First Report of a 16SrI (Aster Yellows) Group Phytoplasma on Garlic (Allium sativum) in the United States

During the growing season of 2012, 35 garlic plant samples were submitted to the University of Minnesota Plant Disease Clinic for disease diagnosis. Samples originated from multiple counties throughout Minnesota as well as Iowa, Wisconsin, and South Dakota. Symptoms first appeared at the time plants were starting to produce scapes. Symptoms included leaf discoloration that varied from yellow to purple, plant stunting, and leaf tip necrosis. In severe cases, the plants wilted and died. Bulbs of affected plants ranged from being soft and small to almost normal-looking. Symptoms were similar to those associated with phytoplasma infection in other plants. Total genomic DNA was extracted from 30 symptomatic samples and five asymptomatic leaf samples using a Qiagen DNeasy Plant Mini Kit (Qiagen, Germantown, MD) according to the manufacturer's instructions, and used with the universal phytoplasma primers P1/P7 in a direct PCR assay, and with P1/AYint in a nested PCR assay (2) to yield amplicons of 1.8 and 1.6 kb, respectively. Asymptomatic plants did not produce amplicons. Garlic cultivars displaying a range of symptoms tested positive for the presence of phytoplasma. These cultivars included: Susanville, Middle Eastern, Music, Ajo Rojo, Spanish Roja, Inchelium Red, Silver White, Asian Tempest, Chesnok Red, and Purple Glazer. The P1/P7 PCR products of 1,830 bp were purified using the PureLink PCR Purification kit (Life Technologies, Carlsbad, CA), and cloned in a pGem T-Easy vector system (Promega, Madison, WI). Sequences from a clone from each of Wisconsin, Iowa, and Minnesota were deposited in GenBank under the accession numbers KC000005, KC000006, and KC000007, respectively. A BLASTn similarity search revealed that the Wisconsin and Iowa isolates shared 99% homology to the sequences of 16SrI-A group phytoplasmas, aster yellows phytoplasma (AY389827), and aconitum proliferation phytoplasma (AF510323). The Minnesota isolate had 99% sequence homology to a 16SrI-B group phytoplasma, mulberry yellow dwarf phytoplasma (GQ249410). Also, the iPhyClassifier 16Sr group/subgroup classification based on similarity (3) analyses showed that the Wisconsin and Iowa phytoplasma isolates had 16S rDNA sequences in the 16SrI-A group with similarity coefficients of 0.97 and 1.00, respectively, to aster yellows witches'-broom phytoplasma AYWB (NC_007716). The same analysis revealed that the Minnesota phytoplasma isolate 16S rDNA sequence grouped with the 16SrI-B group onion yellows phytoplasma (NC_005303) with a similarity coefficient of 1.0. A phylogenic tree was deduced by the neighbor joining algorithm, clustering together the Iowa, Minnesota, and Wisconsin isolate sequences with a 16SrI group phytoplasma. Aster yellows phytoplasma has been reported in North America, but only in Canada (1). This is the first documented occurrence of 16SrI aster yellows group phytoplasma in garlic in the United States. The spring of 2012 was unusually warm, and high leafhopper pressure was observed throughout the Midwest; above average numbers of many ornamental crops and small grains were infected with phytoplasma. These events may have contributed to the phytoplasma infection in garlic. References: (1) A. H. Khadhair et al. Microbiol. Res. 157:161, 2002. (2) C. D. Smart et al. Appl. Env. Microbiol. 62:2988, 1996. (3) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2009.

Download Full-text

The pCS20 PCR assay for Ehrlichia ruminantium does not cross-react with the novel deer ehrlichial agent found in white-tailed deer in the United States of America

Onderstepoort Journal of Veterinary Research ◽

10.4102/ojvr.v71i2.271 ◽

2004 ◽

Vol 71 (2) ◽

Cited By ~ 4

Author(s):

S.M. Mahan ◽

B.H. Simbi ◽

M.J. Burridge

Keyword(s):

