scholarly journals Cucurbit chlorotic yellows virus infecting Rehmannia glutinosa was detected in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Kun Zhang ◽  
Xinjian Zhuang ◽  
Xiao Guo ◽  
Hongmei Xu ◽  
Zhen He ◽  
...  
Keyword(s):  
De Novo ◽  
Viral Disease ◽  
Henan Province ◽  
Plant Sample ◽  
Herbaceous Plant ◽  
Rehmannia Glutinosa ◽  
Rt Pcr ◽  
Illumina Hiseq ◽  
Two Samples ◽  
Cucurbit Chlorotic Yellows Virus

Rehmannia glutinosa Libosch. is a perennial herbaceous plant of the family Scrophulariaceae. Its roots can be used as traditional Chinese medicine. The asexual reproduction by vegetative organ of R. glutinosa lead to an increased viral disease that seriously affects its yield and quality (Kwak et al. 2020; Kwak et al. 2018; Ling and Liu 2009). Leaves of R. glutinosa in Wenxian County, Henan Province, China showed symptoms of chlorosis, mosaic and irregular yellow in August 2019. In general, the older leaves at the base or middle of the plant (sample 2# and 5#) first became irregular yellowing, followed by a gradual extend to the leaves at the top (Supplementary Fig. S1A). Six plants (2#, 3#, 5#, 7#, 8#, and 9#) with these symptoms were collected. The total RNA was extracted and its siRNAs were obtained. High-throughput siRNA sequencing (Sangon, Shanghai, China) was performed on Illumina Hiseq 2000 platform with paired-end method after siRNA library construction (NEBNext Ultra II RNA Library Prep Kit, NEB, UK). Sequencing files were treated with Illumina’s CASAVA pipeline (version 1.8). The length of the resulting reads with adaptor removed were mostly distributed ranging from 21-24 nt (Supplementary Fig. S1B). The Velvet Software 0.7.31 (k=17) was taken to do de novo assembling, and the contigs (∼13,000, Contigs > 300 bp) were used to perform BLASTN against GenBank database. Two viruses, Rehmannia mosaic virus (ReMV) and cucurbit chlorotic yellows virus (CCYV), were frequently appeared in analyzed six symptomatic samples. To further identify the infection of CCYV to R. glutinosa, ten samples with virus-infected symptoms were randomly collected. Total protein and RNAs were extracted for RT-PCR and ELISA (HALING. Shanghai, China). A specific pair of primers (Supplementary Table S1) were designed to amplify the 753-bp length coat protein (CP) gene of CCYV. The result showed that two samples appeared a specific band of expected size on the agarose gel, which indicated that they were infected by CCYV (Supplementary Fig. S1C, Upper panel). The same result was obtained by ELISA assay (Supplementary Fig. S1D). The amplified CP fragment of CCYV was recycled and purified by TIANgel Midi Purification Kit (Tiangen, Beijing, China), followed by cloned into pMD19-T (TaKaRa, Dalian, China) and transformed into E. coli DH5a.Ten separate clones were selected and sequenced (Sangon, Shanghai, China) after PCR verification. The obtained sequences (GenBank accession No. MW521380 & MW521381) were analyzed by BLASTN and bioEdit software (version 7.2.3). The results showed 100% identity with the CCYV CP sequences that mainly derived from infected cucurbit. To confirm the occurrence and distribution of CCYV and ReMV in planting area, the other twenty-four samples (20 with chlorosis and stunt symptoms and 4 with invisible symptoms) were randomly collected for RT-PCR in different regions of Henan Province (Supplementary Table S1). The results showed that the CCYV and ReMV infection rate were 20.5% and 61.7%, respectively. Co-infection of the CCYV and ReMV was 5.8% in fields (Supplementary Table S2). In sum, these results indicated the CCYV can naturally infect R. glutinosa in China. CCYV is transmitted by white-fly in a semi-persistent manner and mainly damages cucurbits (Orfanidou et al. 2017). CCYV has been discovered in many places (Huang et al. 2010). To date, there is no report about CCYV infecting R. glutinosa in nature. This is the first report of CCYV naturally infect R. glutinosa in China.

scholarly journals The occurrence of strawberry virus 1 infecting strawberry in Shandong province, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Chengyong He ◽  
Dehang Gao ◽  
Lingjiao Fan ◽  
Tengfei Xu ◽  
Fei Xing ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
De Novo ◽  
Shandong Province ◽  
Post Inoculation ◽  
Rt Pcr ◽  
Illumina Hiseq ◽  
Total Rna ◽  
Sodium Phosphate Buffer ◽  
Strawberry Vein Banding Virus ◽  
Two Samples

