 5166 cotton seedlings compared to other methods. Both these methods developed all types of symptoms. Initial symptom of water soaked lesion was appeared in 7-8 days post inoculation in pin prick injury while it was 9-10 days in sand paper injury.

PHYTOTOXICITY AND GROWTH OF COFFEE PLANTS AS A FUNCTION OF THE APPLICATION OF HERBICIDE 2,4-D

Weed control in coffee is of great importance for there is a great interference, standing out the competition for water, light and nutrients. Among the control methods, chemical control is highlighted as a function of its efficiency. However, the incorrect application of herbicides may imply the occurrence of drift, resulting in damage to coffee development due to phytotoxicity. In this context, the objective of this study was to evaluate the symptoms and phytotoxicity effects caused by the herbicide 2,4-D drift on the morphological, physiological and anatomical characteristics of coffee seedlings. The experiment was carried out in a greenhouse with ‘Topázio MG1190’ coffee seedlings (<em>Coffea arabica</em> L.), planted in 11-L pots. A randomized block design with four treatments and four replicates was used. The treatments were: 0%; 10%; 25% and 50% of the recommended commercial dose of 2,4-D (2.5 L.ha^-1). Each plot consisted of three plants. The evaluations were performed at 74 days after implantation. Morphological, physiological, anatomical and phytotoxicity symptoms were evaluated as a function of the simulated herbicide drift. Coffee seedlings intoxicated by the herbicide 2,4-D presented hyponastic, chlorosis, shriveling and leaf anomalies. In the orthotropic branch, bending was observed in its extension, besides thickening in the collar region; in the plagiotropic branch, cracking was observed. Herbicide drift negatively affects the development of coffee plants. The coffee physiology was affected as a function of herbicide drift, but without damage to the leaf anatomy.

Anatomy and Biochemical Study of Collar Rot Resistance in Eggplant

Disease reaction of three eggplant varieties (BAUBegun-1, BAUBegun-2 and Dohazari G) to collar rot (Sclerotium rolfsii) at early flowering stage, as well as the anatomy and biochemical effects of the infection on the collar region of the plant was studied. The plants were inoculated following soil inoculation technique, using barley culture of the pathogen. All the varieties were infected, with percentage infection ranging from 62.50 to 100%. Varieties varied in percent mortality (0.00 - 100). Plants of the eggplant variety BAUBegun-2, although infected, all regenerated and were graded resistant. The varieties Dohazari G and BAUBegun-1 were graded as susceptible. Anatomy and biochemical constituents, namely total phenols, ascorbic acid, total sugar, reducing sugar and Ca-oxalate contents of the collar region were investigated. BAUBegun-2 was characterized with thick cuticle, thick epidermal cells, many trichomes and smaller intercellular spaces in the cortex which could have restricted the entry of S. rolfsii into the cell. A higher level of biochemical activities was observed in eggplant var. BAUBegun-2. There was a clear correlation between anatomical features and biochemical constituents, and collar rot incidence. Anatomical features and biochemical constituents, as detected to be responsible for the resistance, could be used for the development of superior variety with resistance to collar rot.

A possible structural correlate of learning performance on a colour discrimination task in the brain of the bumblebee

Synaptic plasticity is considered to be a basis for learning and memory. However, the relationship between synaptic arrangements and individual differences in learning and memory is poorly understood. Here, we explored how the density of microglomeruli (synaptic complexes) within specific regions of the bumblebee ( Bombus terrestris ) brain relates to both visual learning and inter-individual differences in learning and memory performance on a visual discrimination task. Using whole-brain immunolabelling, we measured the density of microglomeruli in the collar region (visual association areas) of the mushroom bodies of the bumblebee brain. We found that bumblebees which made fewer errors during training in a visual discrimination task had higher microglomerular density. Similarly, bumblebees that had better retention of the learned colour-reward associations two days after training had higher microglomerular density. Further experiments indicated experience-dependent changes in neural circuitry: learning a colour-reward contingency with 10 colours (but not two colours) does result, and exposure to many different colours may result, in changes to microglomerular density in the collar region of the mushroom bodies. These results reveal the varying roles that visual experience, visual learning and foraging activity have on neural structure. Although our study does not provide a causal link between microglomerular density and performance, the observed positive correlations provide new insights for future studies into how neural structure may relate to inter-individual differences in learning and memory.

The AP-2 complex has a specialized clathrin-independent role in apical endocytosis and polar growth in fungi

Filamentous fungi provide excellent systems for investigating the role of the AP-2 complex in polar growth. Using Aspergillus nidulans, we show that AP-2 has a clathrin-independent essential role in polarity maintenance and growth. This is in line with a sequence analysis showing that the AP-2 β subunit (β2) of higher fungi lacks a clathrin-binding domain, and experiments showing that AP-2 does not co-localize with clathrin. We provide genetic and cellular evidence that AP-2 interacts with endocytic markers SlaBEnd4 and SagAEnd3 and the lipid flippases DnfA and DnfB in the sub-apical collar region of hyphae. The role of AP-2 in the maintenance of proper apical membrane lipid and cell wall composition is further supported by its functional interaction with BasA (sphingolipid biosynthesis) and StoA (apical sterol-rich membrane domains), and its essentiality in polar deposition of chitin. Our findings support that the AP-2 complex of dikarya has acquired, in the course of evolution, a specialized clathrin-independent function necessary for fungal polar growth.