United States ◽

High Specificity ◽

Pcr Primers ◽

The United States ◽

Rrna Gene ◽

The Novel ◽

Pcr Assay ◽

Ehrlichia Ruminantium ◽

Cowdria Ruminantium ◽

Specificity And Sensitivity

White-tailed deer are susceptible to heartwater (Ehrlichia [Cowdria] ruminantium infection) and are likely to suffer high mortality if the disease spreads to the United States. It is vital, therefore, to validate a highly specific and sensitive detection method for E. ruminantium infection that can be reliably used in testing white-tailed deer, which are reservoirs of antigenically or genetically related agents such as Ehrlichia chaffeensis, Anaplasma (Ehrlichia) phagocytophilum (HGE agent) and Ehrlichia ewingii. Recently, a novel but as yet unnamed ehrlichial species, the white-tailed deer ehrlichia (WTDE), has been discovered in deer populations in the United States. Although the significance of WTDE as a pathogen is unknown at present, it can be distinguished from other Ehrlichia spp. based on 16S rRNA gene sequence analysis. In this study it was differentiated from E. ruminantium by the use of the pCS20 PCR assay which has high specificity and sensitivity for the detection of E. ruminantium. This assay did not amplify DNA from the WTDE DNA samples isolated from deer resident in Florida, Georgia and Missouri, but amplified the specific 279 bp fragment from E. ruminantium DNA. The specificity of the pCS20 PCR assay for E. ruminantium was confirmed by Southern hybridization. Similarly, the 16S PCR primers (nested) that amplify a specific 405-412 bp fragment from the WTDE DNA samples, did not amplify any product from E. ruminantium DNA. This result demonstrates that it would be possible to differentiate between E. ruminantium and the novel WTDE agent found in white tailed deer by applying the two respective PCR assays followed by Southern hybridizations. Since the pCS20 PCR assay also does not amplify any DNA products from E. chaffeensis or Ehrlichia canis DNA, it is therefore the method of choice for the detection of E. ruminantium in these deer and other animal hosts.

Download Full-text

First Report of an Aster Yellows Phytoplasma Associated with Cabbage in Southern Texas

Plant Disease ◽

10.1094/pdis.2001.85.4.447b ◽

2001 ◽

Vol 85 (4) ◽

pp. 447-447 ◽

Cited By ~ 6

Author(s):

I.-M. Lee ◽

R. A. Dane ◽

M. C. Black ◽

Noel Troxclair

Keyword(s):

16S Rdna ◽

Nested Pcr ◽

Restriction Enzymes ◽

Diagnostic Procedures ◽

Acid Extraction ◽

Insect Vector ◽

Aster Yellows ◽

First Report ◽

Pcr Products ◽

Aster Yellows Phytoplasma

In early spring 2000 carrot crops in southwestern Texas were severely infected by an outbreak of phyllody associated with aster yellows phytoplasma. Cabbage crops that had been planted adjacent to these carrot fields began to display previously unobserved symptoms characteristic of phytoplasma infection. Symptoms included purple discoloration in leaf veins and at the outer edges of leaves on cabbage heads. Proliferation of sprouts also occurred at the base of the stem and between leaf layers of some plants, and sprouts sometimes continued to proliferate on extended stems. About 5% of cabbage plants in the field exhibited these symptoms. Two symptomless and four symptomatic cabbage heads were collected in early April from one cabbage field. Veinal tissues were stripped from each sample and used for total nucleic acid extraction. To obtain specific and sufficient amount of PCR products for analysis, nested PCR was performed by using primer pairs (first with P1/P7 followed by R16F2n/R16R2) (1,2) universal for phytoplasma detection. A specific 16S rDNA fragment (about 1.2 kb) was strongly amplified from the four symptomatic but not from the two asymptomatic samples. The nested PCR products obtained from the four symptomatic samples were then analyzed by restriction fragment length polymorphism (RFLP) using the restriction enzymes MseI, HhaI, and HpaII, and the RFLP patterns were compared to the published patterns of known phytoplasmas (1). The resulting RFLP patterns were identical to those of a phytoplasma belonging to subgroup B of the aster yellows phytoplasma group (16SrI). These RFLP patterns were also evident in putative restriction sites observed in a 1.5 kbp nucleotide sequence of the 16S rDNA. This is the first report of aster yellows phytoplasma associated disease symptoms in cabbage in Texas. The occurrence of cabbage proliferation coincided with the presence of high populations of the insect vector, aster leafhopper. References: (1) I.-M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (2) B. Schneider et al. 1995. Molecular and Diagnostic Procedures in Mycoplasmology, Vol. I. Academic Press, San Diego, CA.