Strawberry (Fragaria × ananassa Duch.) is one of the most important horticultural plants worldwide with high economic and nutritional value. Strawberry associated virus 1 (SaV1) is a putative Cytorhabdovirus isolated from strawberry in Fujian province, China (Ding et al., 2019). Strawberry virus 1 (StrV-1) is another putative Cytorhabdovirus characterized from F. ananassa and F. vesca in Czech Republic (Fránová et al., 2019). The complete genomes of isolates of SaV1 and StrV-1 share 79 to 98% nucleotide (nt) identities. In August 2020, foliar chlorotic spots or streaks were observed in four strawberry cultivars (cv. Honeoye, Mibao, 8128 and All Star) in Yantai, Shandong province, China. To identify the associated viruses, symptomatic leaves from two plants of each cultivar (8 samples) were pooled for high-throughput sequencing (HTS). Total RNA was extracted from the composite sample and used for constructing a cDNA library after ribosomal RNA (rRNA)-depletion. Sequencing was carried out on Illumina Hiseq 4000 (Novogene, China). Raw reads were filtered, trimmed and de novo assembled as described previously (Grabherr et al., 2013; Zhou et al. 2020). The resulting contigs were screened by BLASTn and BLASTx against GenBank database. Subsequent analyses indicated the presence of strawberry vein banding virus, strawberry pallidosis associated virus and strawberry mottle virus in the analyzed sample, which had been reported previously in strawberry (Martin and Tzanetakis, 2013; Shi et al., 2018; Bhagwat et al., 2016). Besides, five contigs ranging from 266 to 6,057 nt were obtained. They shared 87 to 91% nt sequence identity with StrV-1 isolate B (GenBank accession no. MK211271). To confirm StrV-1 infection in the strawberry plants, total RNA was isolated from all eight samples using RNAprep Pure Plant Plus Kit (Tiangen, China). Reverse transcription polymerase chain reaction (RT-PCR) was conducted with two pairs of specific primers StrVp1 (Forward: 5ʹ-CATTACTGAAGCATTCCGTG-3′/Reverse: 5ʹ-AGATATCACGCACAGTGAC-3ʹ), and StrVp2 (Forward: 5ʹ-TTGCGCGAAGCGGATGTCCG-3′/Reverse: 5ʹ-GGCTGCCAGAGCGTTGGATG-3ʹ), targeting nt positions 70-1,231 and 7,825-9,348 of StrV-1 isolate B, respectively. Fragments with the expected sizes were amplified from two samples of cv. All Star. The amplicons were cloned, sequenced, and deposited in GenBank under accession no. MW419123-124 and MW645247-248. Both protein encoding sequences shared 91 to 92% and 80 to 84% nt identities with the corresponding sequences of StrV-1 isolate B and SaV1, respectively, indicating that the isolates from this study are genetic variants of StrV-1 and distantly related to SaV1. Crude sap was prepared by homogenizing leaf tissues of StrV-1 infected strawberry in 0.02 mol/L sodium phosphate buffer with 0.45% (w/v) sodium diethyldithiocarbamate thihydrate, then gently rubbed onto five healthy Nicotiana benthamiana plants. Neither the inoculated leaves nor the systemically infected leaves showed obvious symptoms seven days post inoculation. However, StrV-1 was detected by RT-PCR in all five N. benthamiana plants as described above. In addition, a survey of strawberry greenhouses was conducted in August 2020 and approximately 10% of plants in a 667 m2 greenhouse in Yantai had StrV-1-like symptoms. To the best of our knowledge, this is the first report of the occurrence of StrV-1 infecting strawberry in Shandong province, China. Our findings expand the geographic range and genetic diversity of StrV-1 and indicate it could be a potential virus threat to strawberry production in China.

scholarly journals First report of apple rubbery wood virus 1 in apple in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Guojun Hu ◽  
Yafeng Dong ◽  
Zunping Zhang ◽  
Xudong Fan ◽  
Fang Ren ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
De Novo ◽  
Rna Virus ◽  
Rt Pcr ◽  
Apple Rootstocks ◽  
Apple Trees ◽  
Illumina Hiseq ◽  
First Report ◽  
Sequence Contigs ◽  
Apple Stem

