Correlation between insertion mutant activities and amino acid sequence identities of the TaqI and TthHB8 restriction endonucleases

Gene ◽  
1992 ◽  
Vol 112 (1) ◽  
pp. 13-20 ◽  
Author(s):  
Francis Barany ◽  
John Zebala
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Restriction Endonucleases ◽  
Insertion Mutant ◽  
Sequence Identities

scholarly journals First Report of Wheat streak mosaic virus in Slovakia

Plant Disease ◽  
2008 ◽  
Vol 92 (9) ◽  
pp. 1365-1365 ◽  
Author(s):  
O. Kúdela ◽  
M. Kúdelová ◽  
S. Nováková ◽  
M. Glasa
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Mosaic Virus ◽  
Direct Sequencing ◽  
Sandwich Elisa ◽  
Triticum Aestivum L ◽  
Wheat Streak Mosaic Virus ◽  
Natural Occurrence ◽  
First Report ◽  
Sequence Identities

The occurrence of Wheat streak mosaic virus (WSMV; genus Tritimovirus) was monitored by testing 91 wheat and barley samples collected from various localities of Slovakia from March to June 2007. Samples were screened by a commercial double-antibody sandwich-ELISA kit (Loewe Biochemica, Sauerlach, Germany). Positive results were obtained from two wheat (Triticum aestivum L.) samples from the same locality of western Slovakia. Molecular analysis of both samples was performed by reverse transcription-PCR with WSMV-specific primers (WS-8166F 5′ GAGAGCAATACTGCGTGTACG 3′ and WS-8909R 5′ GCATAATGGCTCGAAGTGATG 3′) designed according to available sequences. The expected 750-bp PCR fragment containing the N-terminal and core region of the coat protein gene (from 8166 to 8909 nt based on the Sidney81 isolate, GenBank Accession No AF057533) was obtained from both Slovak isolates. Direct sequencing (GenBank Accession Nos. EU723085 and EU723086) revealed that the two isolates have nucleotide and amino acid sequence identities of 98.3 and 100%, respectively. Except for the highly divergent Mexican isolate (Accession No. AF285170), pairwise comparisons of the Slovak isolates with sequences of other WSMV isolates (1) available in GenBank indicated respective nucleotide and amino acid sequence identities ranging from 87.6 to 98.7% and 95.2 to 100%. The Slovak isolates were most closely related to isolates from Czech Republic, Hungary, and Russia (GenBank Accession Nos. AF454454, AF454456, and AF454459). To our knowledge, this is the first report of the natural occurrence of WSMV in Slovakia. Reference: (1) D. C. Stenger et al. Virology 302:58. 2002.

scholarly journals Three-ComponentO-Demethylase System Essential for Catabolism of a Lignin-Derived Biphenyl Compound in Sphingobium sp. Strain SYK-6

2014 ◽  
Vol 80 (23) ◽  
pp. 7142-7153 ◽  
Author(s):  
Taichi Yoshikata ◽  
Kazuya Suzuki ◽  
Naofumi Kamimura ◽  
Masahiro Namiki ◽  
Shojiro Hishiyama ◽  
...  
Keyword(s):  
Electron Transfer ◽  
Amino Acid ◽  
Amino Acid Sequence ◽  
Reductase Activity ◽  
Normal Growth ◽  
Prosthetic Group ◽  
Gene Encoding ◽  
Content Type ◽  
Sequence Identities ◽  
Electron Transfer Component

ABSTRACTSphingobiumsp. strain SYK-6 is able to assimilate lignin-derived biaryls, including a biphenyl compound, 5,5′-dehydrodivanillate (DDVA). Previously,ligXa(SLG_07770), which is similar to the gene encoding oxygenase components of Rieske-type nonheme iron aromatic-ring-hydroxylating oxygenases, was identified to be essential for the conversion of DDVA; however, the genes encoding electron transfer components remained unknown. Disruption of putative electron transfer component genes scattered through the SYK-6 genome indicated that SLG_08500 and SLG_21200, which showed approximately 60% amino acid sequence identities with ferredoxin and ferredoxin reductase of dicambaO-demethylase, were essential for the normal growth of SYK-6 on DDVA. LigXa and the gene products of SLG_08500 (LigXc) and SLG_21200 (LigXd) were purified and were estimated to be a trimer, a monomer, and a monomer, respectively. LigXd contains FAD as the prosthetic group and showed much higher reductase activity toward 2,6-dichlorophenolindophenol with NADH than with NADPH. A mixture of purified LigXa, LigXc, and LigXd converted DDVA into 2,2′,3-trihydroxy-3′-methoxy-5,5′-dicarboxybiphenyl in the presence of NADH, indicating that DDVAO-demethylase is a three-component monooxygenase. This enzyme requires Fe(II) for its activity and is highly specific for DDVA, with aKmvalue of 63.5 μM andkcatof 6.1 s−1. Genome searches in six other sphingomonads revealed genes similar toligXcandligXd(>58% amino acid sequence identities) with a limited number of electron transfer component genes, yet a number of diverse oxygenase component genes were found. This fact implies that these few electron transfer components are able to interact with numerous oxygenase components and the conserved LigXc and LigXd orthologs are important in sphingomonads.

