First report of cucurbit chlorotic yellows virus infecting watermelon and zucchini in the Canary Islands, Spain

In July 2019, eleven watermelon (Citrullus lanatus) plants, six ‘Augusta negra’ and five ‘Kasmira’, and seven zucchini (Cucurbita pepo) ‘Marcado’ plants showing yellowing and vein clearing on the leaves were collected in Arico, in Tenerife Island of the Canary Islands. Analysis with enzyme-linked immunosorbent assay (ELISA) with polyclonal antibodies using kits from (LOEWE® Biochemica GmbH, Sauerlach, Germany) detected cucurbit chlorotic yellows virus (CCYV) in four watermelon (two ‘Augusta negra’ and two ‘Kasmira’) plants and one zucchini plant. Reverse transcription-polymerase chain reaction (RT-PCR) with primers CCYV-CPs (5'-ATGGAGAAGACTGACAATAAACAA-3’) and CCYV-CPas (5'-TTTACTACAACCTCCCGGTG-3’) (Hamed et al. 2011) yielded 750 bp DNA fragments, which were purified, and directly sequenced by Sanger sequencing. The four CCYV sequences obtained from watermelon plants were identical and showed a 99.6% nucleotide identity with the CCYV isolate from Zucchini. The nucleotide sequences of CCYV isolates 351/19 from watermelon and 361/19 from zucchini were deposited in GenBank under accessions OK562588 and OK562589, respectively. BLASTn analysis showed high nucleotide identity, greater than 99 % with most worldwide CCYV isolates (AB523789, HM581658, JF502222, JF807053, JN126045-6, JQ904629, JX014262, KC990503-5, KC990507, KJ735450, KJ149806, KT946809, KT946816, KU507602, KX118632, KY400632-4, KY618799, LT716000, LT716003-4, MH477612, MH806868, MH819191, MN529560, MN815012-3, MT396249 MT048669, MW033301, MW584337, MW251342, MW521380, MW521381, MW584335-6, MW629380, MZ325848-9 and MZ405664), about 98% with two Saudi Arabian isolates (KT946810 and KT946815) and about 95 % with three Iranian isolates (KC577201-3). These genetic relationships were confirmed with a phylogenetic tree (Supplementary Fig. 1) inferred with the maximum likelihood method with 500 bootstrap replicates and the nucleotide substitution model HKY+G implemented in the program MEGA-X (Kumar et al., 2018). There is no correlation between geographic distance and genetic distance. CCYV is related to viruses in the genus Crinivirus, family Closteroviridae (Okuda et al., 2010). It is widespread and causes high economic losses (yield reduction and unmarketable fruits) in cucurbit crops from East Asia: Japan, China, Taiwan and South Korea; North America (the USA states of California, Texas, Georgia and Alabama); Middle East: Sudan, Saudi Arabia and Iran; and the Mediterranean basin: Egypt, Israel, Lebanon, Turkey, Greece, Algeria and peninsular Spain (Kheireddine et al., 2020; Chynoweth et al., 2021; Jailani, et al., 2021; Kwak et al., 2021). This is the first report of CCYV infecting cucurbits in the Canary Islands. The emergence of this virus poses a threat to the cucurbit crops in the Canary Islands and requires control measures to prevent its spread in Tenerife and the other Canary Islands.

First report of cucurbit chlorotic yellows virus (CCYV) infecting pumpkin in India