More than 30 viral and subviral pathogens infect apple (Malus domestica, an important fruit crop in China) trees and rootstocks, posing a threat to its production. With advances in diagnostic technologies, new viruses including apple rubbery wood virus 1 (ARWV-1), apple rubbery wood virus 2 (ARWV-2), apple luteovirus 1 (ALV), and citrus virus A (CiVA) have been detected (Beatriz et al. 2018; Rott et al. 2018; Hu et al. 2021). ARWV-1 (family Phenuiviridae) is a negative-sense single-stranded RNA virus with three RNA segments (large [L], medium [M], and small [S]). It causes apple rubbery wood disease (Rott et al. 2018) and is found in apple rootstocks, causing leaf yellowing and mottle symptoms in Korea (Lim et al. 2018). To determine virus prevalence in apple trees in China, 200 apple leaf and shoot samples were collected from orchards in Hebei (n = 26), Liaoning (40), Shandong (100), Yunnan (25), and Shanxi (4), and Inner Mongolia (5) in 2020. Total RNA was extracted from the shoot phloem or leaf (Hu et al., 2015) and subjected to reverse transcription (RT)-PCR to detect apple chlorotic leaf spot virus (ACLSV), apple stem pitting virus (ASPV), apple stem grooving virus (ASGV), apple necrotic mosaic virus (ApNMV), apple scar skin viroid (ASSVd), ARWV-2, ARWV-1, ALV, and CiVA, using primers specific to respective viruses (Supplementary Table 1). The prevalence of ACLSV, ASPV, ASGV, ApNMV, ASSVd, ARWV-2, ARWV-1, ALV and CiVA was found to be 75.5%, 85.5%, 86.0%, 43.0%, 4.0%, 48.5%, 10.5%, 0% and 0%, respectively (Supplementary Table 2). Among the 21 positive samples for ARWV-1, three, five and 13 samples were from Hebei, Liaoning, and Shandong, respectively. Five ARWV-1-positive samples (cultivars Xinhongjiangjun, Xiangfu-1, Xiangfu-2 and Tianhong) showed leaf mosaic symptoms. To confirm ARWV-1 by RT-PCR, amplicons from Xiangfu-1 and Tianhong were cloned into the pMD18-T vector (Takara, Dalian, China), and three clones of each sample were sequenced. BLASTn analyses demonstrated that the sequences (accession nos. MW507810–MW507811) shared 96.9%–98.9% identity with ARWV-1 sequences (MH714536, MF062127, and MF062138) in GenBank. An lncRNA library was prepared for high-throughput sequencing (HTS) with the Illumina HiSeq platform using Xiangfu-1 RNA. A total of 71,613,294 reads were obtained. De novo assembly of the reads revealed 135 viral sequence contigs of ACLSV, ASGV, ASPV, ApNMV, ARWV-1, and ARWV-2. The sequences of contig-100_88981 (302 nt) and contig-100_25701 (834 nt) (accession nos. MW507821 and MW507820) matched those of segment S from ARWV-1, whereas the sequences of contig-100_6542 (1,660 nt) and contig-100_27 (7,364 nt) (accession nos. MW507819 and MW507818) matched those of segments M and L, respectively. To confirm the HTS results, fragments of segments L (744 bp), M (747 bp), and S (554 bp) from Xiangfu-1 and Tianhong were amplified (Supplementary Table 1) and sequenced. The sequences (accession nos. MW507812–MW507817) showed 94.8%–99.9% nucleotide identity with the corresponding segments of ARWV-1. Co-infection of ARWV-1 with ApNMV and/or ARWV-2 was confirmed in 17/21 ARWV-1-positive samples. The prevalence of ARWV-1/ApNMV, ARWV-1/ARWV-2, and ARWV-1/ApNMV/ARWV-2 infections was 61.9%, 71.4%, and 52.4%, respectively. To our knowledge, this is the first report of ARWV-1 infecting apple trees in China. Further research is needed to determine whether and how ARWV-1 affects apple yield and quality.

scholarly journals First report of peach leaf pitting-associated virus (PLPaV), plum bark necrosis stem pitting-associated virus (PBNSPaV), and mume virus A (MuVA) from Mei (Prunus mume) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yuhong Zhang ◽  
Jun Zhou ◽  
Binhui Zhan ◽  
shifang li ◽  
Zhixiang Zhang
Keyword(s):  
Prunus Mume ◽  
Sequencing Data ◽  
Rt Pcr ◽  
Illumina Hiseq ◽  
New Host ◽  
First Report ◽  
Interveinal Chlorosis ◽  
Sequence Identity ◽  
Two Samples ◽  
Stem Pitting

