First Report of Botryosphaeria dothidea causing leaf necrosis of Camellia sinensis in Fujian Province, China

The Aegean region (western Turkey) is the center of table, raisin, and wine grape cultivation. During the 2012 growing season, wood canker symptoms were observed in vineyards in Manisa city. Symptoms adjacent to pruning wounds, including shoot dieback and wedge-shaped wood discolorations observed in cross section, were among the most prevalent symptoms of the vines. To identify the causal agents, symptomatic woody tissues were surface disinfested with 95% ethanol and flame-sterilized and the discolored outer bark was cut away. The internal tissues (0.5 cm2) were excised from cankers of vines and plated onto potato dextrose agar amended with tetracycline (0.01%) (PDA-tet). The most frequently isolated fungi, based on general growth pattern, speed of growth, and colony color, resembled species in the Botryosphaeriaceae family. According to morphological characteristics, four different groups have been identified based on visual discrimination. After DNA extraction, ribosomal DNA fragments (ITS1-5.8S-ITS2) (2) amplified with ITS4 and ITS5 primers were sequenced and sequences were compared with those deposited in NCBI GenBank database. Four different Botryosphaeriaceae isolates were identified, including Botryosphaeria dothidea (MBAi25AG), Diplodia seriata (MBAi23AG), Lasiodiplodia theobromae (MBAi28AG), and Neofusicoccum parvum (MBAi27AG) (Accession Nos. KF182329, KF182328, KF182331, and KF182330, respectively) with species nomenclature based on Crous et al. (1). Pathogenicity tests were conducted under greenhouse conditions (24°C, 16/8-h day/night, 70% RH) on 1-year-old own rooted grapevine (Vitis vinifera) cv. Sultana Seedless seedlings using one isolate from each of the Botryosphaeriaceae species specified above. Stems of grapevine seedlings were wounded by removing bark with 4-mm cork borer and fresh mycelial plugs were inoculated into the holes and covered with Parafilm. Sterile PDA plugs were placed into the wounds of control seedlings. Five vines were inoculated per isolate. The experiment was repeated twice. After 4 months of incubation, grapevine seedlings were examined for the extent of vascular discoloration and recovery of fungal isolates. Mean lesion lengths on wood tissues were 85.3, 17.2, 13.9, and 13.1 mm for N. parvum, B. dothidea, L. theobromae, and D. seriata, and 6.3 mm for control. Each fungal isolate was successfully re-isolated from inoculated seedlings to fulfill Koch's postulates. To our knowledge, this is the first report of multiple species in the Botryosphaeriaceae causing wood canker and dieback on grapevine in Turkey. These results are significant because Botryosphaeriaceae species are known causal agents of grapevine trunk disease worldwide (3). References: (1) P. W. Crous et al. Stud. Mycol. 55:235, 2006. (2) B. Slippers et al. Mycologia 96:83, 2004. (3) J. R. Urbez-Torres. Phytopathol. Mediterr. 50:S5, 2011.

Download Full-text

First Report of Meloidogyne enterolobii on Carrot in China

Plant Disease ◽

10.1094/pdis-02-14-0119-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 1019-1019 ◽

Cited By ~ 2

Author(s):

Y. F. Wang ◽

S. Xiao ◽

Y. K. Huang ◽

X. Zhou ◽

S. S. Zhang ◽

...

Keyword(s):

