scholarly journals First report of watermelon crinkle leaf-associated virus 1 and 2 infecting watermelon (Citrullus lanatus) plants in Brazil

Plant Disease ◽  
2021 ◽  
Author(s):  
Matheus Hideki Kihara Maeda ◽  
Lucas Hideo Hataka Koyama ◽  
Ravi Narayan Souza Campos ◽  
Caterynne Melo Kauffmann ◽  
Juliana Osse de Souza ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
De Novo ◽  
Citrullus Lanatus ◽  
Plant Viruses ◽  
Rt Pcr ◽  
Specific Primers ◽  
Consensus Sequences ◽  
Two Samples ◽  
The Usa ◽  
Tblastx Search

Watermelon (Citrullus lanatus) is an important crop in Brazil both for export and domestic consumption. In this study, the cause of a severe leaf curling, distortions and vein clearing/yellowing disease of watermelon was investigated by high-throughput sequencing (HTS). The RNA extract of virus semi-purification preparation (Blawid et al., 2017) from leaf samples of 10 symptomatic plants collected from a commercial field in Juazeiro, Bahia state in May 2019, were pooled. Then, cDNA prepared with TruSeq Stranded Total RNA with Ribo-Zero Plant Kit (Illumina, San Diego, USA) was analyzed by HTS using Novaseq with 100 paired ends of 3G scale (~31M reads). De novo assembly of total reads was performed using Megahit (Li et al., 2015), and the tBlastX search against the RefSeq Virus Genomes (NCBI) was done using Geneious 11.1 program (Biomatters, Auckland, New Zealand). Reads of groundnut ringspot virus (GRSV) were identified, in addition to those of watermelon crinkle leaf-associated virus 1 (WCLaV-1, LC636070-72) and 2 (WCLaV-2, LC636073-75), which are putative members of the genus Coguvirus in the family Phenuiviridae (Zhang et al. 2021) and have not been reported in Brazil. Other plant viruses were not found. The means of read coverage over the genes were from 1652 to 2532 for WCLaV-1 and from 404 to 1025 for WCLaV-2. These viruses were recently reported infecting watermelon in China (Xin et al., 2017) and the USA (Hernandez et al., 2021). The nucleotide identities between consensus sequences of isolates from Brazil and reference sequences of the WCLaV-1 KF-1 isolate from China (KY781184-86) were 99.0% in RdRp, 98.9% in nucleocapsid (NC) and 99.1% in putative movement protein (MP) genes, and between the WCLaV-2 KF-15 isolate from China (MW559083-91) and the sequences from Brazil, 97.2% in RdRp, 96.6% in NC and 96.9% in putative MP genes. To confirm the presence of these viruses in individual samples, RT-PCR was conducted with specific primers to WCLaV-1 (WCLaV-1vNP and WCLaV-1cMP) and WCLaV-2 (WCLaV-2vNP and WCLaV-2cMP) (Hernandez et al., 2021), targeting the NC protein genes with the expected amplicon sizes of 786 and 449 nt, respectively. In addition, GRSV-specific primers (GRSVS: GTGCATCATCCATTGTAAATCC and GRSVA: CGCCAAAGCATCATGAAAG), targeting the NC protein gene, with the expected amplicon size of 445 nt, were also used in the test. Twelve samples from watermelon plants with similar symptoms were analyzed by RT-PCR, six from a field in Mossoró, Rio Grande do Norte state collected in 2020, and six from the same field in Juazeiro, Bahia sampled in 2019. All plants from both locations were positive for WCLaV-1 and GRSV in RT-PCR tests, whereas two samples from Juazeiro were positive for WCLaV-2. Six cDNA fragments (two from Mossoró and two from Juazeiro for WCLaV-1 and two WCLaV-2 from Juazeiro) were sequenced (MZ819081-6) and showed very high identities within the species among them (99.8% to 100%). Finally, leaf samples were also collected from watermelon plants with these symptoms in Guadalupe County, Piaui State in 2015. An HTS analysis of this sample was conducted at the University of California Davis and revealed infection with a divergent strain of GRSV and WCLaV-1 (LC636068-9), but not WCLaV-2. The nucleotide identities between consensus sequences of isolates from Piauí and Juazeiro were 99.9% in RdRp and NC, and 100% in putative MP genes. These results indicate that WCLaV-1 and WCLaV-2 are present in Brazil in association with severe virus-like disease symptoms in watermelon plants.

scholarly journals First report of Melon aphid-borne yellows virus infecting watermelon in Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Hee-Seong Byun ◽  
Hong-Soo Choi ◽  
Hyun Ran Kim ◽  
Hae-Ryun Kwak ◽  
Eui-Joon Kil ◽  
...  
Keyword(s):  
De Novo ◽  
Citrullus Lanatus ◽  
Plant Viruses ◽  
Rt Pcr ◽  
Genome Database ◽  
Total Rna ◽  
First Report ◽  
Two Samples ◽  
Primer Sets ◽  
Melon Aphid