Mei (Prunus mume Sieb. et Zucc.), widely distributed in East Asian countries for both fruiting- and flowering-purposes, is susceptible to viral infections (Marais et al. 2018). Infection by plum bark necrosis stem pitting-associated virus (PBNSPaV) or little cherry virus 2 (LChV-2) possibly caused overall yield loss in mei in Japan due to incomplete flower development, low fruit bearing rate, and interveinal chlorosis (Numaguchi et al. 2019). Virus-like disease showing mosaic, interveinal chlorosis, vein clearing, or necrotic spot on leaf was observed in mei trees in Beijing, Wuhan, Wuxi, and Nanjing in spring and early summer from 2017 to 2018. Symptomatic leaves collected from the four regions were pooled as two samples for RNA-sequencing (RNA-seq) analysis. After ribosomal RNA (rRNA)-depletion, total RNA extracted by TRNzol reagent (TIANGEN, China) was subjected to library construction using NEBNext Ultra RNA Library Prep Kit (NEB, MA, USA) and sequenced on an Illumina Hiseq 4000 (Novogene, China). Sequencing data was filtered, screened, and assembled as described previously (Zhou et al. 2020) to generate contigs, following by BLAST-x/n search in viral genomes in GenBank. We identified >300 contigs (208-10756 nt) homologous to Asian prunus virus 1 and Asian prunus virus 2 (APV1 and 2), mume virus A (MuVA), PBNSPaV, and peach leaf pitting-associated virus (PLPaV), with 71-100% of nucleotide sequence identity values. APV1 and 2 have been reported in mei in China (Wang et al. 2018), here, we focused on the other three viruses. Contigs homologous to these three viruses were further assembled into three scaffolds of 14,224 nt, 1107 nt, and 753 nt for PBNSPaV, MuVA, and PLPaV, respectively. The scaffold of PBNSPaV (MW217574) nearly covered the whole genome of the isolate VIC3 from Australia (LC523039.1) (Kinoti et al. 2020) with 92.30% of sequence identity; the scalffold of MuVA (MW217572) covered 14.50% of the genome of the isolate pm14 from Japan (NC 040568.1) (Marais et al.2018) with 98.47% sequence identity; the scaffold of PLPaV (MW217573) covered 15.26% of the genome of the isolate XJ-6 from peach (KY867750.1) (He et al. 2017) with 85.23% sequence identity. Presence of the three viruses were verified by RT-PCR detection using designed specific primers for PBNSPaV (Forward: 5′-CAACAAAACTCCCACAGCGG-3 [positions 4014-4033, NC_009992.1] / Reverse: 5′-GCCAAAAGAAGTGCTGGTGG-3′ [positions 4659-4640, NC_009992.1]), MuVA (Forward: 5′-AAGAGAATTACTTCAATGCCCTC-3′ [positions 171-194, NC_040568.1] / Reverse: 5′-GATATCCAAGATACGATTAGCCAG-3′ [positions 533-510, NC_040568.1]), and PLPaV (Forward: 5′-GCTATATCTCAACAACTGCAAGAA-3 [positions 5798-5821, KY867750.1] / Reverse: 5′- GAGTGATACATAGTCCACAGAGAT-3′[ positions 6045-6022, KY867750.1]). The amplified 626, 350 and 251 bp fragments of PBNSPaV, MuVA and PLPaV had 91.47%, 98.07% and 81.89% sequence identity to their respective reference sequences. This is the first report of PBNSPaV and MuVA infecting mei in China, and more importantly, the first report of a new host for PLPaV. In addition, 30 collected leaf samples from Nanjing and Wuhan were analyzed by RT-PCR and 15, 6, and 5 samples tested positive to PLPaV, PBNSPaV, and MuVA, respectively. Although it is difficult to link a particular virus with the observed symptoms due to mixed infections, the symptoms were significantly associated with viral infection because almost all symptomatic leaf samples were virus(es)-positive. Further studies would be required to determine the distribution and impact of these viruses on mei trees and other stone fruits species and to understand the possibility that mei trees may play a role in PLPaV epidemiology.

scholarly journals Strawberry, a new natural host of Brassica yellows virus in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Chengyong He ◽  
Xiaoli Zhao ◽  
Lingjiao Fan ◽  
Shifang Li ◽  
Hongqing Wang
Keyword(s):  
High Throughput Sequencing ◽  
De Novo ◽  
Natural Infection ◽  
Complete Sequence ◽  
Rt Pcr ◽  
High Quality ◽  
Illumina Hiseq ◽  
Total Rna ◽  
Turnip Yellows Virus ◽  
Blastn Analysis

Brassica yellows virus (BrYV; genus Polerovirus, family Solemoviridae) has an icosahedral spherical virion with a positive-sense single-stranded RNA genome and it is distinguished from turnip yellows virus (TuYV) based on differences in ORF0 and ORF5 (Xiang et al., 2011). To investigate the occurrence and distribution of viruses infecting strawberry (Fragaria ananassa) in the main production areas in China, a survey of nine greenhouses (667 m2 each) was conducted in the cities of Yantai and Beijing, China in August 2020. About 1% of strawberry plants in each greenhouse showed virus-like symptoms of chlorotic spots; 89 symptomatic leaf samples were randomly collected for virus testing. Total RNA was extracted from a pool of eight samples of four different cultivars (Hokowase: 2, Mibao: 2, Sagahonoka: 2, Monterey: 2) from Yantai using RNAprep Pure Plant Plus Kit (TianGen, China). A cDNA library was constructed by NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB, USA) after ribosomal RNA-depletion using an Epicentre Ribo-Zero™ rRNA Removal Kit (Epicentre, USA). High-throughput sequencing was done on Illumina Hiseq 4000, generating 70,931,850 high-quality 150 bp paired-end reads. Clean reads were de novo assembled by Trinity (v2.2.0) and the resulting contigs were screened by BLASTn and BLASTx against GenBank database as described previously (Grabherr et al., 2013). A total of 1,432,164 high-quality reads unmapped to the strawberry genome were obtained and assembled into 93 contigs (ranging from 33 to 8,031 nt). Seven of these contigs (277 to 1,254 nt) shared 98.2 to 100% nt identities with BrYV-A (accession no. HQ388348) and covered 89.5% of the genome of BrYV-A. Subsequent analyses indicated the presence of Strawberry pallidosis-associated virus and Strawberry mottle virus in the analyzed sample, both have been reported in strawberry in China (Shi et al., 2018; Fan et al., 2021). To confirm BrYV infection, total RNA was isolated from the eight samples used for HTS and reverse transcription polymerase chain reaction (RT-PCR) was conducted with two pairs of specific primers (CP and rtp, Supplementary Table 1) designed based on the assembled contigs. PCR products with expected sizes (587 and 609 bp) were observed in one sample (cv. Mibao). BLASTn analysis indicated that the amplicons (accession no. MW548437 and MW548438) shared 98.6% and 99.3% nt identity with BrYV-A, respectively. To obtain the complete sequence of the putative BrYV isolate, the gaps were bridged and the terminal sequences were determined using 5ʹ and 3ʹ RACE kits (Clontech, China) based on the assembled contigs. The complete genome sequence of the putative BrYV isolate has a length of 5,666 nt (accession no. MZ666129) and shares more than 94.3% nt identities with other BrYV isolates. Phylogenetic analysis indicated that the isolate grouped closely with BrYV and further from TuYV (Figure S1). In addition, 11 samples (cv. Benihoppe) of the remaining 81 symptomatic strawberry samples tested positive for BrYV by RT-PCR with the two pairs of primers mentioned above. The sequences (accession no. MZ407232 and MZ407233) revealed 99.5% and 99.3% nt identities with MW548437 and MW548438. To the best of our knowledge, this is the first report of natural infection of BrYV in strawberry plants. Our findings expand the host range of BrYV, but disease association is difficult to establish due to presence of mixed infection and non-fulfillment of Koch's postulates.