Morphological Characteristics ◽

Severe Infection ◽

Original Description ◽

First Record ◽

Vegetable Crops ◽

Species Identity ◽

Fujian Province ◽

First Report ◽

Lateral Lines ◽

Meloidogyne Sp

Carrot (Daucus carota var. sativus) is one of the 10 most economically important vegetable crops in the world. Recently, stunted and yellowing carrots grown on sandy soil in several commercial fields were observed in Dongshan County, Fujian Province, China. Many round to irregular shaped lumps and swellings were present on the surface of tap and fibrous roots, often with secondary roots emerging from the galls on taproots. Severe infection caused short, stubby, forked taproots leading to losses in quality and marketability. Meloidogyne sp. females and egg masses were dissected from the galls. The perineal patterns from 20 females were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. The second-stage juvenile mean body length (n = 20) was 416 (390 to 461) μm; lateral lips were large and triangular in face view; tail was thin and length was averaged 56.1 (49.8 to 62.1) μm, with a broad, bluntly rounded tip. These morphological characteristics matched the original description of M. enterolobii (5). Species identity was further explored by sequencing the mitochondrial DNA (mtDNA) region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTA GT) (4). A DNA fragment of ~840 bp was obtained and the sequence (GenBank Accession No. KJ146864) was compared with those in GenBank using BLAST and was 100% identical to the sequences of M. enterolobii and M. mayaguensis, a synonym of M. enterolobii (4). Part of the rDNA spanning ITS1, 5.8S gene, ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (3), and the sequence obtained (KJ146863) was 99 to 100% identical to sequences of M. enterolobii (KF418369.1, KF418370.1, JX024149.1, and JQ082448.1). For further confirmation, M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (2) were used for amplification of the rDNA-IGS2 sequences of eight populations of the nematode from three localities. A 200-bp amplification product was produced by each population, whereas no product was amplified from control populations of M. incognita or M. javanica. A single product of ~320 bp was obtained using primers 63VNL/63VTH (GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC ) (1) from the mtDNA 63-bp repeat region for these populations, and the sequence (KJ146861) showed 100% identity with sequences of M. enterolobii (AJ421395.1, JF309159.1, and JF309160.1). Therefore, the population of Meloidogyne sp. on carrot was confirmed to be M. enterolobii. This nematode has been reported to infect more than 20 plant species belonging to seven families, including Annonaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae in China. To our knowledge, this is the first report of infection of carrot by M. enterolobii and the first record of M. enterolobii parasitizing a plant in the family Apiaceae in China. M. enterolobii has been reported in Guangdong and Hainan provinces, China. This is the first report of M. enterolobii in Fujian Province, in southeast China. References: (1) V. C. Blok et al. Nematology 4:773, 2002. (2) H. Long et al. Acta Phytopathol. Sin. 36:109, 2006. (3) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (4) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text

First Report of Botryosphaeria dothidea, Diplodia seriata, and Neofusicoccum luteum Associated with Canker and Dieback of Grapevines in Tunisia

Plant Disease ◽

10.1094/pdis-05-13-0530-pdn ◽

2014 ◽

Vol 98 (3) ◽

pp. 420-420 ◽

Cited By ~ 6

Author(s):

S. Chebil ◽

R. Fersi ◽

A. Yakoub ◽

S. Chenenaoui ◽

M. Chattaoui ◽

...

Keyword(s):

