scholarly journals First Detection of Wheat dwarf virus in Barley in Spain Associated with an Outbreak of Barley Yellow Dwarf

Plant Disease ◽  
2006 ◽  
Vol 90 (7) ◽  
pp. 970-970 ◽  
Author(s):  
M. A. Achon ◽  
L. Serrano ◽  
C. Ratti ◽  
C. Rubies-Autonell
Keyword(s):  
Mosaic Virus ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Yellow Mosaic Virus ◽  
Wheat Dwarf Virus ◽  
Rt Pcr ◽  
Crop Failure ◽  
Specific Primers ◽  
Barley Yellow Dwarf ◽  
Yellow Dwarf Virus

Severe dwarfing, yellowing, and crop failure were observed on barley in northeastern Spain during March and April of 2003. Leaves from 106 plants collected from 15 barley fields were analyzed using enzyme-linked immunosorbent assay (ELISA) with commercial antisera (Loewe Biochemica, Munich) specific for Barley mild mosaic virus (BaMMV), Barley yellow mosaic virus (BaYMV), the PAV and MAV serotypes of Barley yellow dwarf virus (BYDV), Barley yellow striate mosaic virus (BYSMV), Barley stripe mosaic virus (BSMV), Brome mosaic virus (BMV), Brome streak mosaic virus, (BStMV), Cereal yellow dwarf virus (CYDV), Wheat streak mosaic virus (WSMV), Wheat spindle streak mosaic virus (WSSMV), Soilborne cereal mosaic virus (SBCMV), and Wheat dwarf virus (WDV). In 70 samples, BYDV-PAV was the sole virus detected; in 20 other samples, this virus was detected in association with WDV, WSMV, BaMMV, and/or BaYMV. Mixed infections were further analyzed using reverse transcriptase-polymerase chain reaction (RT-PCR) or PCR with specific primers that amplify 445 bp of BaMMV (3), 433 bp of BaYMV (1), 600 bp of WSMV (primer 1: 5′CGAAACGCAGCG TTATTTC3′, primer 2: 5′CATCTGAAG GGCTTGACG3′), and 1,200 bp of WDV (4). Eight samples gave the expected amplicons for WDV, two samples gave the expected amplicon for BaMMV, and one sample gave the BaMMV and BaYMV amplicons. No samples gave the amplicon for WSMV. In addition, 10 samples that were positive with ELISA for BYDV, either as a single or as multiple infections with other viruses, were analyzed with specific primers that amplify 600 bp of the BYDV genome (2) and all gave the expected RT-PCR product. ELISA and RT-PCR results agreed completely for WDV and BYDV samples, but agreed poorly for BaMMV and BaYMV (three of seven ELISA-positive samples). PCR products of WDV were subsequently cloned and sequenced. Sequence analysis confirmed the presence of WDV in these barley samples. This report shows the high occurrence of BYDV in barley fields and its association with BaMMV, BaYMV, and WDV infections that induces barley crop failure. To our knowledge, this is the first detection of WDV in Spain. References: (1) M. A. Achon et al. Plant Dis.87:1004, 2003. (2). E. S. G. Canning et al. J. Virol. Methods 56:191, 1996. (3) D. Hariri et al. Eur. J. Plant Pathol. 106:365, 2000. (4) A. Kvarnheden et al. Arch Virol. 147:206, 2002.

scholarly journals Double Infection of Onion yellow dwarf virus and Shallot latent virus in Garlic from Several Regions in Indonesia

2021 ◽  
Vol 25 (1) ◽  
pp. 40
Author(s):  
Nurenik Nurenik ◽  
Sedyo Hartono ◽  
Sri Sulandari ◽  
Susamto Somowiyarjo ◽  
Argawi Kandito
Keyword(s):  
Early Detection ◽  
Latent Virus ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Onion Yellow Dwarf Virus ◽  
Rt Pcr ◽  
Double Infection ◽  
Specific Primers ◽  
Shallot Latent Virus ◽  
Yellow Dwarf Virus