scholarly journals First report of watermelon crinkle leaf-associated virus 1 and 2 infecting watermelon (Citrullus lanatus) plants in Brazil

Plant Disease ◽  
2021 ◽  
Author(s):  
Matheus Hideki Kihara Maeda ◽  
Lucas Hideo Hataka Koyama ◽  
Ravi Narayan Souza Campos ◽  
Caterynne Melo Kauffmann ◽  
Juliana Osse de Souza ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
De Novo ◽  
Citrullus Lanatus ◽  
Plant Viruses ◽  
Rt Pcr ◽  
Specific Primers ◽  
Consensus Sequences ◽  
Two Samples ◽  
The Usa ◽  
Tblastx Search

Watermelon (Citrullus lanatus) is an important crop in Brazil both for export and domestic consumption. In this study, the cause of a severe leaf curling, distortions and vein clearing/yellowing disease of watermelon was investigated by high-throughput sequencing (HTS). The RNA extract of virus semi-purification preparation (Blawid et al., 2017) from leaf samples of 10 symptomatic plants collected from a commercial field in Juazeiro, Bahia state in May 2019, were pooled. Then, cDNA prepared with TruSeq Stranded Total RNA with Ribo-Zero Plant Kit (Illumina, San Diego, USA) was analyzed by HTS using Novaseq with 100 paired ends of 3G scale (~31M reads). De novo assembly of total reads was performed using Megahit (Li et al., 2015), and the tBlastX search against the RefSeq Virus Genomes (NCBI) was done using Geneious 11.1 program (Biomatters, Auckland, New Zealand). Reads of groundnut ringspot virus (GRSV) were identified, in addition to those of watermelon crinkle leaf-associated virus 1 (WCLaV-1, LC636070-72) and 2 (WCLaV-2, LC636073-75), which are putative members of the genus Coguvirus in the family Phenuiviridae (Zhang et al. 2021) and have not been reported in Brazil. Other plant viruses were not found. The means of read coverage over the genes were from 1652 to 2532 for WCLaV-1 and from 404 to 1025 for WCLaV-2. These viruses were recently reported infecting watermelon in China (Xin et al., 2017) and the USA (Hernandez et al., 2021). The nucleotide identities between consensus sequences of isolates from Brazil and reference sequences of the WCLaV-1 KF-1 isolate from China (KY781184-86) were 99.0% in RdRp, 98.9% in nucleocapsid (NC) and 99.1% in putative movement protein (MP) genes, and between the WCLaV-2 KF-15 isolate from China (MW559083-91) and the sequences from Brazil, 97.2% in RdRp, 96.6% in NC and 96.9% in putative MP genes. To confirm the presence of these viruses in individual samples, RT-PCR was conducted with specific primers to WCLaV-1 (WCLaV-1vNP and WCLaV-1cMP) and WCLaV-2 (WCLaV-2vNP and WCLaV-2cMP) (Hernandez et al., 2021), targeting the NC protein genes with the expected amplicon sizes of 786 and 449 nt, respectively. In addition, GRSV-specific primers (GRSVS: GTGCATCATCCATTGTAAATCC and GRSVA: CGCCAAAGCATCATGAAAG), targeting the NC protein gene, with the expected amplicon size of 445 nt, were also used in the test. Twelve samples from watermelon plants with similar symptoms were analyzed by RT-PCR, six from a field in Mossoró, Rio Grande do Norte state collected in 2020, and six from the same field in Juazeiro, Bahia sampled in 2019. All plants from both locations were positive for WCLaV-1 and GRSV in RT-PCR tests, whereas two samples from Juazeiro were positive for WCLaV-2. Six cDNA fragments (two from Mossoró and two from Juazeiro for WCLaV-1 and two WCLaV-2 from Juazeiro) were sequenced (MZ819081-6) and showed very high identities within the species among them (99.8% to 100%). Finally, leaf samples were also collected from watermelon plants with these symptoms in Guadalupe County, Piaui State in 2015. An HTS analysis of this sample was conducted at the University of California Davis and revealed infection with a divergent strain of GRSV and WCLaV-1 (LC636068-9), but not WCLaV-2. The nucleotide identities between consensus sequences of isolates from Piauí and Juazeiro were 99.9% in RdRp and NC, and 100% in putative MP genes. These results indicate that WCLaV-1 and WCLaV-2 are present in Brazil in association with severe virus-like disease symptoms in watermelon plants.