scholarly journals Novel Three-Component Rieske Non-Heme Iron Oxygenase System Catalyzing theN-Dealkylation of Chloroacetanilide Herbicides in Sphingomonads DC-6 and DC-2

2014 ◽  
Vol 80 (16) ◽  
pp. 5078-5085 ◽  
Author(s):  
Qing Chen ◽  
Cheng-Hong Wang ◽  
Shi-Kai Deng ◽  
Ya-Dong Wu ◽  
Yi Li ◽  
...  
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Heme Iron ◽  
Content Type ◽  
Non Heme Iron ◽  
Transport Component ◽  
Reductase Gene ◽  
Chloroacetanilide Herbicides ◽  
The Individual ◽  
Sequence Identities

ABSTRACTSphingomonads DC-6 and DC-2 degrade the chloroacetanilide herbicides alachlor, acetochlor, and butachlor viaN-dealkylation. In this study, we report a three-component Rieske non-heme iron oxygenase (RHO) system catalyzing theN-dealkylation of these herbicides. The oxygenase component genecndAis located in a transposable element that is highly conserved in the two strains. CndA shares 24 to 42% amino acid sequence identities with the oxygenase components of some RHOs that catalyzeN- orO-demethylation. Two putative [2Fe-2S] ferredoxin genes and one glutathione reductase (GR)-type reductase gene were retrieved from the genome of each strain. These genes were not located in the immediate vicinity ofcndA. The four ferredoxins share 64 to 72% amino acid sequence identities to the ferredoxin component of dicambaO-demethylase (DMO), and the two reductases share 62 to 65% amino acid sequence identities to the reductase component of DMO.cndA, the four ferredoxin genes, and the two reductases genes were expressed inEscherichia coli, and the recombinant proteins were purified using Ni-affinity chromatography. The individual components or the components in pairs displayed no activity; the enzyme mixture showedN-dealkylase activities toward alachlor, acetochlor, and butachlor only when CndA-His6was combined with one of the four ferredoxins and one of the two reductases, suggesting that the enzyme consists of three components, a homo-oligomer oxygenase, a [2Fe-2S] ferredoxin, and a GR-type reductase, and CndA has a low specificity for the electron transport component (ETC). TheN-dealkylase utilizes NADH, but not NADPH, as the electron donor.

A Nomenclature for the Mammalian Flavin-Containing Monooxygenase Gene Family Based on Amino Acid Sequence Identities

1994 ◽  
Vol 308 (1) ◽  
pp. 254-257 ◽  
Author(s):  
M.P. Lawton ◽  
J.R. Cashman ◽  
T. Cresteil ◽  
C.T. Dolphin ◽  
A.A. Elfarra ◽  
...  
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Gene Family ◽  
Monooxygenase Gene ◽  
Family Based ◽  
Sequence Identities

scholarly journals Discovery of a Novel Member of the Carlavirus Genus from Soybean (Glycine max L. Merr.)

Pathogens ◽  
2021 ◽  
Vol 10 (2) ◽  
pp. 223
Author(s):  
Thanuja Thekke-Veetil ◽  
Nancy K. McCoppin ◽  
Houston A. Hobbs ◽  
Glen L. Hartman ◽  
Kris N. Lambert ◽  
...  
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Triple Gene Block ◽  
Red Clover ◽  
Amino Acid Sequences ◽  
Predicted Amino Acid Sequence ◽  
Nucleic Acid Binding ◽  
Gene Block ◽  
The Family ◽  
Sequence Identities

A novel member of the Carlavirus genus, provisionally named soybean carlavirus 1 (SCV1), was discovered by RNA-seq analysis of randomly collected soybean leaves in Illinois, USA. The SCV1 genome contains six open reading frames that encode a viral replicase, triple gene block proteins, a coat protein (CP) and a nucleic acid binding protein. The proteins showed highest amino acid sequence identities with the corresponding proteins of red clover carlavirus A (RCCVA). The predicted amino acid sequence of the SCV1 replicase was only 60.6% identical with the replicase of RCCVA, which is below the demarcation criteria for a new species in the family Betaflexiviridae. The predicted replicase and CP amino acid sequences of four SCV1 isolates grouped phylogenetically with those of members of the Carlavirus genus in the family Betaflexiviridae. The features of the encoded proteins, low nucleotide and amino acid sequence identities of the replicase with the closest member, and the phylogenetic grouping suggest SCV1 is a new member of the Carlavirus genus.