Pumpkin (Cucurbita moschata), a member of the family Cucurbitaceae, is widely cultivated throughout the world including India. During August 2020 to January 2021, stunted pumpkin plants (cv. Pusa Vishwas), showing chlorotic patches, mosaic, and vein banding on leaves (e-Xtra Fig.1), were observed in the experimental fields of the Indian Agricultural Research Institute (IARI), New Delhi, India. Leaf-dip electron microscopy (EM) of the symptomatic plants (12 out of 37 samples) revealed the association of long flexuous virus particles measuring 650-950nm×10-12nm, suggestive of the presence of either crinivirus or potyvirus or both. Subsequently, a reverse transcription-polymerase chain reaction (RT-PCR) was performed on RNA extracted from the samples that had long flexuous virus particles using generic primers for criniviruses i.e. CriniPol-F: GCY CCS AGR GTK AAT GA and CriniPol-R: ACC TTG RGA YTT RTC AAA targeting partial RNA-dependent RNA polymerase coding region (Martin et al. 2003) and specific primers for papaya ringspot virus (PRSV) targeting a part of 3’ NIb and full coat protein (CP) gene (Basavaraj et al., 2019) separately. All tested samples were positive for both crinivirus and PRSV as expected size amplicons were obtained, accounting for about 32% prevalence. As PRSV is a well-studied virus infecting cucurbits, further work was not carried on this virus and only the RT-PCR amplicon indicative of crinivirus (~515 bp) was cloned into the pGEM-T easy cloning vector (Promega, Madison, WI) and sequenced for further confirmation of the virus presence. The obtained sequence (GenBank accession No MZ318672) shared up to 90% nucleotide and 100% amino acid sequence identity with the corresponding genomic region of a cucurbit chlorotic yellows virus (CCYV) isolate from Greece (LT841297). To confirm the identity of the crinivirus species present in the same pumpkin sample, the CP gene (753bp) was amplified and sequenced using CCYV CP gene-specific primers CP-F (5’-ATG GAG AAG ACY GAC AAT AAA CAA AAT GAT GA-3’) and CP-R (5’-TTA TTT ACT ACA ACC TCC CGG TGC CAA C-3’) (modified from Kheireddine et al. 2020). Sequence analysis using the BioEdit tool (version 2.0) revealed that the crinivirus present in pumpkin (KC577202) shared 95 to 100% nucleotide (and 98 to 100% amino acid) sequence identity with the corresponding gene sequences of CCYV isolates originating from cucurbitaceous hosts from diverse locations. The presence of CCYV was further validated by a whitefly transmission-based bioassay followed by RT-PCR confirmation. The bioassay was performed by the whitefly species Bemisia tabaci (biotype Asia II7) using the acquisition access period and inoculation access period of 24 hours each. Six whitefly individuals per plant were used for inoculating ten pumpkin plants (cv. Pusa Vishwas) at the first true leaf stage grown in pots containing soilrite as the medium in insect-proof cages. All ten plants inoculated using whiteflies exhibited chlorosis and stunting symptoms 12-15 days post-inoculation (e-Xtra Fig.2) and were found positive for CCYV in RT-PCR assay performed using CCYV CP gene-specific primers. Though CCYV had been reported worldwide (Tzanetakis et al. 2013), its occurrence had not been reported from India. Results of the present study confirm the infection of pumpkin plants by CCYV and constitute the first report of its presence in India. Further, there is a need to investigate the extent of its spread and impact of this virus on the production of cucurbitaceous crops in the country.

First Report of Natural Infection of Zucchini by Tomato Chlorosis Virus and Cucurbit Chlorotic Yellows Virus in China