scholarly journals First Report of the Plum Pox Virus Recombinant Strain on Peach in Bulgaria

Plant Disease ◽  
2011 ◽  
Vol 95 (10) ◽  
pp. 1320-1320 ◽  
Author(s):  
I. Kamenova ◽  
S. Dallot ◽  
V. Bozkova ◽  
S. Milusheva
Keyword(s):  
Large Scale ◽  
Natural Infection ◽  
Viral Disease ◽  
Recombination Breakpoint ◽  
Amino Acid Sequences ◽  
Plum Pox Virus ◽  
Rt Pcr ◽  
Specific Primers ◽  
South Central ◽  
Two Samples

Plum pox virus (PPV) causes sharka, the most damaging viral disease of stone fruit species. Seven distinct PPV strains are known; PPV-M, PPV-D, and PPV-Rec are the most common (3). PPV-Rec is a unique recombinant (3) between PPV-M and PPV-D and has been reported from plum, apricot, Japanese plum, myrobalan, and blackthorn in eastern and central Europe, but has never been found in peach as a single natural infection (2). A survey was conducted during spring 2009 in eight peach orchards located in the southwest, southeast, and south central regions of Bulgaria to assess the incidence of PPV infection. A total of 98 leaf samples from individual trees showing PPV-like symptoms were collected and analyzed by triple-antibody sandwich (TAS)-ELISA with the universal monoclonal antibody (MAb) 5B (Agritest, Valenzano, Italy). Sixty one samples reacted positive for PPV (optical density 0.161 to 1.267) and these samples were further analyzed with PPV-M (AL) and PPV-D (4DG5) specific MAbs (1). All 61 samples reacted positively with PPV-M specific MAbs. To distinguish PPV-M and PPV-Rec strains, which are serologically identical, immunocapture (IC)-reverse transcription (RT)-PCR was carried out with PPV-M (CIP-M: 5′-GTC GCA GCA TTT GTA GCC CTT GTT-3′, CIP-MR: 5′-CCA ACA CGT TAA CGC CAT GCT TCA-3′) and PPV-D (CIP-D: 5′-ATG ATG CTG TTT GAC TCG GAG CGA-3′, CIP-DR: 5′-TCG CAA CTG CTT GCA CAC ATT CTC-3′) specific primers targeting the 6K1-CI genomic region. A PCR fragment of ~880 bp amplified with PPV-M specific primers obtained from 59 samples confirmed that these were PPV-M isolates. However, the remaining two samples (both coming from infected tress located in two different orchards in the southwest region) yielded a 468-bp PCR fragment with PPV-D specific primers, suggesting that these two samples belonged to PPV-Rec strain. These samples together with controls of PPV-M, PPV-D, and PPV-Rec strains were further analyzed by RT-PCR using mD5/mM3 primers spanning the recombination breakpoint (4). Both peach samples and the PPV-Rec strain control produced a single 605-bp PCR product. The two peach amplicons were purified and sequenced directly with the same primers. The nucleotide (nt) sequences obtained were 100% identical to each other. BLAST analysis of the two samples with PPV-Rec (No. AF421118.1) showed maximum nt identity of 98%. Percent maximum nt identity with PPV-M (No. AY324837.1) and PPV-D (No. AB576062.1) were 93 and 87%, respectively. The deduced amino acid sequences of the two isolates were 98% identical to PPV-Rec (No. No. AF421118.1), 93% identical to PPV-M (No. M92280.1), and 84% identical to PPV-D (No. AB576062.1). Analyzed samples were further transmitted from the diseased trees to peach seedlings (GF 305) by chip-budding in a greenhouse during the fall of 2009. Six months later, faint vein clearing on the leaves of inoculated seedlings was observed. The presence of PPV was confirmed by TAS-ELISA and PPV-Rec presence was shown by IC-RT-PCR (mD5/mM3 primers). One of the generated 605-bp products was sequenced and showed 100% nt identity with the isolate used for inoculation. To our knowledge, this is the first identification of PPV-Rec strain in naturally infected peach trees, a finding that calls for further large-scale investigations of PPV-Rec incidence in peach in Bulgaria. References: (1) M. Cambra et al. OEPP/EPPO Bull. 24:569, 1994. (2) S. Dallot et al. Acta Hortic. 781:227, 2008. (3). M. Glasa et al. J. Gen. Virol. 85:2671, 2004. (4) Z. Šubr et al. Acta Virol. 48:173, 2004.