Viruses have been a problem on garlic cultivations in various countries. There are several viruses reported infecting garlic. Genera Potyvirus and Carlavirus are the most common viruses found infecting garlic. Mixed infection on garlic is often designated as a “garlic viral complex”. These viruses can be transmitted through imported garlic seeds. Therefore, it is necessary to conduct early detection of garlic seeds to prevent the epidemic of these viruses. This study aimed to detect Onion yellow dwarf virus (OYDV) and Shallot latent virus (SLV) on garlic. Garlic samples were obtained from Enrekang, Magelang, Temanggung, Tawangmangu, and Yogyakarta. Total RNA was extracted from the samples and subsequently used for RT-PCR using two pairs of specific primers SLV-F/SLV-R and OYDV-F/OYDV-R. Primary pair SLV-F/SLV-R in amplicons sized 276 bp, while OYDV-F/OYDV-R in amplicons sized 112 bp. RT-PCR results showed that OYDV was found in all samples tested in this study. Meanwhile, double infections (OYDV and SLV) were found in eight out of ten samples tested. These results indicated that double infections on garlic were common in Indonesia.

scholarly journals Status and Epidemiology of Maize Lethal Necrotic Disease in Northern Tanzania

Pathogens ◽  
2019 ◽  
Vol 9 (1) ◽  
pp. 4 ◽  
Author(s):  
Fatma Hussein Kiruwa ◽  
Samuel Mutiga ◽  
Joyce Njuguna ◽  
Eunice Machuka ◽  
Senait Senay ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Plant Diseases ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Maize Dwarf Mosaic Virus ◽  
Rt Pcr ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Yellow Dwarf Virus

Sustainable control of plant diseases requires a good understanding of the epidemiological aspects such as the biology of the causal pathogens. In the current study, we used RT-PCR and Next Generation Sequencing (NGS) to contribute to the characterization of maize lethal necrotic (MLN) viruses and to identify other possible viruses that could represent a future threat in maize production in Tanzania. RT-PCR screening for Maize Chlorotic Mottle Virus (MCMV) detected the virus in the majority (97%) of the samples (n = 223). Analysis of a subset (n = 48) of the samples using NGS-Illumina Miseq detected MCMV and Sugarcane Mosaic Virus (SCMV) at a co-infection of 62%. The analysis further detected Maize streak virus with an 8% incidence in samples where MCMV and SCMV were also detected. In addition, signatures of Maize dwarf mosaic virus, Sorghum mosaic virus, Maize yellow dwarf virus-RMV and Barley yellow dwarf virus were detected with low coverage. Phylogenetic analysis of the viral coat protein showed that isolates of MCMV and SCMV were similar to those previously reported in East Africa and Hebei, China. Besides characterization, we used farmers’ interviews and direct field observations to give insights into MLN status in different agro-ecological zones (AEZs) in Kilimanjaro, Mayara, and Arusha. Through the survey, we showed that the prevalence of MLN differed across regions (P = 0.0012) and villages (P < 0.0001) but not across AEZs (P > 0.05). The study shows changing MLN dynamics in Tanzania and emphasizes the need for regional scientists to utilize farmers’ awareness in managing the disease.

scholarly journals Barley yellow dwarf virus and Cereal yellow dwarf virus Quantification by Real-Time Polymerase Chain Reaction in Resistant and Susceptible Plants

2003 ◽  
Vol 93 (11) ◽  
pp. 1386-1392 ◽  
Author(s):  
Boovaraghan Balaji ◽  
Dennis B. Bucholtz ◽  
Joseph M. Anderson
Keyword(s):  
Real Time ◽  
Barley Yellow Dwarf Virus ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Wheat Line ◽  
Rt Pcr ◽  
Chain Reaction ◽  
Barley Yellow Dwarf ◽  
Polymerase Chain ◽  
Yellow Dwarf Virus

Reliable detection and quantification of barley and cereal yellow dwarf viruses (YDVs) is a critical component in managing yellow dwarf diseases in small grain cereal crops. The method currently used is enzyme-linked immunosorbent assay (ELISA), using antisera against the coat proteins that are specific for each of the various YDVs. Recently, quantitative real-time reverse-transcription polymerase chain reaction (Q-RT-PCR) has been used to detect bacterial and viral pathogens and to study gene expression. We applied this technique to detect and quantify YDVs using primers specific for Barley yellow dwarf virus-PAV (BYDV-PAV) and Cereal yellow dwarf virus-RPV (CYDV-RPV) coat protein genes because of the higher sensitivity of RT-PCR and the advantage of using a real-time PCR instrument. This Q-RT-PCR was used to detect BYDV and CYDV, and to examine disease development in a resistant wheatgrass, a resistant wheat line, a susceptible wheat line, and a susceptible oat line. BYDV-PAV and CYDV-RPV were detected as early as 2 and 6 h, respectively, in susceptible oat compared with detection by ELISA at 4 and 10 days postinoculation. BYDV-PAV RNA accumulated more rapidly and to a higher level than CYDV-RPV RNA in both oat and wheat, which may account for PAV being more prevalent and causing more severe viral disease than CYDV. Q-RT-PCR is reproducible, sensitive, and has the potential to be used for examining yellow dwarf disease and as a rapid diagnostic tool for YDVs.