Zucchini (Cucurbita pepo) is an extensively cultivated and important economic cucurbit crop in China. In September 2018 and 2019, interveinal chlorosis and yellowing symptoms, suspected to be caused by either tomato chlorosis virus (ToCV; genus Crinivirus) or cucurbit chlorotic yellows virus (CCYV; genus Crinivirus) or by their co-infection, were observed on zucchini plants in a greenhouse in Shandong Province, China. The incidence of the disease in the greenhouse was 20–30%. To identify the causal agent(s) of the disease, leaf samples from 66 zucchini plants were collected in 14 greenhouses in the cities of Shouguang (n = 12), Dezhou (n = 36), Qingzhou (n = 12), and Zibo (n = 6) in Shandong. Four whitefly (Bemisia tabaci) samples and four symptomatic tomato samples were also collected from these sampling sites (one each for each site) because numerous whiteflies were observed in the sampling greenhouses and ToCV was previously reported in greenhouse tomato plants from these regions (Zhao et al. 2014). To determine whether the symptoms were associated with Crinivirus infection, reverse transcription polymerase chain reaction (RT-PCR) using Crinivirus-specific degenerate primers (CriniRdRp251F/CriniRdRp995R) (Wintermantel and Hladky 2010) was performed first on total RNA extracted using the TRIzol protocol (Jordon-Thaden et al. 2015). Thereafter, the RNA samples were subjected to RT-PCR with ToCV- or CCYV-specific primers (Sun et al. 2016; Gan et al. 2019). Of the 66 zucchini samples, 54 tested positive by the degenerate crinivirus primer pair; and among them, 10 tested positive for ToCV only, 40 positive for CCYV only, and 4 positive for both viruses. Interestingly, while both viruses were detected in all B. tabaci samples, only ToCV was detected in the tomato samples (n = 4). To confirm the identity of the viruses, the amplicons of ToCV (four samples each of tomato, B. tabaci and zucchini) and CCYV (four samples each of B. tabaci and zucchini) were Sanger sequenced (Tsingke Biotechnology Co., Ltd., Beijing, China) after cloning into pMD18-T vectors (Takara, Shiga, Japan). BLASTn analysis demonstrated that all sequences were identical to their respective amplicons. The ToCV sequences (GenBank accession numbers: tomato, MN944406; B. tabaci, MN944404; zucchini, MN944405) shared 100% sequence identity with isolates from Beijing (KT751008, KC887999, KR184675, and KP335046), Hebei (KP217196), and Shandong (KX900412). The CCYV sequence (GenBank accession number MT396249) shared 99.9% sequence identity with isolates China (JN126046, JQ904629, KP896506, KX118632, KY400633, and MK568545), Greece (LT716000, LT716001, LT716002, LT716005, and LT716006), and Cyprus (LT992909, LT992910, and LT992911). To assess the transmissibility of ToCV and CCYV, virus-free B. tabaci (n = 30) were placed in ToCV or CCYV-infected zucchini plants for one day for virus acquisition. Thereafter, the whiteflies were transferred into virus-free zucchini seedlings (cv. ‘Zaoqingyidai’, 4-leaf-stage, n = 6 for each of the control, ToCV and CCYV treatment) for one day. Three weeks after inoculation, all plants that were inoculated with either ToCV or CCYV displayed same symptoms as those observed in the greenhouses, whereas plants in the control group remained symptom free. RT-PCR analysis using ToCV- and CCYV-specific primers confirmed the infection of the plants with the respective virus, whereas control plants were free from the viruses. CCYV has been previously reported on zucchini in Algeria (Kheireddine et al. 2020), Iran (LR585225), and Cyprus (LT992910). To our knowledge, this is the first report of CCYV infection in zucchini in China, and moreover the first report of ToCV infection in zucchini in the world. Clearly, stringent management is needed to minimize the losses caused by these viruses in greenhouse operations in the region.