scholarly journals First report of Melon aphid-borne yellows virus infecting watermelon in Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Hee-Seong Byun ◽  
Hong-Soo Choi ◽  
Hyun Ran Kim ◽  
Hae-Ryun Kwak ◽  
Eui-Joon Kil ◽  
...  
Keyword(s):  
De Novo ◽  
Citrullus Lanatus ◽  
Plant Viruses ◽  
Rt Pcr ◽  
Genome Database ◽  
Total Rna ◽  
First Report ◽  
Two Samples ◽  
Primer Sets ◽  
Melon Aphid

Watermelon (Citrullus lanatus) is one of the most popular crops in Korea, with over 100 million units produced annually. As watermelon cultivation increases, the damage caused by plant viruses in watermelon farms is also increasing. In July 2020, some watermelons cultivated on farms in Uiryeong showed typical viral symptoms, such as yellowing and necrosis. In previous studies, two plant viruses, cucurbit aphid-borne yellows virus (CABYV) and cucurbit chlorotic yellows virus (CCYV), have been reported as causal agents of yellowing disease in the cucurbitaceae plant in Korea. To identify the virus(es) associated with the symptomatic watermelon plants, 11 samples were collected. Total RNA was extracted from each sample using the Plant RNA Prep kit (Biocube System, Gwacheon, Korea). RT-PCR was performed using primer sets specific to CABYV and CCYV to detect each virus (Kwak et al. 2018, Wintermantel et al. 2019). CABYV was detected in one sample, and CCYV was detected in 8 samples. Every sample presented similar yellowing symptoms; however, neither virus was detected in the remaining two samples. To investigate unknown viruses, a transcriptome library was constructed using total RNA of the watermelons and sequenced using a NovaSeq 6000 sequencer (Illumina, San Diego, CA). The reads were de novo assembled and annotated using the KEGG virus genome database with the NCBI BLAST utility. All procedures of next generation sequencing were performed by Macrogen (Seoul, Korea). Three large viral contigs were identified, and additional BLAST analyses for nucleotides (nt) and proteins indicated that they were CABYV, CCYV, and melon aphid-borne yellows virus (MAYBV). A total of 247,198 reads were mapped to reference MABYV sequence (GenBank Accession Number NC_010809), and the sequencing depth was 6,575X. The contig (MW505927) had a size of 5,677 nt and showed 100% coverage and 96% identity with known complete MABYV sequences (JQ700307 and EU000534). To confirm the presence of MABYV, RT-PCR was performed using specific primer sets targeting MABYV (MABYV-262-F, 5ʹ-GAACCGTCGACGCACTTCAAAGAGTA-3ʹ and Polero-uni-R, 5ʹ-GATYTTATAYTCATGGTAGGCCTTGAG-3ʹ; Knierim et al. 2010). The expected size of 262 bp was obtained from 5 out of 11 samples, including the two samples mentioned above. MABYV belongs to the genus Polerovirus and has been reported in cucurbit crops in China, Taiwan, and Thailand (Xiang et al. 2008, Knierim et al. 2010, Cheewachaiwit et al. 2017). According to the farmer, outbreak of aphids had previously occurred and were controlled with pesticides. Since aphids are known to be vectors of poleroviruses, we surmise that the watermelons were infected with MABYV by the aphids at that time. To monitor the outbreak of MABYV, watermelon farms in Uiryeong will be continuously investigated. To our knowledge, this is the first report of MABYV in Korea.

Genexpressionsmuster von fibrinolytischen Faktoren des Urokinase-Plasmin-Systems bei Dermatoliposklerose

Phlebologie ◽  
1999 ◽  
Vol 28 (01) ◽  
pp. 1-6 ◽  
Author(s):  
Ch. Stetter ◽  
E. Schöpf ◽  
J. Norgauer ◽  
W. Vanscheidt ◽  
Y. Herouy
Keyword(s):  
Mrna Expression ◽  
De Novo ◽  
Ulcus Cruris ◽  
Ulcus Cruris Venosum ◽  
Rt Pcr ◽  
Fand Sich ◽  
Pai 1