Watermelon (Citrullus lanatus) is one of the most popular crops in Korea, with over 100 million units produced annually. As watermelon cultivation increases, the damage caused by plant viruses in watermelon farms is also increasing. In July 2020, some watermelons cultivated on farms in Uiryeong showed typical viral symptoms, such as yellowing and necrosis. In previous studies, two plant viruses, cucurbit aphid-borne yellows virus (CABYV) and cucurbit chlorotic yellows virus (CCYV), have been reported as causal agents of yellowing disease in the cucurbitaceae plant in Korea. To identify the virus(es) associated with the symptomatic watermelon plants, 11 samples were collected. Total RNA was extracted from each sample using the Plant RNA Prep kit (Biocube System, Gwacheon, Korea). RT-PCR was performed using primer sets specific to CABYV and CCYV to detect each virus (Kwak et al. 2018, Wintermantel et al. 2019). CABYV was detected in one sample, and CCYV was detected in 8 samples. Every sample presented similar yellowing symptoms; however, neither virus was detected in the remaining two samples. To investigate unknown viruses, a transcriptome library was constructed using total RNA of the watermelons and sequenced using a NovaSeq 6000 sequencer (Illumina, San Diego, CA). The reads were de novo assembled and annotated using the KEGG virus genome database with the NCBI BLAST utility. All procedures of next generation sequencing were performed by Macrogen (Seoul, Korea). Three large viral contigs were identified, and additional BLAST analyses for nucleotides (nt) and proteins indicated that they were CABYV, CCYV, and melon aphid-borne yellows virus (MAYBV). A total of 247,198 reads were mapped to reference MABYV sequence (GenBank Accession Number NC_010809), and the sequencing depth was 6,575X. The contig (MW505927) had a size of 5,677 nt and showed 100% coverage and 96% identity with known complete MABYV sequences (JQ700307 and EU000534). To confirm the presence of MABYV, RT-PCR was performed using specific primer sets targeting MABYV (MABYV-262-F, 5ʹ-GAACCGTCGACGCACTTCAAAGAGTA-3ʹ and Polero-uni-R, 5ʹ-GATYTTATAYTCATGGTAGGCCTTGAG-3ʹ; Knierim et al. 2010). The expected size of 262 bp was obtained from 5 out of 11 samples, including the two samples mentioned above. MABYV belongs to the genus Polerovirus and has been reported in cucurbit crops in China, Taiwan, and Thailand (Xiang et al. 2008, Knierim et al. 2010, Cheewachaiwit et al. 2017). According to the farmer, outbreak of aphids had previously occurred and were controlled with pesticides. Since aphids are known to be vectors of poleroviruses, we surmise that the watermelons were infected with MABYV by the aphids at that time. To monitor the outbreak of MABYV, watermelon farms in Uiryeong will be continuously investigated. To our knowledge, this is the first report of MABYV in Korea.

scholarly journals The occurrence of strawberry virus 1 infecting strawberry in Shandong province, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Chengyong He ◽  
Dehang Gao ◽  
Lingjiao Fan ◽  
Tengfei Xu ◽  
Fei Xing ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
De Novo ◽  
Shandong Province ◽  
Post Inoculation ◽  
Rt Pcr ◽  
Illumina Hiseq ◽  
Total Rna ◽  
Sodium Phosphate Buffer ◽  
Strawberry Vein Banding Virus ◽  
Two Samples