First Report of Cucurbit Chlorotic Yellows Virus affecting Watermelon in USA

Watermelon (Citrullus lanatus) is a high nutrient crop, high in vitamins and very popular in the U.S and globally. The crop was harvested from 101,800 acres with a value of $560 million in the U.S (USDA-NASS, 2020). California, Florida, Georgia and Texas are the four-leading watermelon-producing states in the U.S. During the fall season of 2020, plants in two North Florida watermelon fields, one in Levy County (~20 acres) and one in Suwannee County (~80 acres) with varieties Talca and Troubadour, respectively, exhibited viral-like symptoms. The fields had 100% disease incidence that led to fruit quality issues and yield losses of 80% and above. Symptoms observed in the watermelon samples included leaf crumpling, yellowing and curling, and vein yellowing similar to that of single/and or mixed infection of cucurbit leaf crumple virus (CuLCrV; genus: Begomovirus, family: Geminiviridae), cucurbit yellow stunting disorder virus (CYSDV; genus: Crinivirus, family: Closteroviridae) and squash vein yellowing virus (SqVYV; genus: Ipomovirus, family: Potyviridae), although the vine decline symptoms often associated with SqVYV infection of watermelon were not observed. All three viruses are vectored by whiteflies and previously described in Florida (Akad et al., 2008; Polston et al., 2008; Adkins et al., 2009). To confirm the presence of these viruses, RNA was isolated from 20 symptomatic samples using the RNeasy Plant Mini Kit (Qiagen, USA) as per protocol. This was followed by RT-PCR (NEB, USA) using gene-specific primers described for CuLCrV, CYSDV and SqVYV (Adkins et al., 2009). Amplicons of expected sizes were obtained for all the viruses with the infection of CuLCrV in 17/20, CYSDV in 16/20, and SqVYV in 8/20 samples. In addition, the presence of cucurbit chlorotic yellows virus (CCYV; genus: Crinivirus, family: Closteroviridae) in mixed infection was confirmed in 4/20 samples (3 leaves and 1 fruit) by RT-PCR with primers specific to the CCYV coat protein (CP), heat shock protein 70 homolog (HSP70h) and RNA dependent RNA polymerase (RdRp) designed based on the available CCYV sequences (Sup Table. 1). The RT-PCR amplification was performed using a symptomatic watermelon sample and the amplicons of RdRp, HSP70h and CP were directly sequenced by Sanger method, and the sequences of the amplicons were deposited in GenBank under the accession number: MW527462 (RdRp, 952 bp), MW527461 (HSP70h, 583 bp) and MW527460 (CP, 852 bp). BLASTn analysis demonstrated that the sequences exhibited an identity of 99% to 100% (RdRp and HSP70h, 100%; and CP, 99%) with the corresponding regions of the CCYV isolate Shanghai from China (accession number: KY400636 and KY400633). The presence of CCYV was further confirmed in the watermelon samples by ELISA (Loewe, Germany) using crude sap extracted from the RT-PCR-positive, symptomatic watermelon samples. CCYV was first identified in Kumamoto, Japan in 2004 on melon plants (Gyoutoku et al. 2009). The CCYV was previously reported on melon from Imperial Valley, California (Wintermantel et al., 2019), and more recently on squash in Tifton, Georgia (Kavalappara et al., 2021) and cantaloupe in Cameron, Texas (Hernandez et al., 2021). To our knowledge, this is the first report of CCYV on field watermelon production in the U.S. Continued monitoring of the CCYV in spring and fall watermelon crop, and cucurbit volunteers and weeds will be critical toward understanding the spread of this virus and its potential risk to watermelon in Florida and other regions of the U.S.

First Report of Cucurbit chlorotic yellows virus infecting Cucumber Plants in Spain

