scholarly journals First Report of Cowpea mild mottle virus in Cowpea and French Bean in Taiwan

Plant Disease ◽  
2013 ◽  
Vol 97 (7) ◽  
pp. 1001-1001 ◽  
Author(s):  
C. A. Chang ◽  
L. Y. Chien ◽  
C. F. Tsai ◽  
Y. Y. Lin ◽  
Y. H. Cheng
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
French Bean ◽  
Mottle Virus ◽  
Replicase Gene ◽  
Degenerate Primers ◽  
French Beans ◽  
Cp Gene ◽  
Asparagus Bean ◽  
Sequence Identities

In 2009, more than 50% of vine type French beans were found bearing severe viral symptoms in a vegetable garden in Nantou County, Taiwan. Infected plants were stunted and exhibited pronounced mottling symptoms on their leaves. The symptomatic plants were mechanically inoculated on Chenopodium quinoa and local lesions developed 7 to 10 days after inoculation. The virus source established by back isolation the single lesion from C. quinoa on French beans developed symptoms similar to those found in the field. Host range test showed that this isolate could only infect leguminous plants, including soybean, mung bean, pea, peanut, asparagus bean, cowpea, adzuki bean, and lima bean, but not cucurbitaceous and solanaceous plants. Since only Cucumber mosaic virus (CMV) has been reported in Taiwan to induce similar symptoms in French beans, we tested both the field collected and inoculated French beans by CMV antiserum in ELISA but obtained a negative result. Due to subsequent electron microscopy studies that found potyvirus and carlavirus like particles in the leaf dips of infected French beans, we conducted reverse transcription (RT)-PCR using generic degenerate primers for potyviruses (Hrp5/Pot1 (2) and PotZ/Pot1 (3)) and carlaviruses (Decarla-u2 (5′-TGCACTGARTCMGAYTATGARGCYTT-3′ and Decarla-d1 (5′-GCACATRTCRTCVCCDGCAAA-3′) previously designed in our lab. No amplification was found from the potyvirus primers, while the carlavirus one gave an expected amplicon of 285 bp, which was found sharing 81% nucleotide sequence identity with the replicase gene of Cowpea mild mottle virus (CpMMV) (GenBank Accession No. FJ560903). A primer pair (CpMMV-CPu: 5′-TTTACTCTTAggTWATggAgTC-3′ and CpMMV-CPd: 5′-CCTATTAAAACACACAAHTCAAA-3′) was thus designed to amplify the complete coat protein (CP) gene based on the reported CP sequences and obtained an expected 867-bp product from our French bean isolate. This 867-bp sequence (JX020701) was confirmed to have 97.6% amino acid sequence identities with the CP gene of a Puerto Rican CpMMV isolate (GU191840). In a separate survey, another isolate from asparagus bean (CpMMV-V) causing mild mottling symptom was obtained. Analyses of the CP gene of CpMMV-V (JX070669) confirmed that it shared 88.8% and 97.8% of nucleotide and amino acid sequence identities with the French bean isolate, respectively. Different from most carlaviruses with aphid transmissibility, CpMMV has been shown to be transmitted non-persistently by whiteflies (1). Both CpMMV isolates from Taiwan were confirmed to be transmitted by silver leaf whiteflies (Bemicia argentifolii Bellows and Perring). This is the first record of whitefly transmissible legume virus in Taiwan. Since whitefly has been a problem in agriculture worldwide, CpMMV can be a new emerging threat for Taiwan's legume crop production. References: (1) M. Iwaki et al. Plant Dis. 66:365, 1982. (2) S. S. Pappu et al. J. Virol. Methods 41:9, 1993. (3) F. M. Zerbini et al. Phytopathology 85:746.

scholarly journals First Report of Bidens mottle virus Infecting Calendula in Taiwan

Plant Disease ◽  
2011 ◽  
Vol 95 (3) ◽  
pp. 362-362 ◽  
Author(s):  
C.-H. Huang ◽  
F.-J. Jan
Keyword(s):  
Amino Acid ◽  
Inclusion Bodies ◽  
Amino Acid Identity ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Acid Identity ◽  
First Report ◽  
Cp Gene ◽  
Dna Fragment