Strawberry (Fragaria × ananassa Duch.) is one of the most important horticultural plants worldwide with high economic and nutritional value. Strawberry associated virus 1 (SaV1) is a putative Cytorhabdovirus isolated from strawberry in Fujian province, China (Ding et al., 2019). Strawberry virus 1 (StrV-1) is another putative Cytorhabdovirus characterized from F. ananassa and F. vesca in Czech Republic (Fránová et al., 2019). The complete genomes of isolates of SaV1 and StrV-1 share 79 to 98% nucleotide (nt) identities. In August 2020, foliar chlorotic spots or streaks were observed in four strawberry cultivars (cv. Honeoye, Mibao, 8128 and All Star) in Yantai, Shandong province, China. To identify the associated viruses, symptomatic leaves from two plants of each cultivar (8 samples) were pooled for high-throughput sequencing (HTS). Total RNA was extracted from the composite sample and used for constructing a cDNA library after ribosomal RNA (rRNA)-depletion. Sequencing was carried out on Illumina Hiseq 4000 (Novogene, China). Raw reads were filtered, trimmed and de novo assembled as described previously (Grabherr et al., 2013; Zhou et al. 2020). The resulting contigs were screened by BLASTn and BLASTx against GenBank database. Subsequent analyses indicated the presence of strawberry vein banding virus, strawberry pallidosis associated virus and strawberry mottle virus in the analyzed sample, which had been reported previously in strawberry (Martin and Tzanetakis, 2013; Shi et al., 2018; Bhagwat et al., 2016). Besides, five contigs ranging from 266 to 6,057 nt were obtained. They shared 87 to 91% nt sequence identity with StrV-1 isolate B (GenBank accession no. MK211271). To confirm StrV-1 infection in the strawberry plants, total RNA was isolated from all eight samples using RNAprep Pure Plant Plus Kit (Tiangen, China). Reverse transcription polymerase chain reaction (RT-PCR) was conducted with two pairs of specific primers StrVp1 (Forward: 5ʹ-CATTACTGAAGCATTCCGTG-3′/Reverse: 5ʹ-AGATATCACGCACAGTGAC-3ʹ), and StrVp2 (Forward: 5ʹ-TTGCGCGAAGCGGATGTCCG-3′/Reverse: 5ʹ-GGCTGCCAGAGCGTTGGATG-3ʹ), targeting nt positions 70-1,231 and 7,825-9,348 of StrV-1 isolate B, respectively. Fragments with the expected sizes were amplified from two samples of cv. All Star. The amplicons were cloned, sequenced, and deposited in GenBank under accession no. MW419123-124 and MW645247-248. Both protein encoding sequences shared 91 to 92% and 80 to 84% nt identities with the corresponding sequences of StrV-1 isolate B and SaV1, respectively, indicating that the isolates from this study are genetic variants of StrV-1 and distantly related to SaV1. Crude sap was prepared by homogenizing leaf tissues of StrV-1 infected strawberry in 0.02 mol/L sodium phosphate buffer with 0.45% (w/v) sodium diethyldithiocarbamate thihydrate, then gently rubbed onto five healthy Nicotiana benthamiana plants. Neither the inoculated leaves nor the systemically infected leaves showed obvious symptoms seven days post inoculation. However, StrV-1 was detected by RT-PCR in all five N. benthamiana plants as described above. In addition, a survey of strawberry greenhouses was conducted in August 2020 and approximately 10% of plants in a 667 m2 greenhouse in Yantai had StrV-1-like symptoms. To the best of our knowledge, this is the first report of the occurrence of StrV-1 infecting strawberry in Shandong province, China. Our findings expand the geographic range and genetic diversity of StrV-1 and indicate it could be a potential virus threat to strawberry production in China.

scholarly journals First report of Cherry virus F infecting Japanese plum in Korea

Plant Disease ◽  
2020 ◽  
Author(s):  
Yeonhwa Jo ◽  
Hoseong Choi ◽  
Jin Kyong Cho ◽  
Won Kyong Cho
Keyword(s):  
Czech Republic ◽  
High Throughput Sequencing ◽  
Prunus Avium ◽  
De Novo ◽  
Protein Database ◽  
Specific Primers ◽  
The Czech Republic ◽  
First Report ◽  
Japanese Plum ◽  
Leaf Spots