During the winter 2018, symptoms of leaf chlorotic spots (Figure 1) followed by symptoms of leaf interveinal chlorosis (Figure 2) and severe chlorosis in basal leaves were observed in cucumber cv Laredo (Cucumis sativus) plants in three separated greenhouses, sited in distinct locations in southern Spain. In all cases, Bemisia tabaci populations were observed on infected plants. The symptomology observed was similar to that caused by whitefly transmitted Cucurbit yellow stunting disorder virus (CYSDV, genus Crinivirus, family Closteroviridae), which is usually found infecting cucumber plants in this geographical area (1). Samples from four different cucumber plants of distinct greenhouses were collected and tested for the presence of CYSDV. Total RNA was extracted from the samples using the NucleoSpin RNA Plant kit (Macherey-Nagel, Germany). Molecular detection of CYSDV was performed using the multiplex and degenerate primer RT-PCR method (2), specific to the region of the highly conserved RNA-dependent RNA polymerase (RdRp) gene of criniviruses, which also detects other criniviruses such as Lettuce infectious yellows virus (LIYV) and Beet pseudo-yellows virus (BPYV). Results indicated that the viral species CYSDV, LIYV and BPYV were not detected in the four cucurbit plant samples. In 2004, an emergent crinivirus (Cucurbit chlorotic yellows virus, CCYV), inducing symptoms similar to those caused by CYSDV, was described infecting cucurbits in Japan (3). Recently, CCYV was detected in 2011 in Greece (4) and in 2014 in Egypt (5) and Saudi Arabia (6). Therefore, the four RNA samples were tested for the presence of the CCYV by a RT-PCR method previously described (7). Specific primers were designed to amplify 336 nt of the capsid protein (CP) gene and 680 nt of the RdRp gene, located on CCYV genomic RNA 1 and RNA 2, respectively. In all cases, clear cDNA bands of both expected sizes were detected for each cucumber sample that were then purified and sequenced via Sanger technology. BLAST analysis of those sequences showed 99% identity with the nucleotide sequence of the CP and RpRd genes from the CCYV isolates from Greece (LT992911, LT992910), China (KY400633.1, KX118632) and Taiwan (JF502222). To our knowledge, this is the first report of CCYV infecting cucurbits in Spain. Probably CCYV has been spread throughout the Mediterranean basin, remaining undetected due to the yellowing symptom similarities between CYSDV and CCYV. Detection of the emergent virus CCYV in Spain represents a new threat for the horticultural area of southern Europe.

First report of watermelon crinkle leaf-associated virus 1 (WCLaV-1) and WCLaV-2 in watermelon (Citrullus lanatus L.) plants co-infected with Cucurbit chlorotic yellows virus in Florida