ZusammenfassungDie Dermatoliposklerose (DLS) entwickelt sich als Folge einer progredienten primären Varikosis oder eines postthrombotischen Syndroms (PTS). Trotz bestehender Hinweise auf eine veränderte intravasale fibrinolytische Aktivität bei der chronisch-venösen Insuffizienz (CVI), wurden bisher fibrinolytische Faktoren im perivaskulären Gewebe nicht untersucht. Kürzlich zeigten wir, daß bei Dermatoliposklerose Matrix-Metalloproteinasen exprimiert und aktiviert werden. Da spezifische fibrinolytische Faktoren wichtige Haupteffektoren der Matrix-Metalloproteinasenaktivierung sind, untersuchten wir kürzlich die Genexpression der Plasminogenaktivatoren vom Urokinasetyp (uPA) und vom Gewebetyp (tPA), des Urokinase-Rezeptor (uPA-R) sowie der Plasminogenaktivator-Inhibitoren (PAI-1 und PAI-2) in Gewebsbiopsien von Patienten mit Dermatoliposklerose. Zum Nachweis verwandten wir dabei die Technik der reversen Transkription und Polymerase-Kettenreaktion (RT-PCR). Es fand sich in allen Hautproben (n = 21) eine signifikant erhöhte mRNA-Expression von uPA und uPA-R im Vergleich zu gesunder Haut (n = 12). Dagegen konnte kein signifikanter Unterschied für mRNA-Transkripte von tPA, PAI-1 und PAI-2 nachgewiesen werden. Die Dermatoliposklerose zeichnet sich somit durch erhöhte transkriptionelle Expression von uPA und uPA-R aus. Eine gesteigerte De-novo-Synthese von uPA und uPA-R könnte daher bei der Aktivierung von Matrix-Metalloproteinasen und entsprechend in der Pathogenese des Ulcus cruris venosum eine zentrale Rolle spielen.

scholarly journals Imunocompetent Mice Model for Dengue Virus Infection

2012 ◽  
Vol 2012 ◽  
pp. 1-12 ◽  
Author(s):  
Denise Gonçalves ◽  
Rafael de Queiroz Prado ◽  
Eric Almeida Xavier ◽  
Natália Cristina de Oliveira ◽  
Paulo Marcos da Matta Guedes ◽  
...  
Keyword(s):  
Animal Model ◽  
Virus Infection ◽  
Dengue Virus ◽  
Viral Disease ◽  
Mice Model ◽  
Rt Pcr ◽  
Dengue Virus Infection ◽  
Dengue Disease ◽  
The Family ◽  
The World

Dengue fever is a noncontagious infectious disease caused by dengue virus (DENV). DENV belongs to the familyFlaviviridae, genusFlavivirus, and is classified into four antigenically distinct serotypes: DENV-1, DENV-2, DENV-3, and DENV-4. The number of nations and people affected has increased steadily and today is considered the most widely spread arbovirus (arthropod-borne viral disease) in the world. The absence of an appropriate animal model for studying the disease has hindered the understanding of dengue pathogenesis. In our study, we have found that immunocompetent C57BL/6 mice infected intraperitoneally with DENV-1 presented some signs of dengue disease such as thrombocytopenia, spleen hemorrhage, liver damage, and increase in production of IFNγand TNFαcytokines. Moreover, the animals became viremic and the virus was detected in several organs by real-time RT-PCR. Thus, this animal model could be used to study mechanism of dengue virus infection, to test antiviral drugs, as well as to evaluate candidate vaccines.

scholarly journals De novo gonad transcriptome analysis of the common littoral shrimp Palaemon serratus: novel insights into sex-related genes

BMC Genomics ◽  
2019 ◽  
Vol 20 (1) ◽  
Author(s):  
Inés González-Castellano ◽  
Chiara Manfrin ◽  
Alberto Pallavicini ◽  
Andrés Martínez-Lage
Keyword(s):  
Transcriptome Analysis ◽  
De Novo ◽  
Expression Patterns ◽  
Gonadal Development ◽  
Differentially Expressed ◽  
Rna Seq ◽  
Illumina Hiseq ◽  
Specific Expression ◽  
Development Processes ◽  
The Common

Abstract Background The common littoral shrimp Palaemon serratus is an economically important decapod resource in some European communities. Aquaculture practices prevent the genetic deterioration of wild stocks caused by overfishing and at the same time enhance the production. The biotechnological manipulation of sex-related genes has the proved potential to improve the aquaculture production but the scarcity of genomic data about P. serratus hinders these applications. RNA-Seq analysis has been performed on ovary and testis samples to generate a reference gonadal transcriptome. Differential expression analyses were conducted between three ovary and three testis samples sequenced by Illumina HiSeq 4000 PE100 to reveal sex-related genes with sex-biased or sex-specific expression patterns. Results A total of 224.5 and 281.1 million paired-end reads were produced from ovary and testis samples, respectively. De novo assembly of ovary and testis trimmed reads yielded a transcriptome with 39,186 transcripts. The 29.57% of the transcriptome retrieved at least one annotation and 11,087 differentially expressed genes (DEGs) were detected between ovary and testis replicates. Six thousand two hundred seven genes were up-regulated in ovaries meanwhile 4880 genes were up-regulated in testes. Candidate genes to be involved in sexual development and gonadal development processes were retrieved from the transcriptome. These sex-related genes were discussed taking into account whether they were up-regulated in ovary, up-regulated in testis or not differentially expressed between gonads and in the framework of previous findings in other crustacean species. Conclusions This is the first transcriptome analysis of P. serratus gonads using RNA-Seq technology. Interesting findings about sex-related genes from an evolutionary perspective (such as Dmrt1) and for putative future aquaculture applications (Iag or vitellogenesis genes) are reported here. We provide a valuable dataset that will facilitate further research into the reproductive biology of this shrimp.

Sign in / Sign up

Export Citation Format

Share Document