Cherry virus F (CVF) is a tentative member of the genus Fabavirus in the family Secoviridae, consisting of two RNA segments (Koloniuk et al. 2018). To date, CVF has been documented in only sweet cherry (Prunus avium) in the Czech Republic (Koloniuk et al. 2018), Canada, and Greece. In May 2014, we collected leaf samples from four symptomatic (leaf spots and dapple fruits) and two asymptomatic Japanese plum cultivars (Sun and Gadam) grown in an orchard in Hoengseong, South Korea, to identify viruses and viroids infecting plum trees. Total RNA from individual plum trees was extracted using two commercial kits: Fruit-mate for RNA Purification Kit (Takara, Shiga, Japan) and RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). We generated six mRNA libraries from the six different plum cultivars for RNA-sequencing using the TruSeq RNA Library Preparation Kit v2 (Illumina, CA, U.S.A.) as described previously (Jo et al. 2017). The mRNA libraries were paired-end (2 X 100 bp) sequenced with a HiSeq 2000 system (Macrogen, Seoul, Korea). The raw sequence reads were de novo assembled by Trinity program v. 2.8.6, with default parameters (Haas et al. 2013). The assembled contigs were subjected to BLASTX search against the non-redundant protein database in NCBI. Of the two asymptomatic cultivars, the transcriptome of asymptomatic plum cv. Gadam contained five contigs specific to CVF. Two and three contigs were specific to CVF RNA1 (2,571 reads, coverage 42.15%) and RNA2 (2,025 reads, coverage 53.04%), respectively. The size of these five contigs ranged from 241 to 5,986 bp. Contigs of 5,986 and 3,867 bp in length, referred to as CVF isolate Gadam RNA1 (GenBank MN896996) and RNA2 (GenBank MN896995), respectively, were subjected to BLASTP search against NCBI’s non-redundant protein database. The results showed that the polyprotein sequences of RNA1 and RNA2 shared 95.3% and 93.11% amino acid identities with isolates SwC-H_1a from the Czech Republic (GenBank acc. no. AWB36326) and Stac-3B_c8 from Canada (AZZ10055), respectively. To confirm the infection of CVF in cv. Gadam, RT-PCR was conducted using CVF RNA1-specific primers designed based on the CVF reference genome sequences (MH998210 and MH998216), including 5’-CCACCAAATAGGCAAGAGGTCAC-3’ (position 3190–3212) and 5’-CACAATCACCATCAATGGTCTCTGC-3’ (position 3742–3766), and CVF RNA2-specific primers, including 5’-CTGCTTTATGATGCTAGACATCAAGATG-3’ (position 1015–1042) and 5’-ACAATAGGCATGCTCATCTCAACCTC-3’ (position 1594–1619). We amplified 577-bp RNA1-specific and 605-bp RNA2-specific amplicons that were cloned and then performed Sanger sequencing. Sequencing of the cloned amplicons for isolate Gadam RNA1 (GenBank MN896993) and RNA2 (GenBank MN896994) revealed values of 99.48% and 99.17% nucleotide identity to that of RNA1 and RNA2 determined by high-throughput sequencing, respectively. Additionally, we tested five plants for each of the six plum cultivars grown in the same orchard. The detection of CVF was carried out through PCR using the primers and protocol described above. Of the 30 trees, CVF was detected in three trees of cv. Gadam by both primer pairs. To our knowledge, this is the first report of CVF infecting Japanese plum and the first report of the virus in Korea. However, its prevalence in other Prunus species, including apricot, European plum, and peach, should be further elucidated.

scholarly journals Cucurbit chlorotic yellows virus infecting Rehmannia glutinosa was detected in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Kun Zhang ◽  
Xinjian Zhuang ◽  
Xiao Guo ◽  
Hongmei Xu ◽  
Zhen He ◽  
...  
Keyword(s):  
De Novo ◽  
Viral Disease ◽  
Henan Province ◽  
Plant Sample ◽  
Herbaceous Plant ◽  
Rehmannia Glutinosa ◽  
Rt Pcr ◽  
Illumina Hiseq ◽  
Two Samples ◽  
Cucurbit Chlorotic Yellows Virus

Rehmannia glutinosa Libosch. is a perennial herbaceous plant of the family Scrophulariaceae. Its roots can be used as traditional Chinese medicine. The asexual reproduction by vegetative organ of R. glutinosa lead to an increased viral disease that seriously affects its yield and quality (Kwak et al. 2020; Kwak et al. 2018; Ling and Liu 2009). Leaves of R. glutinosa in Wenxian County, Henan Province, China showed symptoms of chlorosis, mosaic and irregular yellow in August 2019. In general, the older leaves at the base or middle of the plant (sample 2# and 5#) first became irregular yellowing, followed by a gradual extend to the leaves at the top (Supplementary Fig. S1A). Six plants (2#, 3#, 5#, 7#, 8#, and 9#) with these symptoms were collected. The total RNA was extracted and its siRNAs were obtained. High-throughput siRNA sequencing (Sangon, Shanghai, China) was performed on Illumina Hiseq 2000 platform with paired-end method after siRNA library construction (NEBNext Ultra II RNA Library Prep Kit, NEB, UK). Sequencing files were treated with Illumina’s CASAVA pipeline (version 1.8). The length of the resulting reads with adaptor removed were mostly distributed ranging from 21-24 nt (Supplementary Fig. S1B). The Velvet Software 0.7.31 (k=17) was taken to do de novo assembling, and the contigs (∼13,000, Contigs > 300 bp) were used to perform BLASTN against GenBank database. Two viruses, Rehmannia mosaic virus (ReMV) and cucurbit chlorotic yellows virus (CCYV), were frequently appeared in analyzed six symptomatic samples. To further identify the infection of CCYV to R. glutinosa, ten samples with virus-infected symptoms were randomly collected. Total protein and RNAs were extracted for RT-PCR and ELISA (HALING. Shanghai, China). A specific pair of primers (Supplementary Table S1) were designed to amplify the 753-bp length coat protein (CP) gene of CCYV. The result showed that two samples appeared a specific band of expected size on the agarose gel, which indicated that they were infected by CCYV (Supplementary Fig. S1C, Upper panel). The same result was obtained by ELISA assay (Supplementary Fig. S1D). The amplified CP fragment of CCYV was recycled and purified by TIANgel Midi Purification Kit (Tiangen, Beijing, China), followed by cloned into pMD19-T (TaKaRa, Dalian, China) and transformed into E. coli DH5a.Ten separate clones were selected and sequenced (Sangon, Shanghai, China) after PCR verification. The obtained sequences (GenBank accession No. MW521380 & MW521381) were analyzed by BLASTN and bioEdit software (version 7.2.3). The results showed 100% identity with the CCYV CP sequences that mainly derived from infected cucurbit. To confirm the occurrence and distribution of CCYV and ReMV in planting area, the other twenty-four samples (20 with chlorosis and stunt symptoms and 4 with invisible symptoms) were randomly collected for RT-PCR in different regions of Henan Province (Supplementary Table S1). The results showed that the CCYV and ReMV infection rate were 20.5% and 61.7%, respectively. Co-infection of the CCYV and ReMV was 5.8% in fields (Supplementary Table S2). In sum, these results indicated the CCYV can naturally infect R. glutinosa in China. CCYV is transmitted by white-fly in a semi-persistent manner and mainly damages cucurbits (Orfanidou et al. 2017). CCYV has been discovered in many places (Huang et al. 2010). To date, there is no report about CCYV infecting R. glutinosa in nature. This is the first report of CCYV naturally infect R. glutinosa in China.