In March of 2010, calendula (Calendula officinalis L.), a perennial herb known as the pot marigold, showing chlorotic spots on leaves, chlorosis, and stunting were collected from Puli Township, Nantou County, Taiwan. The disorder occurred in more than 50% of the calendula plants in the field. A virus culture isolated from one of the symptomatic calendulas was established in Chenopodium quinoa through triple single-lesion isolation and designated as TwCa1. With transmission electron microscopy (TEM), negatively stained flexuous filamentous virions approximately 12 × 720 nm were observed in the crude sap of TwCa1-infected C. quinoa leaves and pinwheel inclusion bodies were found in the infected cells. On the basis of the sizes of the viral particles and inclusion bodies, isolate TwCa1 was a suspected potyvirus. By reverse transcription (RT)-PCR and potyvirus degenerate primers (Hrp5/Pot1) (1,2), a 0.65-kb DNA fragment, which included the 3′-end of the NIb gene and the 5′-end of coat protein (CP) gene of the virus, was amplified from total RNA isolated from TwCa1-infected plants. The amplified DNA fragment was cloned and sequenced. A homology search indicated that the new calendula-infecting virus in Taiwan might belong to Bidens mottle virus (BiMoV) because its partial genomic sequence shared 94.9 to 97.3% nucleotide and 96.6 to 98.1% amino acid identity with 11 BiMoV isolates available in NCBI GenBank. Primer pairs Hrp5/oligo d(T) were used to amplify the 3′-end genome of BioMV TwCa1 including the 3′-end of the NIb gene, the full-length CP gene, and the 3′-nontranslatable region of the virus. The 807-nt CP gene of TwCa1 (Accession No. HQ117871) shared 97.3 to 98.6% nucleotide and 98.5 to 98.9% amino acid identity with those of 11 BiMoV isolates available in GenBank. Results from TEM observations and CP gene sequence analysis indicated that TwCa1 is an isolate of BiMoV. BiMoV was later detected by RT-PCR in eight symptomatic calendulas collected from the same field. To our knowledge, this is the first report of BiMoV infecting calendula in Taiwan. This newly identified calendula-infecting BiMoV could have a direct impact on the economically important vegetable and floral industry in Taiwan. References: (1) C. C. Chen et al. Bot. Stud. 947:369, 2006. (2) D. Colinet and J. Kummert. J. Virol. Methods 45:149, 1993.

scholarly journals First Report of Cherry green ring mottle virus and Cherry necrotic rusty mottle virus in Sweet Cherry (Prunus avium) in Chile and South America

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1122-1122 ◽  
Author(s):  
N. Fiore ◽  
A. Zamorano
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Sweet Cherry ◽  
Mottle Virus ◽  
Reference Sequence ◽  
Nucleotide Identity ◽  
Green Ring ◽  
Sequence Identity ◽  
Cp Gene ◽  
Plant Pathol