Download Full-text

Resistance to Quinone Outside Inhibitor Fungicides Conferred by the G143A Mutation in Cercospora sojina (Causal Agent of Frogeye Leaf Spot) Isolates from Michigan, Minnesota, and Nebraska Soybean Fields

Plant Health Progress ◽

10.1094/php-06-20-0052-br ◽

2020 ◽

Vol 21 (4) ◽

pp. 230-231 ◽

Cited By ~ 1

Author(s):

Danilo L. Neves ◽

Martin I. Chilvers ◽

Tamra A. Jackson-Ziems ◽

Dean K. Malvick ◽

Carl A. Bradley

Keyword(s):

United States ◽

Leaf Spot ◽

Fungicide Resistance ◽

The United States ◽

Pcr Assay ◽

Cercospora Sojina ◽

Qoi Fungicides ◽

Quinone Outside Inhibitor ◽

Frogeye Leaf Spot ◽

Important Disease

Frogeye leaf spot, caused by Cercospora sojina, is an important disease of soybean (Glycine max) in the United States. An important tactic to manage frogeye leaf spot is to apply foliar fungicides. Isolates of C. sojina were collected from soybean fields in one county in Michigan, three counties in Minnesota, and 10 counties in Nebraska in 2019, and they were tested for resistance to quinone outside inhibitor (QoI) fungicides using a discriminatory dose assay, a PCR assay, and DNA sequencing. Results of the testing indicated that QoI fungicide-resistant isolates were detected in isolates from all counties. Testing results also indicated that the G143A mutation was responsible for the QoI fungicide resistance. This is the first report of QoI fungicide-resistant C. sojina isolates in Michigan, Minnesota, and Nebraska and expands the geographical distribution of QoI fungicide-resistant C. sojina isolates to 18 states in total.

Download Full-text

Genetic Variation Among Geographically Disparate Isolates of Aster Yellows Phytoplasma in the Contiguous United States

Journal of Economic Entomology ◽

10.1093/jee/toz356 ◽

2020 ◽

Vol 113 (2) ◽

pp. 604-611 ◽

Cited By ~ 2

Author(s):

Justin Clements ◽

Marjorie Garcia ◽

Benjamin Bradford ◽

Linda Crubaugh ◽

Shannon Piper ◽

...

Keyword(s):

United States ◽

Aster Yellows ◽

Effector Genes ◽

Northern Latitudes ◽

Similarities And Differences ◽

Northern United States ◽

Macrosteles Quadrilineatus ◽

Aster Leafhopper ◽

Aster Yellows Phytoplasma ◽

Insight Into

Abstract Aster Yellows phytoplasma (AYp; Candidatus Phytoplasma asteris) is associated with diseases of herbaceous plants, including ornamentals and important commercial vegetable and grain crops. The aster leafhopper (ALH; Macrosteles quadrilineatus Forbes) is the predominant vector of these bacteria, though other leafhopper species can acquire and transmit AYp. Potentially inoculative leafhoppers are reported to overwinter in the southern United States and migrate to northern latitudes in the spring. Examining the genetic similarities and differences in AYp associated with southern and northern populations of ALH may provide insight into the role that migrating ALH play in AYp disease development. To investigate similarities among geographically distinct populations of ALH and characterize the variation in AYp associated within these populations, we identified genetic variations in subgroup designation and the relative proportions of secreted AY-WB proteins from field-collected populations of AYp isolated from ALH from select locations in the southern (Arkansas, Kansas, Oklahoma, and Texas) and the northern United States (Wisconsin) in 2016, 2017, and 2018. Isolated phytoplasma were tested for variation of AYp genotypes, numbers of potentially inoculative (AYp-positive) ALH, and presence of specific AYp virulence (effector) genes. Geographically distinct populations of ALH collected in northern and southern regions were similar in CO1 genotype but carried different proportions of AYp genotypes. While similar AYp strains were detected in geographically distinct locations, the proportion of each genotype varied over time.