scholarly journals First report of apple rubbery wood virus 1 in apple in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Guojun Hu ◽  
Yafeng Dong ◽  
Zunping Zhang ◽  
Xudong Fan ◽  
Fang Ren ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
De Novo ◽  
Rna Virus ◽  
Rt Pcr ◽  
Apple Rootstocks ◽  
Apple Trees ◽  
Illumina Hiseq ◽  
First Report ◽  
Sequence Contigs ◽  
Apple Stem

More than 30 viral and subviral pathogens infect apple (Malus domestica, an important fruit crop in China) trees and rootstocks, posing a threat to its production. With advances in diagnostic technologies, new viruses including apple rubbery wood virus 1 (ARWV-1), apple rubbery wood virus 2 (ARWV-2), apple luteovirus 1 (ALV), and citrus virus A (CiVA) have been detected (Beatriz et al. 2018; Rott et al. 2018; Hu et al. 2021). ARWV-1 (family Phenuiviridae) is a negative-sense single-stranded RNA virus with three RNA segments (large [L], medium [M], and small [S]). It causes apple rubbery wood disease (Rott et al. 2018) and is found in apple rootstocks, causing leaf yellowing and mottle symptoms in Korea (Lim et al. 2018). To determine virus prevalence in apple trees in China, 200 apple leaf and shoot samples were collected from orchards in Hebei (n = 26), Liaoning (40), Shandong (100), Yunnan (25), and Shanxi (4), and Inner Mongolia (5) in 2020. Total RNA was extracted from the shoot phloem or leaf (Hu et al., 2015) and subjected to reverse transcription (RT)-PCR to detect apple chlorotic leaf spot virus (ACLSV), apple stem pitting virus (ASPV), apple stem grooving virus (ASGV), apple necrotic mosaic virus (ApNMV), apple scar skin viroid (ASSVd), ARWV-2, ARWV-1, ALV, and CiVA, using primers specific to respective viruses (Supplementary Table 1). The prevalence of ACLSV, ASPV, ASGV, ApNMV, ASSVd, ARWV-2, ARWV-1, ALV and CiVA was found to be 75.5%, 85.5%, 86.0%, 43.0%, 4.0%, 48.5%, 10.5%, 0% and 0%, respectively (Supplementary Table 2). Among the 21 positive samples for ARWV-1, three, five and 13 samples were from Hebei, Liaoning, and Shandong, respectively. Five ARWV-1-positive samples (cultivars Xinhongjiangjun, Xiangfu-1, Xiangfu-2 and Tianhong) showed leaf mosaic symptoms. To confirm ARWV-1 by RT-PCR, amplicons from Xiangfu-1 and Tianhong were cloned into the pMD18-T vector (Takara, Dalian, China), and three clones of each sample were sequenced. BLASTn analyses demonstrated that the sequences (accession nos. MW507810–MW507811) shared 96.9%–98.9% identity with ARWV-1 sequences (MH714536, MF062127, and MF062138) in GenBank. An lncRNA library was prepared for high-throughput sequencing (HTS) with the Illumina HiSeq platform using Xiangfu-1 RNA. A total of 71,613,294 reads were obtained. De novo assembly of the reads revealed 135 viral sequence contigs of ACLSV, ASGV, ASPV, ApNMV, ARWV-1, and ARWV-2. The sequences of contig-100_88981 (302 nt) and contig-100_25701 (834 nt) (accession nos. MW507821 and MW507820) matched those of segment S from ARWV-1, whereas the sequences of contig-100_6542 (1,660 nt) and contig-100_27 (7,364 nt) (accession nos. MW507819 and MW507818) matched those of segments M and L, respectively. To confirm the HTS results, fragments of segments L (744 bp), M (747 bp), and S (554 bp) from Xiangfu-1 and Tianhong were amplified (Supplementary Table 1) and sequenced. The sequences (accession nos. MW507812–MW507817) showed 94.8%–99.9% nucleotide identity with the corresponding segments of ARWV-1. Co-infection of ARWV-1 with ApNMV and/or ARWV-2 was confirmed in 17/21 ARWV-1-positive samples. The prevalence of ARWV-1/ApNMV, ARWV-1/ARWV-2, and ARWV-1/ApNMV/ARWV-2 infections was 61.9%, 71.4%, and 52.4%, respectively. To our knowledge, this is the first report of ARWV-1 infecting apple trees in China. Further research is needed to determine whether and how ARWV-1 affects apple yield and quality.