Ancestry of the 4-chlorobenzoate dehalogenase: analysis of amino acid sequence identities among families of acyl:adenyl ligases, enoyl-CoA hydratases/isomerases, and acyl-CoA thioesterases

Biochemistry ◽  
1992 ◽  
Vol 31 (24) ◽  
pp. 5594-5604 ◽  
Author(s):  
Patricia C. Babbitt ◽  
George L. Kenyon ◽  
Brian M. Martin ◽  
Hugues Charest ◽  
Michel Slyvestre ◽  
...  
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Sequence Identities

scholarly journals A44 Genome analysis of bovine enterovirus variants isolated from cattle in Thailand

2019 ◽  
Vol 5 (Supplement_1) ◽  
Author(s):  
N Kosoltanapiwat ◽  
N Income ◽  
D Cadar ◽  
J Schmidt-Chanasit ◽  
J Tongshoob
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Cattle Feces ◽  
Isolation And Characterization ◽  
Wide Range ◽  
Vp1 Capsid Protein ◽  
Genus Enterovirus ◽  
Virus Isolates ◽  
Sequence Identities

Abstract Bovine enteroviruses (BEV) are non-enveloped RNA viruses of the genus Enterovirus, family Picornaviridae, which are commonly found in cattle. They have been classified into two species, enterovirus E (EV-E) and enterovirus F (EV-F). The viruses were previously considered non-pathogenic, but recent evidences suggest their association with pathogenesis in cattle. BEV-like enteroviruses have also been increasingly isolated from a wide range of animals, such as sheep, goats, horses, geese, possum, and deer, from many countries. The isolation and characterization of novel enteroviruses expands the range of the genus. Our data show that both EV-E and EV-F are circulating in cattle in Thailand. The viruses have been detected in 35–67 per cent of dairy and meat cattle feces in Kanchanaburi Province. Recently, we retrieved EV-E isolates from cattle feces by virus isolation in Madin-Darby Bovine Kidney cells. Four virus isolates were subjected to whole-genome sequencing using Illumina next-generation sequencing. A phylogenetic analysis of VP1 capsid protein, which is used for virus genotyping, suggested that there are at least two EV-E genotypes circulating in cattle in the area of study. Two virus strains, closely related to EV-E1 with amino acid sequence identities >88 per cent were identified as EV-E1. The other two strains, closely related to EV-E2 with amino acid sequence identities < 85 per cent, were likely to constitute a new EV-E genotype separate from the existing EV-E2.

scholarly journals A Novel Member of the Genus Nepovirus Isolated from Cucumis melo in Japan

2011 ◽  
Vol 101 (3) ◽  
pp. 316-322 ◽  
Author(s):  
Yasuhiro Tomitaka ◽  
Tomio Usugi ◽  
Fumitoshi Yasuda ◽  
Hiroshi Okayama ◽  
Shinya Tsuda
Keyword(s):  
Amino Acid ◽  
Coat Protein ◽  
Amino Acid Sequence ◽  
Molecular Mass ◽  
Host Range ◽  
Cucumis Melo ◽  
Virus Particles ◽  
Phylogenetic Reconstructions ◽  
Experimental Host Range ◽  
Sequence Identities

An unusual virus was isolated from a Japanese Cucumis melo cv. Prince melon plant showing mild mottling of the leaves. The virus had a broad experimental host range including at least 19 plant species in five families, with most infected plants showing no symptoms on inoculated and uninoculated systemically infected leaves. The virus particles were spherical, approximately 28 nm in diameter, and the coat protein (CP) had an apparent molecular mass of about 55 kDa. The virus possessed a bi-partite genome with two RNA species, of approximately 8,000 and 4,000 nucleotides. Both genome components for the new virus were sequenced. Amino acid sequence identities in CP between the new virus and previously characterized nepoviruses were found to be low (less than 27%); however, in phylogenetic reconstructions the closest relationship was revealed between the new virus and subgroup A nepoviruses. These results suggest that the new virus represents a novel member of the genus Nepovirus. A new name, Melon mild mottle virus, has been proposed for this new virus.

Sign in / Sign up

Export Citation Format

Share Document