Cherry green ring mottle virus (CGRMV) infects several Prunus species, while Cherry necrotic rusty mottle virus (CNRMV) has been detected mainly in sweet cherry. In Chile, sweet cherry represents one of the most valuable fruit crops, and the country is the main producer of cherries in the southern hemisphere. In October 2011, leaf samples were collected from 21 trees of cv. Bing in Libertador General Bernardo O'Higgins and Maule regions. Leaves of symptomatic plants showed brown angular necrotic spots, the center of which can drop out giving a shot-hole appearance. Total RNA was extracted by the silica capture method (1). Reverse transcription (RT)-PCR was carried out to test the presence of CGRMV and CNRMV using primer pairs GRM7950/GRM8316 (1), and DetCNR-F (TCCCACCTCAAGTCCTAGCAGAGA) / DetCNR-R (TCATTGCTAATTGCAAAATCCCA). Ten and six samples were tested positive for CGRMV and CNRMV, obtaining 366- and 333-bp fragments, respectively. Mixed infections occurred in five samples. Two sets of primer pairs were designed to amplify a region of the genome which includes the entire coat protein (CP) gene: CGRM-CPF (GGCTGATGAAGAATTTGA-GAAG) and CGRM-CPR (GAGTGGAATTGCAGGGGTTT), and CNRM-CPF (GAGTGTGTGTGAGCTTTCAAGTT) and CNRM-CPR (TTCGCCCCGTGTTGTAAAAC). Amplicons of the expected size of 828 bp (CGRMV) and 892 bp (CNRMV) were obtained from infected samples. Three amplicons for each virus were cloned into pGEM-T and three colonies per cloned fragment were sequenced in both directions. For CNRMV, Chilean isolates CP9754 (GenBank Accession No. KC432619) and CP9956N (KC432621) had 98% for nucleotide identity with isolate JK10 from India (FN546178), while isolate CP9879 (KC432620) had 97% of nucleotide identity. For CGRMV, Chilean isolate CP3359 (KC432616) had 98% identity with isolate HI17 from Poland (JX468873), while isolates CP9731 (KC432617) and CP9956G (KC432618) had 98% and 99% nucleotide identity with isolate ita7 (AF533161) from Italy, respectively. Nucleotide and amino acid sequence identity between Chilean isolates of CGRMV ranged between 94.5% and 99.3%, and from 97.8% to 99.2%, respectively. For Chilean isolates of CNRMV, sequence identity ranged between 98.0% and 98.5% (nucleotide), and from 98.6% to 98.9% (amino acid). Sequence analysis indicated that CGRMV isolates found in Chile belong to group II (3). Detection was confirmed by non-isotopic molecular hybridization. Riboprobes were designed on the basis of a consensus sequence of CP gene and labeled with digoxigenin (2); are complementary to the fragments located from the nucleotide 7415 to 7576 for CGRMV (reference sequence NC 001946.1), and 7475 to 7638 for CNRMV (reference sequence NC 002468.1). The cultivar Bing manifested symptoms only when infected by CNRMV. Results suggest that CNRMV is the cause of symptoms and yield loss observed in Bing, the most important cherry variety cultivated in Chile. To our knowledge, this is the first report of CGRMV and CNRMV infecting sweet cherry in South America. References: (1) M. E. Rott and W. Jelkmann. Eur. J. Plant Pathol. 107:411, 2001. (2) J. A Sánchez-Navarro et al. Plant Pathol. 47:780, 1998. (3) Y. P. Zhang et al. J. Plant. Pathol. 82:49, 2000.

scholarly journals Engineered Resistance Against Papaya ringspot virus in Venezuelan Transgenic Papayas

Plant Disease ◽  
2004 ◽  
Vol 88 (5) ◽  
pp. 516-522 ◽  
Author(s):  
Gustavo Fermin ◽  
Valentina Inglessis ◽  
Cesar Garboza ◽  
Sairo Rangel ◽  
Manuel Dagert ◽  
...  
Keyword(s):  
Amino Acid ◽  
Agrobacterium Tumefaciens ◽  
Coat Protein ◽  
Amino Acid Sequence ◽  
Sequence Similarity ◽  
Ringspot Virus ◽  
Amino Acid Sequence Similarity ◽  
Papaya Ringspot Virus ◽  
Local Varieties ◽  
Cp Gene

Local varieties of papaya grown in the Andean foothills of Mérida, Venezuela, were transformed independently with the coat protein (CP) gene from two different geographical Papaya ringspot virus (PRSV) isolates, designated VE and LA, via Agrobacterium tumefaciens. The CP genes of both PRSV isolates show 92 and 96% nucleotide and amino acid sequence similarity, respectively. Four PRSV-resistant R0 plants were intercrossed or selfed, and the progenies were tested for resistance against the homologous isolates VE and LA, and the heterologous isolates HA (Hawaii) and TH (Thailand) in greenhouse conditions. Resistance was affected by sequence similarity between the transgenes and the challenge viruses: resistance values were higher for plants challenged with the homologous isolates (92 to 100% similarity) than with the Hawaiian (94% similarity) and, lastly, Thailand isolates (88 to 89% similarity). Our results show that PRSV CP gene effectively protects local varieties of papaya against homologous and heterologous isolates of PRSV.