scholarly journals Genome sequencing of two Bell pepper endornavirus (BPEV) variants infecting Capsicum annuum in Colombia

2017 ◽  
Vol 35 (1) ◽  
pp. 44-53 ◽  
Author(s):  
Laura Muñoz-Baena ◽  
Mauricio Marín-Montoya ◽  
Pablo A. Gutiérrez
Keyword(s):  
Sanger Sequencing ◽  
Bell Pepper ◽  
Santa Fe ◽  
Rt Pcr ◽  
Specific Primers ◽  
Significant Similarity ◽  
Consensus Sequences ◽  
Random Samples ◽  
Amino Acid Levels ◽  
Viral Sequences

Transcriptome analysis of chili and bell pepper samples from commercial plots in the municipalities of Santa Fe de Antioquia and El Peñol in the province of Antioquia revealed the presence of viral sequences with significant similarity to genomes of members of the genus Endornavirus. Assembly of the chili and bell pepper transcriptomes resulted in consensus sequences of 14,727 nt and 14,714 nt that were identified as Bell pepper endornavirus (BPEV). Both sequences were nearly identical by 99.9 % at both nucleotide and amino acid levels. The presence of BPEV was confirmed by RT-qPCR, RT-PCR and Sanger sequencing using RdRp-specific primers designed from the assembled sequences in ten independent random samples taken from the investigated bell pepper stands. The phylogenetic analysis of both BPEV variants and their affiliation within the genus Endornavirus is discussed. For our knowledge, this is the first study on this group of viruses in Colombia.

scholarly journals First Report of Eggplant mottled dwarf virus in Pittosporum tobira in Spain

Plant Disease ◽  
2011 ◽  
Vol 95 (1) ◽  
pp. 75-75 ◽  
Author(s):  
A. Alfaro-Fernández ◽  
C. Córdoba-Sellés ◽  
T. Tornos ◽  
M. C. Cebrián ◽  
M. I. Font
Keyword(s):  
Plant Viruses ◽  
Dwarf Virus ◽  
Eastern Coast ◽  
Rt Pcr ◽  
Pcr Assay ◽  
Specific Primers ◽  
First Report ◽  
Type Isolate ◽  
The Mean ◽  
Pittosporum Tobira

In 2009, Pittosporum tobira (Thunb.) Ait. plants showing virus-like symptoms were observed in two ornamental greenhouses in two regions of the eastern coast of Spain (Tarragona and Valencia). Affected plants showed veinal yellowing and interveinal yellow mottling on the leaves. In addition, surveys conducted in 2010 in three public gardens in Valencia revealed 4% of P. tobira plants grown as hedges showed similar, but less severe symptoms. Five symptomatic and five asymptomatic P. tobira leaves were collected and analyzed by double antibody sandwich-ELISA using polyclonal antisera for Alfalfa mosaic virus (AMV) (SEDIAG S.A.S., Longvic, France) and Eggplant mottled dwarf virus (EMDV) (Deutsche Sammlung von Mikroorganismen und Zellkulturen Gmbh [DSMZ], Braunschweig, Germany). Samples were considered positive only if the mean absorbance value of duplicate wells was more than three times the mean absorbance of healthy control leaf samples. Only the five symptomatic samples tested positive for EMDV in the serological analyses. To confirm the results, a pair of EMDV-specific primers was designed using the published sequence of a fragment of the EMDV polymerase gene available in GenBank (Accession No. AM922322): EMDV-D (5′ TATGCGAGAATTGGGAGTGGGTAGT 3′) and EMDV-R (5′ CATTGTTATCCCGGGAAGTATTT 3′) targeting a 400-bp fragment. Total RNA was extracted from the symptomatic leaves and tested by reverse transcription (RT)-PCR assay with specific primers for AMV (4) and the primer pair designed for EMDV. The type isolate (EMDV-PV-0031, DSMZ) was used as a positive control sample in the serological and molecular analyses. None of the samples tested positive for AMV. The same five symptomatic samples that tested positive in the serological assays also tested positive for EMDV in the RT-PCR assay. Two RT-PCR products amplified from RNA of symptomatic P. tobira leaves and one from the type isolate were purified and directly sequenced. BLAST analyses of two sequences from infected P. tobira leaves (Accession Nos. HM636918 and HM636919) revealed 90% nucleotide identity to both the EMDV-Egg isolate (Accession No. AM922322) and the type isolate (EMDV-PV-0031, DSMZ), and 98% similarity among the P. tobira isolates. EMDV was first reported in the Canary Islands, Spain (3), and later was detected in the northeastern peninsular Spain on cucumber and eggplant (1). Although EMDV has been described as affecting P. tobira in countries such as Italy, Libya, and the former Yugoslavia (3), to our knowledge, this is the first report of EMDV infecting P. tobira in Spain. EMDV is generally considered of minor importance. However, P. tobira infection might have epidemiological consequences for susceptible cultivated crops such as eggplant or cucumber. Moreover, where P. tobira is used as a vegetatively propagated ornamental plant, EMDV could be transmitted from infected plants by the leafhopper vector (2). References: (1) J. Aramburu et al. Plant Pathol. 55:565, 2006. (2) G. H. Babaie and K. Izadpanah. J. Phytopathol. 151:679, 2003. (3) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20. Retrieved from http://biology.anu.edu.au/Groups/MES/vide/ , August, 1996. (4) L. Martínez-Priego et al. Plant Dis. 88:908, 2004.