Watermelon (Citrullus lanatus L.) and other cucurbits are major crops in Florida. During the 2020 and 2021 seasons, watermelon plants with foliar virus-like symptoms of yellow mottling and chlorosis, mild leaf wrinkling and thickened leaves were observed in commercial fields (40 to 150 ha) in five counties (Desoto, Glades, Osceola, Seminole, and Charlotte) at >50% field incidence. Initial screening of 13 field-collected samples (2 to 4/County) for potyviruses with the Agdia POTY Immunostrip (Agdia, Inc. Elkhart, IN) were negative. Total nucleic acid extracts from each sample (RNeasy Plant Mini Kit, Qiagen, Germantown, MD) were used in one-step RT-PCR (Qiagen OneStep RT-PCR kit) with species-specific primer targeting squash vein yellowing virus (SqVYV), papaya ringspot virus-W (PRSV-W) (Adkins et al., 2008), cucurbit yellow stunting disorder virus (CYSDV) (Polston et al. 2008), cucurbit chlorotic yellows virus (CCYV) (Hernandez et al., 2021a), watermelon crinkle leaf-associated virus 1 (WCLaV-1), and WCLaV-2 (Hernandez et al., 2021b). The samples were also tested for cucurbit leaf crumple virus (CuLCrV) as per Hagen et al. (2008). All 13 samples were negative for SqVYV, PRSV-W, CuLCrV, and CYSDV, but 7 samples (53.8%) from 4 counties tested positive for CCYV, 12 (92.3%) from 5 counties were positive for WCLaV-1, and WCLaV-2 was detected in 8 samples (61.5%) from 5 counties. Three samples were singly infected with WCLaV-1 while the remaining 10 were mixed infected with different combination of 2 or 3 viruses. Notably, symptoms on all 13 plants were visually indistinguishable. To verify the results, two randomly chosen gene-specific fragments per virus, obtained with primers CCYV-v1330/c2369, CCYV-v4881/c5736, WCLaV-1vRP/1cRP, WCLaV-1vMP/1cMP, WCLaV-2vRP/2cRP, and WLaV 2vMP/2cMP, were excised from the gel, cloned, and Sanger-sequenced as described (Hernandez et al., 2021a, 2021b). In pairwise comparisons, the ~1 kb partial ORF1a (GenBank accession nos. MZ325846 to MZ325847) and 753 bp complete coat protein cistron (MZ325848 to MZ325849) of CCYV from Florida shared 98.9-99.5%/98.4-99.6% nucleotide (nt)/amino acid (aa) and 99.4-99.8%/99.6-100% nt/aa identities, respectively with the corresponding sequences of global CCYV isolates. The partial RNA1 (MZ325850 to MZ325851) and RNA2 (MZ325852 to MZ325853) sequences of WCLaV-1 from Florida shared 99.2-99.8%/100% nt/aa and 98.9-100%/99.3-100% nt/aa identities, respectively with the corresponding global sequences of WCLaV-1 isolates. Lastly, the partial RNA1 (MZ325854 to MZ325857) and RNA2 (MZ325858 to MZ325861) sequences of WCLaV-2 from Florida shared 96.4-99.8%/97-100% nt/aa and 96.5-100%/95.9-100% nt/aa identities, respectively with the corresponding global sequences of WCLaV-2 isolates. This is the first report of WCLaV-1 and WCLaV-2 from Florida and the first documentation of the occurrence of CCYV in South Florida. CCYV has been reported previously from California (Wintermantel et al. 2019), Georgia (Kavalappara et al. 2021), and recently from North Florida (M. Paret, pers. comm) but WCLaV-1 and WCLaV-2 have only been reported from Texas (Hernandez et al., 2021b), after their discovery in China (Xin et al. 2017). The results indicate further expansion of the geographical range of these cucurbit-infecting viruses, although their longer but undetected presence in Florida is plausible due to the resemblance of their associated symptoms with those attributed to known viruses. References Adkins, et al., 2008. Plant Dis. 92:1119-1123. https://apsjournals.apsnet.org/doi/10.1094/PDIS-92-7-1119. Hagen, et al. 2008. Plant Dis. 92:781-793. https://apsjournals.apsnet.org/doi/pdfplus/10.1094/PDIS-92-5-0781. Hernandez, et al. 2021a. Plant Dis. https://doi.org/10.1094/PDIS-02-21-0378-PDN. Hernandez, et al., 2021b. Plant Dis. https://doi.org/10.1094/PDIS-02-21-0249-PDN Kavalappara, et al., 2021. Plant Dis. https://doi.org/10.1094/PDIS-11-20-2429-PDN. Polston, et al. 2008. Plant Dis. 92(8):1251. https://apsjournals.apsnet.org/doi/10.1094/PDIS-92-8-1251B. Wintermantel, et al., 2019. Plant Dis. 103(4):778. https://doi.org/10.1094/PDIS-08-18-1390-PDN. Xin, et al., 2017. Front. Microbiol. 8:1514, doi: 10.3389/fmicb.2017.01514.

First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in cucurbit crops in Alabama