scholarly journals A New Hypothesis on the Strategy for Acquisition of Phosphorus in Arbuscular Mycorrhiza: Up-Regulation of Secreted Acid Phosphatase Gene in the Host Plant

2005 ◽  
Vol 18 (10) ◽  
pp. 1046-1053 ◽  
Author(s):  
Tatsuhiro Ezawa ◽  
Masahito Hayatsu ◽  
Masanori Saito
Keyword(s):  
Acid Phosphatase ◽  
Amino Acid ◽  
Amino Acid Sequence ◽  
Mycorrhizal Colonization ◽  
Purple Acid Phosphatase ◽  
Terminal Amino Acid ◽  
Degenerate Primers ◽  
Fungal Partner ◽  
Terminal Amino ◽  
Terminal Amino Acid Sequence

The mycorrhiza-responsive phosphatase of Tagetes patula in symbiosis with Glomus etunicatum was detected by electrophoresis, was purified by column chromatography, and was characterized as acid phosphatase that was secreted into rhizosphere. The N-terminal amino acid sequence was determined by a gas-phase sequencer, and a cDNA fragment of the phosphatase gene (TpPAP1) was amplified by degenerate primers designed based on the N-terminal amino acid sequence. The full-length cDNA was obtained by the rapid amplification of cDNA ends technique. The TpPAP1 was of host origin, and the cDNA was 1,843 bp long with a predicted open reading frame of polypeptide of 466 amino acids. Phylogenetic analysis revealed that the gene fell into the cluster of plant high-molecular-weight purple acid phosphatase. Expression analysis of the TpPAP1 in T. patula in symbiosis with Archaeospora leptoticha showed that the levels of transcripts increased eightfold by mycorrhizal colonization. Western blot analysis revealed that the 57-kDa protein corresponding to the mycorrhiza-responsive phosphatase increased by mycorrhizal colonization. The present study proposes a new strategy for acquisition of P in arbuscular mycorrhizal associations in which the fungal partner activates a part of the low-P adaptation system of the plant partner, phosphatase secretion, and improves the overall efficiency of P uptake.

scholarly journals Evolutionary conservation of the vertebrate Ah (dioxin) receptor: amplification and sequencing of the PAS domain of a teleost Ah receptor cDNA

1995 ◽  
Vol 310 (2) ◽  
pp. 383-387 ◽  
Author(s):  
M E Hahn ◽  
S I Karchner
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Evolutionary Conservation ◽  
Ah Receptor ◽  
Pas Domain ◽  
Cdna Fragment ◽  
Degenerate Primers ◽  
Reverse Transcription Pcr ◽  
Receptor Cdna ◽  
Dioxin Receptor

The PAS domain of a teleost Ah receptor was amplified using reverse transcription-PCR with degenerate primers containing inosine. The deduced amino acid sequence of the amplified cDNA fragment was 62-64% identical with the PAS domains of mammalian Ah receptors. These data demonstrate the homology of Ah receptors in mammals and fish, and reveal regions of this protein that are highly conserved between these diverse vertebrate groups.

scholarly journals Protein structure and gene cloning of Syncephalastrum racemosum nuclease

1999 ◽  
Vol 339 (2) ◽  
pp. 261-267 ◽  
Author(s):  
Heng-Chien HO ◽  
Ta-Hsiu LIAO
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Active Site ◽  
Direct Sequencing ◽  
Coli Strain ◽  
Protein Sequencing ◽  
Intact Protein ◽  
Computer Search ◽  
Degenerate Primers ◽  
Syncephalastrum Racemosum