scholarly journals First Report of Cucurbit chlorotic yellows virus Infecting Cucurbits in Taiwan

Plant Disease ◽  
2010 ◽  
Vol 94 (9) ◽  
pp. 1168-1168 ◽  
Author(s):  
L.-H. Huang ◽  
H.-H. Tseng ◽  
J.-T. Li ◽  
T.-C. Chen
Keyword(s):  
Citrullus Lanatus ◽  
Bottle Gourd ◽  
Insect Vector ◽  
Silverleaf Whitefly ◽  
Rt Pcr ◽  
Specific Primers ◽  
Total Rna ◽  
First Report ◽  
Dna Fragment ◽  
Cucurbit Chlorotic Yellows Virus

In April 2009, chlorosis, yellows, and bleaching accompanied with green veins and brittleness on the lower leaves of cantaloupe (Cucumis melo L.) were observed in Lunbei Township, Yunlin County, Taiwan. The same symptoms were also found on cucumber (Cucumis sativus L.), pumpkin (Cucurbita moschata Duchesne), watermelon (Citrullus lanatus (Thunb.) Matsum. & Nakai), bottle gourd (Lagenaria siceraria (Molina) Standl.), and oriental pickling melon planted in other areas of Yunlin and Changhua counties in central Taiwan. Large populations of whiteflies were observed in association with the diseased cucurbit crops, and they were further identified as silverleaf whitefly (Bemisia argentifolii Bellows & Perring) by PCR with specific primers BaBF (5′-CCACTATAATTATTGCTGTTCCCACA-3′) and l2-N-3014R (5′-TCCAATGCACTAATCTGCCATATTA-3′) (3). In June 2009, samples from symptomatic cantaloupe were collected for virus diagnosis. Flexuous filamentous virions of 700 to 900 nm were observed in crude sap of the symptomatic cantaloupe tissues with transmission electron microscopy. On the basis of the suspected insect vector, symptomology, and virus morphology, a Crinivirus species was suspected as the causal agent. A nested reverse transcription (RT)-PCR assay with degenerate deoxyinosine-containing primers developed for detection of Closterovirus and Crinivirus (1) was conducted. Total RNAs extracted from 16 symptomatic cantaloupe samples with a Plant Total RNA Miniprep Purification Kit (Hopegen, Taichung, Taiwan) were analyzed, and a 0.5-kb DNA fragment was amplified from eight of them. The PCR products were sequenced and the sequences were identical among samples. A comparison of the submitted sequence (Accession No. HM120250) with those in GenBank showed that the sequence was identical to the Hsp70h sequences of Cucurbit chlorotic yellows virus (CCYV) isolates from Japan (Accession No. AB523789) (4) and China (Accession Nos. GU721105, GU721108, and GU721110). To identify CCYV infection in the field, the specific primers, Crini-hsp70-f (5′-GCCATAACCATTACGGGAGA-3′) and Crini-hsp70-r (5′-CGCAGTGAAAAACCCAAACT-3′), that amplify a 389-bp DNA fragment corresponding to the nucleotide 1,324 to 1,712 of RNA2 of the original CCYV Japan isolate (Accession No. AB523789) were designed for detection of CCYV. In RT-PCR analyses, CCYV was identified in cantaloupe (305 of 599 samples), watermelon (27 of 93 samples), cucumber (all 15 samples), melon (82 of 92 samples), pumpkin (8 of 10 samples), and bottle gourd (10 of 17 samples) showing chlorosis and yellowing. The 389-bp DNA fragment was also amplified by RT-PCR with the primer pair Crini-hsp70-f/Crini-hsp70-r from total RNA extracts of 29 of 116 silverleaf whitefly individuals collected from the diseased cantaloupe fields in Lunbei Township from August to October, 2009. CCYV is a newly characterized Crinivirus species, first discovered in Japan in 2004 (2) and also found in China in 2009. To our knowledge, this is the first report that CCYV is emerging as a threat to cucurbit productions in Taiwan. References: (1) C. I. Dovas and N. I. Katis. J. Virol. Methods 109:217, 2003. (2) Y. Gyoutoku et al. Jpn. J. Phytopathol. 75:109, 2009. (3) C. C. Ko et al. J. Appl. Entomol. 131:542, 2007. (4) M. Okuda et al. Phytopathology 100:560, 2010.