Morphological Characteristics ◽

Aerial Mycelium ◽

Its2 Region ◽

Pathogenicity Test ◽

Botryosphaeria Dothidea ◽

Diplodia Seriata ◽

First Report ◽

Grapevine Dieback ◽

Pinus Spp ◽

Neofusicoccum Luteum

In 2011, common symptoms of grapevine dieback were frequently observed in 2- to 5-year-old table grape (Vitis vinifera L.) cvs. in four vineyards located in northern Tunisia. The symptoms included dead spur and cordons, shoot dieback, and sunken necrotic bark lesions, which progressed into the trunk resulting in the death of large sections of the vine. Longitudinal and transversal sections of cordons and spurs from symptomatic vines revealed brown wedge-shaped cankers of hard consistency. Twelve symptomatic samples from spur and cordons were collected, surface disinfected by dipping into 5% (v/v) sodium hypochlorite for 2 min, and small pieces from the edge of necrotic and healthy tissue were removed and plated onto potato dextrose agar (PDA) at 25°C in the dark. Based on colony and conidia morphological characteristics, isolates were divided in three species, named Diplodia seriata, Botryosphaeria dothidea, and Neofusicoccum luteum. D. seriata colonies were gray-brown with dense aerial mycelium producing brown cylindric to ellipsoid conidia rounded at both ends and averaged 22.4 × 11.7 μm (n = 50). B. dothidea colonies were initially white with abundant aerial mycelium, gradually becoming dark green olivaceous. Conidia were fusiform to fusiform elliptical with a subobtuse apex and averaged 24.8 × 4.7 μm (n = 50). N. luteum colonies were initially pale to colorless, gradually darkening with age and becoming gray to dark gray producing a yellow pigment that diffuses into the agar. Conidia were hyaline, thin-walled, aseptate, fusiform to fusiform elliptical, and averaged 19.8 × 5.5 μm (n = 50). Identity of the different taxa was confirmed by sequence analyses of the internal transcribed spacer (ITS1-5.8S-ITS2) region of the rDNA and part of the elongation factor 1-alpha (EF1-α) gene. BLAST analysis of sequences indicated that six isolates were identified as D. seriata (GenBank: AY259094, AY343353), one isolate as B. dothidea (AY236949, AY786319) and one isolate as N. luteum (AY259091, AY573217). Sequences were deposited in GenBank under accessions from KC178817 to KC178824 and from KF546829 to KF546836 for ITS region and EF1-α gene, respectively. A pathogenicity test was conducted on detached green shoots cv. Italia for the eight Botryosphaeriaceae isolates. Shoots were inoculated by placing a colonized agar plug (5 mm diameter) from the margin of a 7-day-old colony on fresh wound sites made with a sterilized scalpel. Each wound was covered with moisturized cotton and sealed with Parafilm. Control shoots were inoculated using non-colonized PDA plugs. After 6 weeks, discoloration of xylem and phloem and necrosis with average length of 38.8, 17.6, and 11.2 mm were observed from inoculated shoots with D. seriata, N. luteum, and B. dothidea, respectively, and all three fungi were re-isolated from necrotic tissue, satisfying Koch's postulates. Control shoots showed no symptoms of the disease and no fungus was re-isolated. In Tunisia, Botryosphaeria-related dieback was reported only on citrus tree caused by B. ribis (2), on Pinus spp. caused by D. pinea (4), on Quercus spp. caused by D. corticola (3), and on olive tree (Olea europea) caused by D. seriata (1). To our knowledge, this is the first report of D. seriata, B. dothidea, and N. luteum associated with grapevine dieback in Tunisia. References: (1) M. Chattaoui et al. Plant Dis. 96:905, 2012. (2) H. S. Fawcett. Calif. Citrogr. 16:208, 1931. (3) B. T. Linaldeddu et al. J. Plant Pathol. 91:234. 2009. (4) B. T. Linaldeddu et al. Phytopathol. Mediterr. 47:258, 2008.

Download Full-text

First Report of Botryosphaeria dothidea Causing Canker of Betula alnoides in China

Plant Disease ◽

10.1094/pdis-03-20-0582-pdn ◽

2020 ◽

Vol 104 (11) ◽

pp. 3081

Author(s):

Shengkun Wang ◽

Junkun Lu ◽

Sen Meng ◽

Jie Song ◽

Junfeng Liang

Keyword(s):

Botryosphaeria Dothidea ◽

First Report ◽

Betula Alnoides

Download Full-text

Sporulation Capacity and Longevity of Puccinia horiana Teliospores in Infected Chrysanthemum Leaves

Plant Health Progress ◽

10.1094/php-2013-0823-01-rs ◽

2013 ◽

Vol 14 (1) ◽

pp. 11 ◽

Cited By ~ 3

Author(s):

Morris R. Bonde ◽

Cristi L. Palmer ◽

Douglas G. Luster ◽

Susan E. Nester ◽

Jason M. Revell ◽

...

Keyword(s):

United States ◽

Fungal Pathogen ◽

Local Environment ◽

The United States ◽

First Report ◽

White Rust ◽

Teliospore Germination ◽

Sporulation Capacity ◽

Leaf Necrosis ◽

Puccinia Horiana

Puccinia horiana Henn., a quarantine-significant fungal pathogen and causal agent of chrysanthemum white rust (CWR), was first discovered in the United States in 1977 and later believed to have been eradicated. Recently, however, the disease has sporadically reappeared in the northeastern US. Possible explanations for the reappearance include survival of the pathogen in the local environment, and reintroduction from other locations. To determine the possibility that the pathogen might be overwintering in the field, we undertook the study described here. Results from the study showed that P. horiana teliospores, imbedded in infected leaves, were capable of sporulating 2 weeks after inoculation, and this capacity continued until the leaf became necrotic and desiccated. This is the first report of the extreme susceptibility of P. horiana teliospores to leaf necrosis and desiccation and suggests that field infections following winter are unlikely to originate from teliospores. Teliospore germination on excised leaves was shown to be inhibited by light. Accepted for publication 3 April 2013. Published 23 August 2013.

Download Full-text