The complete amino acid sequence of the fungus Syncephalastrum racemosum (Sr-) nuclease has been delineated on the basis of protein sequencing of the intact protein and its protease-digested peptides. The resulting 250-residue sequence shows a carbohydrate side chain attached at Asn134 and two half-cystine residues (Cys242 and Cys247) cross-linked to form a small disulphide loop. On the basis of the sequence of Sr-nuclease, a computer search in the sequence database yielded 60% and 48% positional identities with the sequences of Cunninghamella echinulata nuclease C1 and yeast mitochondria nuclease respectively, and very little similarity to those of several known mammalian DNases I. Sequence alignment of the three similar nucleases reveals that the single small disulphide loop is unchanged but the carbohydrate attachment in Sr-nuclease is absent from the other two nucleases. Alignment also shows a highly conserved region harbouring Sr-nuclease His85, which is assigned as one of the essential residues in the active site. The cDNA encoding Sr-nuclease was amplified by using reverse transcriptase-mediated PCR with degenerate primers based on its amino acid sequence. Subsequently, specific primers were synthesized for use in the 3´ and 5´ rapid amplification of cDNA ends (RACE). Direct sequencing of the RACE products led to the deduction of a 1.1 kb cDNA sequence for Sr-nuclease. The cDNA contains an open reading frame of 320 amino acid residues including a 70-residue putative signal peptide and the 250-residue mature protein. Finally, the recombinant Sr-nuclease was expressed in Escherichia coli strain BL21(DE3) in which the recombinant protein, after solubilization with detergent and renaturation, showed both DNase and RNase activities. The assignment of His85 to the active site was further supported by evidence that the mutant protein Sr-nuclease (H85A), in which His85 was replaced by Ala, was not able to degrade DNA or RNA.

scholarly journals First Report of Wheat streak mosaic virus in Slovakia

Plant Disease ◽  
2008 ◽  
Vol 92 (9) ◽  
pp. 1365-1365 ◽  
Author(s):  
O. Kúdela ◽  
M. Kúdelová ◽  
S. Nováková ◽  
M. Glasa
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Mosaic Virus ◽  
Direct Sequencing ◽  
Sandwich Elisa ◽  
Triticum Aestivum L ◽  
Wheat Streak Mosaic Virus ◽  
Natural Occurrence ◽  
First Report ◽  
Sequence Identities

The occurrence of Wheat streak mosaic virus (WSMV; genus Tritimovirus) was monitored by testing 91 wheat and barley samples collected from various localities of Slovakia from March to June 2007. Samples were screened by a commercial double-antibody sandwich-ELISA kit (Loewe Biochemica, Sauerlach, Germany). Positive results were obtained from two wheat (Triticum aestivum L.) samples from the same locality of western Slovakia. Molecular analysis of both samples was performed by reverse transcription-PCR with WSMV-specific primers (WS-8166F 5′ GAGAGCAATACTGCGTGTACG 3′ and WS-8909R 5′ GCATAATGGCTCGAAGTGATG 3′) designed according to available sequences. The expected 750-bp PCR fragment containing the N-terminal and core region of the coat protein gene (from 8166 to 8909 nt based on the Sidney81 isolate, GenBank Accession No AF057533) was obtained from both Slovak isolates. Direct sequencing (GenBank Accession Nos. EU723085 and EU723086) revealed that the two isolates have nucleotide and amino acid sequence identities of 98.3 and 100%, respectively. Except for the highly divergent Mexican isolate (Accession No. AF285170), pairwise comparisons of the Slovak isolates with sequences of other WSMV isolates (1) available in GenBank indicated respective nucleotide and amino acid sequence identities ranging from 87.6 to 98.7% and 95.2 to 100%. The Slovak isolates were most closely related to isolates from Czech Republic, Hungary, and Russia (GenBank Accession Nos. AF454454, AF454456, and AF454459). To our knowledge, this is the first report of the natural occurrence of WSMV in Slovakia. Reference: (1) D. C. Stenger et al. Virology 302:58. 2002.

scholarly journals Three-ComponentO-Demethylase System Essential for Catabolism of a Lignin-Derived Biphenyl Compound in Sphingobium sp. Strain SYK-6

2014 ◽  
Vol 80 (23) ◽  
pp. 7142-7153 ◽  
Author(s):  
Taichi Yoshikata ◽  
Kazuya Suzuki ◽  
Naofumi Kamimura ◽  
Masahiro Namiki ◽  
Shojiro Hishiyama ◽  
...  
Keyword(s):  
Electron Transfer ◽  
Amino Acid ◽  
Amino Acid Sequence ◽  
Reductase Activity ◽  
Normal Growth ◽  
Prosthetic Group ◽  
Gene Encoding ◽  
Content Type ◽  
Sequence Identities ◽  
Electron Transfer Component