scholarly journals High-throughput sequencing of autism spectrum disorders comes of age

2013 ◽  
Vol 95 (4) ◽  
pp. 121-129 ◽  
Author(s):  
MINGBANG WANG ◽  
XIAOMEI FAN ◽  
TAO WANG ◽  
JINYU WU
Keyword(s):  
Autism Spectrum Disorders ◽  
High Throughput ◽  
High Throughput Sequencing ◽  
De Novo ◽  
Autism Spectrum ◽  
Disease Gene Discovery ◽  
The Usa ◽  
High Heritability ◽  
Spectrum Disorders ◽  
Promising Perspective

SummaryAutism spectrum disorders (ASDs) are lifelong neurodevelopmental disabilities that affect 1 in 88 children in the USA. Despite the high heritability, the genetic basis for a majority of the ASDs remains elusive. The considerable clinical and genetic heterogeneity pose a significant challenge technically. State-of-the-art high-throughput sequencing (HTS), which makes the analyses of any specific single/multiple genes or whole exomes feasible, has shown a promising perspective in disease gene discovery. To date, numerous genetic studies using HTS have been reported and many rare inherited or de novo mutations have been identified. This review will focus on the progress and prospective of genome studies of ASDs using HTS.

scholarly journals Identification of a Novel Hepacivirus in Domestic Cattle from Germany

2015 ◽  
Vol 89 (14) ◽  
pp. 7007-7015 ◽  
Author(s):  
Christine Baechlein ◽  
Nicole Fischer ◽  
Adam Grundhoff ◽  
Malik Alawi ◽  
Daniela Indenbirken ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
De Novo ◽  
Dairy Herd ◽  
Herd Size ◽  
Rt Pcr ◽  
Emerging Pathogens ◽  
Content Type ◽  
Zoonotic Infections ◽  
Novel Virus ◽  
Cattle Herds

ABSTRACTHepatitis C virus (HCV) continues to represent one of the most significant threats to human health. In recent years, HCV-related sequences have been found in bats, rodents, horses, and dogs, indicating a widespread distribution of hepaciviruses among animals. By applying unbiased high-throughput sequencing, a novel virus of the genusHepaciviruswas discovered in a bovine serum sample.De novoassembly yielded a nearly full-length genome coding for a polyprotein of 2,779 amino acids. Phylogenetic analysis confirmed that the virus represents a novel species within the genusHepacivirus. Viral RNA screening determined that 1.6% (n =5) of 320 individual animals and 3.2% (n =5) of 158 investigated cattle herds in Germany were positive for bovine hepacivirus. Repeated reverse transcription-PCR (RT-PCR) analyses of animals from one dairy herd proved that a substantial percentage of cows were infected, with some of them being viremic for over 6 months. Clinical and postmortem examination revealed no signs of disease, including liver damage. Interestingly, quantitative RT-PCR from different organs and tissues, together with the presence of an miR-122 binding site in the viral genome, strongly suggests a liver tropism for bovine hepacivirus, making this novel virus a promising animal model for HCV infections in humans.IMPORTANCELivestock animals act as important sources for emerging pathogens. In particular, their large herd size and the existence of multiple ways of direct and food-borne infection routes emphasize their role as virus reservoirs. Apart from the search for novel viruses, detailed characterization of these pathogens is indispensable in the context of risk analysis. Here, we describe the identification of a novel HCV-like virus in cattle. In addition, determination of the prevalence and of the course of infection in cattle herds provides valuable insights into the biology of this novel virus. The results presented here form a basis for future studies targeting viral pathogenesis of bovine hepaciviruses and their potential to establish zoonotic infections.

Sign in / Sign up

Export Citation Format

Share Document