Download Full-text

First Report of a 16SrI (Aster Yellows) Group Phytoplasma in Phlox in the United States

Plant Health Progress ◽

10.1094/php-br-16-0021 ◽

2016 ◽

Vol 17 (3) ◽

pp. 198-199

Author(s):

Andrew E. Sathoff ◽

Deepak Rajendran ◽

Seth D. Wannemuehler ◽

Katarina Sweeney ◽

Fazal Manan ◽

...

Keyword(s):

United States ◽

North America ◽

Flowering Time ◽

Flower Color ◽

The United States ◽

Aster Yellows ◽

First Report ◽

Color Range ◽

Small Grains ◽

Herbaceous Perennial

Phlox are herbaceous perennial ornamentals native to North America grown for their flower color, range in flowering time, scent, and differing forms. Candidatus Phytoplasma asteris, first found to occur in Chinese asters, is spread by aster leafhoppers and in 2001 was reported to be a serious threat to phlox. There have been several reports of Ca. P. asteris in garlic and small grains in Minnesota. This is the first report of Candidatus Phytoplasma asteris in phlox in Minnesota and the United States. Accepted for publication 28 June 2016. Published 6 September 2016.

Download Full-text

Comparison of Automated Quantitative Reverse Transcription-PCR and Direct Fluorescent-Antibody Detection for Routine Rabies Diagnosis in the United States

Journal of Clinical Microbiology ◽

10.1128/jcm.01227-15 ◽

2015 ◽

Vol 53 (9) ◽

pp. 2983-2989 ◽

Cited By ~ 15

Author(s):

Michelle Dupuis ◽

Scott Brunt ◽

Kim Appler ◽

April Davis ◽

Robert Rudd

Keyword(s):

United States ◽

Reverse Transcription ◽

Gold Standard ◽

Fluorescent Antibody ◽

The United States ◽

Pcr Assay ◽

Qrt Pcr ◽

Reverse Transcription Pcr ◽

Direct Fluorescent Antibody ◽

Rabies Diagnosis

Rabies virus found worldwide and prevalent throughout the United States continues to be a public health concern. Direct-fluorescent antibody (DFA) detection remains the gold standard for rabies virus diagnostics. Assessing the utility of a high-throughput molecular platform such as the QIAsymphony SP/AS, in conjunction with quantitative reverse transcription-PCR (qRT-PCR), to augment or potentially replace the DFA test, was the focus of this project. Here we describe a triplex qRT-PCR assay, including assembly and evaluation for sensitivity, specificity, and ability to detect variants. Additionally, we compared the qRT-PCR assay to the gold standard direct fluorescent-antibody test. More than 1,000 specimens submitted for routine rabies diagnosis were tested to directly compare the two methods. All results were in agreement between the two methods, with one additional specimen detected by qRT-PCR below the limits of the DFA sensitivity. With the proper continued validation for variant detection, molecular methods have a place in routine rabies diagnostics within the United States.

Download Full-text

Similarity, Pattern, and Grouping of Soybean Fungal Diseases in the United States: Implications for the Risk of Soybean Rust

Plant Disease ◽

10.1094/pdis-93-2-0162 ◽

2009 ◽

Vol 93 (2) ◽

pp. 162-169 ◽

Cited By ~ 6

Author(s):

X. Li ◽

X. B. Yang

Keyword(s):