scholarly journals First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 849-849 ◽  
Author(s):  
E. S. Mustafayev ◽  
L. Svanella-Dumas ◽  
S. G. Kumari ◽  
Z. I. Akparov ◽  
T. Candresse
Keyword(s):  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
The United States ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Crops ◽  
Cereal Yellow Dwarf Virus ◽  
Barley Yellow Dwarf ◽  
Nucleotide Divergence ◽  
Yellow Dwarf Virus

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.

scholarly journals Occurrence of Winter Cereal Viruses in New South Wales, Australia, 2006 to 2014

Plant Disease ◽  
2016 ◽  
Vol 100 (2) ◽  
pp. 313-317 ◽  
Author(s):  
Andrew Milgate ◽  
Dante Adorada ◽  
Grant Chambers ◽  
Mary Ann Terras
Keyword(s):  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
New South ◽  
New South Wales ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Winter Cereal ◽  
Barley Yellow Dwarf ◽  
South Wales ◽  
Yellow Dwarf Virus

Winter cereal viruses can cause significant crop losses; however, detailed knowledge of their occurrence in New South Wales, Australia is very limited. This paper reports on the occurrence of Wheat streak mosaic virus (WSMV), Wheat mosaic virus (WMoV), Barley yellow dwarf virus (BYDV), Cereal yellow dwarf virus (CYDV), and their serotypes between 2006 and 2014. Detection of WMoV is confirmed in eastern Australia for the first time. The BYDV and CYDV 2014 epidemic is examined in detail using 139 samples of wheat, barley, and oat surveyed from southern New South Wales. The presence of virus was determined using enzyme-linked immunosorbent assays. The results reveal a high frequency of the serotype Barley yellow dwarf virus - MAV as a single infection present in 27% of samples relative to Barley yellow dwarf virus - PAV in 19% and CYDV in 14%. Clear differences emerged in the infection of different winter cereal species by serotypes of BYDV and CYDV. These results are contrasted to other Australian and international studies.

scholarly journals First Report of Barley yellow dwarf virus-MAV in Oat, Wheat, and Barley Grown in the Czech Republic

Plant Disease ◽  
2009 ◽  
Vol 93 (9) ◽  
pp. 964-964 ◽  
Author(s):  
J. K. Kundu
Keyword(s):  
Czech Republic ◽  
Barley Yellow Dwarf Virus ◽  
Virus Disease ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Crops ◽  
Rt Pcr ◽  
The Czech Republic ◽  
Barley Yellow Dwarf ◽  
Yellow Dwarf Virus