During the summer and fall of 2020, foliar yellowing symptoms, including leaf mottle and interveinal yellowing with green veins were observed on several melon, squash, and cucumber plants in commercial fields in Alabama, USA. These foliar symptoms were similar to those caused by the whitefly-transmitted yellowing viruses, cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) (both genus Crinivirus, Closteroviridae). A total of 231 leaf samples showing yellowing, interveinal chlorosis, and mottling (e-Xtra 1, 2) were collected from individual plants from 25 commercial fields in Alabama (70 watermelon, 52 melon, 34 pumpkin, 50 squash, and 25 cucumber) during two sampling periods, June (spring/summer season) and October (fall season) 2020. Total RNA, extracted as described in Tamang et al. (2021), was used in reverse transcription polymerase chain reaction (RT-PCR) with primer sets designed to amplify portions of the CCYV and CYSDV RNA-dependent RNA polymerase (RdRp) genes encoded on RNA1 of these viruses (Mondal et al. 2021, submitted; Kavalappara et al., 2021). Single infections of either CYSDV or CCYV were found in 53 of 57 infected cucurbit samples (of 231 total plants), whereas both viruses were detected in four samples, all squash. In June 2020 near the end of the spring season, CYSDV was identified from 20 of 114 total cucurbit plants tested (17.5%), but CCYV was not identified from any plants. During the fall season, 37 of 117 plants (32%) tested positive for the presence of one or both criniviruses. Of the 37 virus-positive samples from the fall season, 26 were singly infected with CCYV (70%), seven were singly infected with CYSDV (19%), and four were infected with both CYSDV and CCYV (11%). The RdRp amplicon was sequenced from three CCYV-infected plants (2 squash; GenBank Accession No. MZ073347, MZ073348; 1 cucumber, MZ073349) and one CYSDV-infected plant (melon, MZ073350); the 857 nt sequenced portion of the CCYV RdRp gene was found to share 99% identity with the same sequence of CCYV RNA1 isolates from Israel (MH477611.1) and California (MW680157), whereas the 494 nt CYSDV amplicon shared 100% sequence identity with the comparable sequence from RNA1 of a CYSDV isolate from Arizona (EF547827.1). In addition, all of the CYSDV and CCYV infections were confirmed using a second set of primers that amplified 394 and 372 nt sections of the coat protein gene of each virus, respectively (Wintermantel et al., 2009; 2019), encoded on RNA2 of each viral genome. Furthermore, a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted) was used to confirm four representative CYSDV and CCYV infections each. This is the first report of CYSDV and CCYV in cucurbit crops from Alabama. Surprisingly, CYSDV was only found in melon plants (20 of 52, 38%), whereas CCYV was only found in squash, pumpkin, and cucumber (26 of 109, 24%); no watermelon plants were infected with either virus, even though watermelon is a known host of both viruses. The identification of CCYV and CYSDV in Alabama, along with a recent report of both criniviruses from nearby Georgia (Kavalappara et al., 2021) illustrates the need for a more thorough sampling of cucurbit crops, further monitoring of the whitefly vector, Bemisia tabaci, and the identification of alternate hosts of these viruses to better understand the epidemiology of these viruses in Alabama and throughout the Gulf Coast region.

High Throughput Sequencing-Aided Survey Reveals Widespread Mixed Infections of Whitefly-Transmitted Viruses in Cucurbits in Georgia, USA

Viruses transmitted by the sweet potato whitefly (Bemisia tabaci) have been detrimental to the sustainable production of cucurbits in the southeastern USA. Surveys were conducted in the fall of 2019 and 2020 in Georgia, a major cucurbit-producing state of the USA, to identify the viruses infecting cucurbits and their distribution. Symptomatic samples were collected and small RNA libraries were prepared and sequenced from three cantaloupes, four cucumbers, and two yellow squash samples. An analysis of the sequences revealed the presence of the criniviruses cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and the begomovirus cucurbit leaf crumple virus (CuLCrV). CuLCrV was detected in 76%, CCYV in 60%, and CYSDV in 43% of the total samples (n = 820) tested. The level of mixed infections was high in all the cucurbits, with most plants tested being infected with at least two of these viruses. Near-complete genome sequences of two criniviruses, CCYV and CYSDV, were assembled from the small RNA sequences. An analysis of the coding regions showed low genetic variability among isolates from different hosts. In phylogenetic analysis, the CCYV isolates from Georgia clustered with Asian isolates, while CYSDV isolates clustered with European and USA isolates. This work enhances our understanding of the distribution of viruses on cucurbits in South Georgia and will be useful to develop strategies for managing the complex of whitefly-transmitted viruses in the region.

First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in melon in the Central Valley of California

In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus, fam. Closteroviridae, have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, fam. Luteoviridae) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies (B. tabaci) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F – 5’ AAGAGCGGCAGCTACAATAC 3’, CABYV RdRp-R – 5’ TGCCACATTCCGGTTCATAG 3’), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.