United States ◽

Downy Mildew ◽

Geographical Distribution ◽

Leaf Spot ◽

The United States ◽

Fungal Diseases ◽

Brown Spot ◽

Soybean Rust ◽

Yield Losses ◽

Similarity Coefficients

Ten biological or ecological characteristics of pathogens/diseases were used to quantitatively describe 34 soybean (Glycine max) fungal diseases in the United States. These characteristics included optimal temperatures for disease development, host ranges, characteristics of disease cycle, and the pathogens' survival capacity. Gower's general similarity coefficients for pairs of diseases were determined and used in principal coordinate analysis (PCoA) to project the diseases into a two-dimensional space, in which significant patterns were identified for some of the characteristic variables, e.g., means of pathogen dispersal. Similarity coefficients indicated that soybean rust (Phakopsora pachyrhizi) resembled soybean downy mildew (Peronospora manshurica) and Leptosphaerulina leaf spot (Leptosphaerulina trifolii). Cluster analysis with multiscale bootstrapping identified two major clusters with high significance level (P > 0.95). In a loose cluster (P = 0.86), soybean rust was grouped with brown spot (Septoria glycines), frogeye leaf spot (Cercospora sojina), Phyllosticta leaf spot (Phyllosticta sojicola), purple seed stain (Cercospora kikuchii), downy mildew, and Leptosphaerulina leaf spot. Estimated soybean yield losses in the United States from 1996 to 2005 and the geographical distribution information of the diseases in this cluster implied that the potential geographical distribution range of soybean rust may include most U.S. soybean production regions and that yield losses would be light in the north but moderate in the south if environmental conditions are conducive.

Download Full-text

First Report of Aster Yellows Phytoplasma in Alfalfa

Plant Disease ◽

10.1094/pdis.1999.83.5.488c ◽

1999 ◽

Vol 83 (5) ◽

pp. 488-488 ◽

Cited By ~ 10

Author(s):

R. D. Peters ◽

M. E. Lee ◽

C. R. Grau ◽

S. J. Driscoll ◽

R. M. Winberg ◽

...

Keyword(s):

16S Rdna ◽

Nested Pcr ◽

Sequence Data ◽

Sequence Similarity ◽

Similarity Function ◽

Sterile Water ◽

Aster Yellows ◽

First Report ◽

Pcr Product ◽

Aster Yellows Phytoplasma

Samples of alfalfa (Medicago sativa L.) leaves and stems showing symptoms of inter-veinal chlorosis and purpling, commonly associated with insect feeding, were collected from 8 sites in central and southern Wisconsin in autumn of 1998. Samples were frozen within 24 h of collection. Approximately 0.3 g of plant tissue from each sample was used for total DNA extraction according to the protocol of Zhang et al. (4), with minor modifications in grinding procedures and reagent volumes to optimize results. Nested polymerase chain reaction (PCR) was carried out by amplification of 16S rDNA with the universal primer pairs R16mF2/R16mR1 followed by R16F2n/R16R2 as described by Gunder-sen and Lee (1). Undiluted total sample DNA was used for the first amplification; PCR products were diluted (1:30) in sterile water prior to final amplification. Alfalfa DNA and sterile water were used as negative controls; DNA from phytoplasma causing X-disease in peach (CX) served as a positive control. Fragments of 16S rDNA from putative phytoplasmas amplified by PCR with the primer pair R16F2n/R16R2 were characterized by restriction endonuclease digestion (3). The resulting restriction fragment length polymorphism (RFLP) patterns were compared with patterns for known phytoplasmas described by Lee et al. (3). Products of nested PCR were also purified and sequenced with primers R16F2n/R16R2 and an automated DNA sequencer (ABI 377XL; C. Nicolet, Biotechnology Center, University of Wisconsin-Madison). Of 51 samples of alfalfa assessed, one sample from Evansville, WI, yielded a nested PCR product of the appropriate size (1.2 kb), indicating the presence of phytoplasma. Digestion of this product with various restriction enzymes produced RFLP patterns that were identical to those for phytoplasmas in the aster yellows phytoplasma subgroup 16SrI-A (3). Alignment of the DNA sequence of the nested PCR product from the positive sample with sequences found in the GenBank sequence data base (National Center for Biotechnology Information, Bethesda, MD) with the BLAST sequence similarity function confirmed this result. Although other phytoplasma strains (particularly those causing witches'-broom) have been reported to infect alfalfa (2), this is the first report of the presence of the aster yellows phytoplasma in the alfalfa crop. Vectors involved in transmission and the potential agronomic impacts of aster yellows phytoplasma in alfalfa are topics of current investigation. References: (1) D. E. Gundersen and I.-M. Lee. Phytopathol. Mediterr. 35:144, 1996. (2) A.-H. Khadhair et al. Microbiol. Res. 152:269, 1997. (3) I.-M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (4) Y.-P. Zhang et al. J. Virol. Methods 71:45, 1998.