Barley yellow dwarf disease, a ubiquitous virus disease of cereal crops worldwide, is caused by a group of related, single-stranded RNA viruses assigned to Luteovirus (Barley yellow dwarf virus [BYDV] spp. PAV, PAS, MAV, and GAV) or Polerovirus (Cereal yellow dwarf virus-RPV) genera or unassigned to a genera (BYDV-SGV, BYDV-RMV, and BYDV-GPV) in the family Luteoviridae (1). Incidence of BYDV in cereal crops (e.g., barley, wheat, and oats) was high, and in recent years, reached epidemic levels in many regions of the Czech Republic. BYDV-PAV and BYDV-PAS have been identified in Czech cereal crops (2,4). Surveys of the incidence of BYDV were carried out using ELISA (SEDIAG SAS, Longvic, France) and one-step reverse transcription (RT)-PCR (Qiagen, Hilden, Germany) (2) during 2007 and 2008. Samples (125) were collected from different fields around the Czech Republic and 96 were BYDV positive. Three of the field isolates, CZ-6815, CZ-1561, and CZ-10844, from oat (Avena sativa; cv. Auron), winter wheat (Triticum aestivum; cv. Apache), and winter barley (Hordeum vulgare; cv. Merlot), respectively, were identified as BYDV-MAV by sequencing of the RT-PCR product (641-bp fragment) used to identify BYDV, which spanned 2839–3479 of the BYDV genome (GenBank Accession Nos. EF043235 and NC_002160) (2). The partial coat protein gene sequence of 483 nt was compared with the available sequences of 12 BYDV-PAV isolates (PAV-JP, PAV-NY, PAV-ILL, PAV-AUS, PAV-WG2, PAV-whG4y3, PAV-on21-4, Tahoe1, CA-PAV, HB3, FH3, and MA9501); nine BYDV-PAS isolates (PAS-129, PAS-64, WS6603, WG13, PAS-Tcb4-1, PASwaw5-9, FL2, PAS-Vd29, and PAS-MA9516); and six BYDV-MAV isolates (MAV-CA, MAV-PS1X1, MAV-Alameds268, LMB2a, SI-o4, and MAV-CN) by MEGA4 (3). Nucleotide and amino acid sequence identities for the three isolates ranged from 92.9 to 99.4% and 88.0 to 95.8%, respectively, for available BYDV-MAV isolates; 76.8 to 78.2% and 62.7 to 67.6%, respectively, for available BYDV-PAS isolates; and 77.6 to 79.3% and 65.5 to 70.4%, respectively, for available PAV isolates. The sequence data indicates that these isolates (CZ-6815, CZ-1561, and CZ10844; GenBank Accession Nos. FJ645747, FJ645758, and FJ645746, respectively) are BYDV-MAV. To my knowledge, this is the first record of BYDV-MAV in the Czech Republic. References: (1) C. J. D'Arcy and L. L. Domier. Page 891 in: Virus Taxonomy-8th Report of the ICTV. C. M. Fauquet et al., eds. Springer-Verlag, NY, 2005. (2) J. K. Kundu. Plant Dis. 92:1587, 2008. (3) K. Tamura et al. Mol. Biol. Evol. 24:1596, 2007. (4) J. Vacke. Page 100 in: Sbornik Referatu z Odborneho Seminare, Aktualni Problemy Ochrany Polnich Plodin, Praha, 1991.

scholarly journals Occurrence and molecular characterization of wheat streak mosaic virus in wheat in Serbia

2020 ◽  
Vol 35 (2) ◽  
pp. 117-131
Author(s):  
Ana Vucurovic ◽  
Ivana Stankovic ◽  
Katarina Zecevic ◽  
Branka Petrovic ◽  
Goran Delibasic ◽  
...  
Keyword(s):  
Phylogenetic Analysis ◽  
Mosaic Virus ◽  
Wheat Streak Mosaic Virus ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Streak Virus ◽  
Nucleotide Position ◽  
Rt Pcr ◽  
Cp Gene ◽  
Yellow Dwarf Virus

The wheat streak mosaic virus (WSMV), vectored by the wheat curl mite, is globally distributed and threatens wheat production worldwide. Since its first occurrence in Serbia in the 1960s, WSMV presence has not been monitored. In 2019, a total of 62 samples of fi ve wheat cultivars from eight locations in Serbia were collected and tested for the presence of nine common wheat viruses: WSMV, barley yellow dwarf virus-PAV, -MAV, -SGV, and -RMV, cereal yellow dwarf virus-RPV, wheat spindle streak virus, brome mosaic virus, and soil-borne wheat mosaic virus, using individual or multiplex RT-PCR. WSMV was detected in 58.1% of the tested samples in seven wheat crops at five different locations. Species-specific primers failed to detect the presence of the other eight tested viruses. For further confirmation of WSMV, RT-PCR with the WS8166F/WS8909R primers covering the coat protein (CP) gene was carried out for both amplification and sequencing. The amplified product of the correct predicted size (750 bp) derived from four selected isolates, 98-19, 99-19, 102-19 and 120-19, was sequenced and deposited in GenBank (MT461299, MT461300, MT461301 and MT461302, respectively). Serbian WSMV isolates showed very high nucleotide identity (98.16-99.02%) and shared a deletion of triplet codon GCA at nucleotide position 8412- 8414 resulting in deletion of glycine amino acid (Gly2761). Phylogenetic analysis conducted on CP gene sequences revealed the existence of four clades, named A, B, C and D, and one recently introduced clade B1. All Serbian wheat WSMV isolates grouped into clade B together with other European isolates and one isolate from Iran. The results of this study provide the first insight into molecular characterisation of Serbian WSMV isolates, indicating their close relationship with other European isolates and existence of a single genotype in the country. Phylogenetic analysis also confirms the dispersal of WSMV isolates throughout Europe from a single locus.

Sign in / Sign up

Export Citation Format

Share Document