ABSTRACTSphingobiumsp. strain SYK-6 is able to assimilate lignin-derived biaryls, including a biphenyl compound, 5,5′-dehydrodivanillate (DDVA). Previously,ligXa(SLG_07770), which is similar to the gene encoding oxygenase components of Rieske-type nonheme iron aromatic-ring-hydroxylating oxygenases, was identified to be essential for the conversion of DDVA; however, the genes encoding electron transfer components remained unknown. Disruption of putative electron transfer component genes scattered through the SYK-6 genome indicated that SLG_08500 and SLG_21200, which showed approximately 60% amino acid sequence identities with ferredoxin and ferredoxin reductase of dicambaO-demethylase, were essential for the normal growth of SYK-6 on DDVA. LigXa and the gene products of SLG_08500 (LigXc) and SLG_21200 (LigXd) were purified and were estimated to be a trimer, a monomer, and a monomer, respectively. LigXd contains FAD as the prosthetic group and showed much higher reductase activity toward 2,6-dichlorophenolindophenol with NADH than with NADPH. A mixture of purified LigXa, LigXc, and LigXd converted DDVA into 2,2′,3-trihydroxy-3′-methoxy-5,5′-dicarboxybiphenyl in the presence of NADH, indicating that DDVAO-demethylase is a three-component monooxygenase. This enzyme requires Fe(II) for its activity and is highly specific for DDVA, with aKmvalue of 63.5 μM andkcatof 6.1 s−1. Genome searches in six other sphingomonads revealed genes similar toligXcandligXd(>58% amino acid sequence identities) with a limited number of electron transfer component genes, yet a number of diverse oxygenase component genes were found. This fact implies that these few electron transfer components are able to interact with numerous oxygenase components and the conserved LigXc and LigXd orthologs are important in sphingomonads.

scholarly journals Molecular Characterization of a Novel Glucosyltransferase from Lactobacillus reuteri Strain 121 Synthesizing a Unique, Highly Branched Glucan with α-(1→4) and α-(1→6) Glucosidic Bonds

2002 ◽  
Vol 68 (9) ◽  
pp. 4283-4291 ◽  
Author(s):  
S. Kralj ◽  
G. H. van Geel-Schutten ◽  
H. Rahaoui ◽  
R. J. Leer ◽  
E. J. Faber ◽  
...  
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Amino Acid Sequence ◽  
Molecular Characterization ◽  
Lactobacillus Reuteri ◽  
Degenerate Primers ◽  
Terminal Domain ◽  
Branching Points ◽  
Culture Supernatants

ABSTRACT Lactobacillus reuteri strain 121 produces a unique, highly branched, soluble glucan in which the majority of the linkages are of the α-(1→4) glucosidic type. The glucan also contains α-(1→6)-linked glucosyl units and 4,6-disubstituted α-glucosyl units at the branching points. Using degenerate primers, based on the amino acid sequences of conserved regions from known glucosyltransferase (gtf) genes from lactic acid bacteria, the L. reuteri strain 121 glucosyltransferase gene (gtfA) was isolated. The gtfA open reading frame (ORF) was 5,343 bp, and it encodes a protein of 1,781 amino acids with a deduced M r of 198,637. The deduced amino acid sequence of GTFA revealed clear similarities with other glucosyltransferases. GTFA has a relatively large variable N-terminal domain (702 amino acids) with five unique repeats and a relatively short C-terminal domain (267 amino acids). The gtfA gene was expressed in Escherichia coli, yielding an active GTFA enzyme. With respect to binding type and size distribution, the recombinant GTFA enzyme and the L. reuteri strain 121 culture supernatants synthesized identical glucan polymers. Furthermore, the deduced amino acid sequence of the gtfA ORF and the N-terminal amino acid sequence of the glucosyltransferase isolated from culture supernatants of L. reuteri strain 121 were the same. GTFA is thus responsible for the synthesis of the unique glucan polymer in L. reuteri strain 121. This is the first report on the molecular characterization of a glucosyltransferase from a Lactobacillus strain.

Sign in / Sign up

Export Citation Format

Share Document