Download Full-text

Association of Burkholderia glumae and B. gladioli with Panicle Blight Symptoms on Rice in Panama

Plant Disease ◽

10.1094/pdis-91-6-0767c ◽

2007 ◽

Vol 91 (6) ◽

pp. 767-767 ◽

Cited By ~ 26

Author(s):

R. Nandakumar ◽

M. C. Rush ◽

F. Correa

Keyword(s):

United States ◽

Fatty Acid ◽

16S Rdna ◽

Latin American ◽

The United States ◽

Unknown Etiology ◽

Rice Grain ◽

Burkholderia Glumae ◽

Specific Primers ◽

Panicle Blight

Panicle blight of rice, caused by Burkholderia glumae, has been a serious problem on rice in Japan since 1955. It has been reported from other rice-producing countries around the world and recently was reported on rice in the southern United States (2). A rice producer in Panama contacted us to verify the occurrence of bacterial panicle blight in rice fields where heavy losses were associated with a disease of unknown etiology, but with typical bacterial panicle blight symptoms (2). The observed grain discoloration, sterility, and abortion were thought to be due to the spinki mite, Steneotarsonemus spinki Smiley. After obtaining a USDA-APHIS import permit (73325), rice panicle samples from seven fields in Panama were sent to our laboratory in 2006. Bacteria were isolated from grains showing typical panicle blight symptoms on the semiselective S-Pg medium. Nonfluorescing colonies producing toxoflavin on King's B medium were selected for further identification. Initial PCR analyses, made with DNA isolated directly from grain crushed in sterile water, with B. glumae specific primers (BGF 5′ACACGG AACACCTGGGTA3′ and BGR 5′TCGCTCTCCCGAAGAGAT3′) gave a positive reaction for B. glumae in all seven samples. Biolog tests (Biolog Inc, Hayward, CA), fatty acid analysis, and PCR using species-specific primers for B. glumae and B. gladioli (BLF 5′CGAGCT AATACCGCGAAA3′ and BLR 5′AGACTCGA GTCAACTGA3′) identified 19 B. glumae and 6 B. gladioli strains among 35 bacterial strains isolated. Only the Biolog and fatty acid analyses identified B. gladioli strains. PCR analysis did not identify B. gladioli strains. To confirm B. gladioli, PCR amplification of the 16S rDNA gene from eight representative strains (four each for B. glumae and B. gladioli) using universal primers (16SF 5′AGAGTTTGATCCTGGCTCAG3′ and 16SR5′GGCTACCTTGTTACGACTT3′) and further sequencing of the PCR product was performed. A BLAST analysis of 16S rDNA sequences in the Genbank data base showed 99% sequence similarity for these two species with other published sequences. Our APHIS import permit did not allow us to perform pathogenicity tests with the strains isolated from Panama, but the B. glumae and B. gladioli strains obtained corresponded closely with pathogenic control cultures isolated from rice grown in the United States or with strains obtained from the ATCC. Other B. glumae strains recently isolated from rice in Panama, and identified by PCR, were tested for pathogenicity in tests conducted at CIAT in Colombia and were found to be pathogenic and highly virulent. These strains caused disease on seedlings when inoculated and typical bacterial panicle blight symptoms on panicles when spray inoculated. This disease has caused severe losses in Panama's rice crop for at least 3 years. Similar symptoms reported in Cuba, Haiti, and the Dominican Republic were attributed to damage from the spinki mite in association with Sarocladium oryzae (Sawada) W. Gams & D. Hawksw. (1). Zeigler and Alvarez (3) reported the occurrence of B. glumae in Columbia in 1987, but not in other Latin American countries. Pseudomonas fuscovaginae was reported in association with rice grain discoloration in Panama (4), but to our knowledge, this is the first report of these two Burkholderia species being associated with panicle blight symptoms on rice in Panama. References: (1) T. B. Bernal et al. Fitosanidad 6:15, 2002. (2). A. K. M. Shahjahan et al. Rice J. 103:26, 2000. (3). R. S. Zeigler and E. Alvarez. Plant Dis. 73:368, 1989. (4). R. S. Zeigler et al. Plant Dis. 71:896, 1987.

Download Full-text