First Report of Cherry green ring mottle virus and Cherry necrotic rusty mottle virus in Sweet Cherry (Prunus avium) in Chile and South America

Cherry green ring mottle virus (CGRMV) infects several Prunus species, while Cherry necrotic rusty mottle virus (CNRMV) has been detected mainly in sweet cherry. In Chile, sweet cherry represents one of the most valuable fruit crops, and the country is the main producer of cherries in the southern hemisphere. In October 2011, leaf samples were collected from 21 trees of cv. Bing in Libertador General Bernardo O'Higgins and Maule regions. Leaves of symptomatic plants showed brown angular necrotic spots, the center of which can drop out giving a shot-hole appearance. Total RNA was extracted by the silica capture method (1). Reverse transcription (RT)-PCR was carried out to test the presence of CGRMV and CNRMV using primer pairs GRM7950/GRM8316 (1), and DetCNR-F (TCCCACCTCAAGTCCTAGCAGAGA) / DetCNR-R (TCATTGCTAATTGCAAAATCCCA). Ten and six samples were tested positive for CGRMV and CNRMV, obtaining 366- and 333-bp fragments, respectively. Mixed infections occurred in five samples. Two sets of primer pairs were designed to amplify a region of the genome which includes the entire coat protein (CP) gene: CGRM-CPF (GGCTGATGAAGAATTTGA-GAAG) and CGRM-CPR (GAGTGGAATTGCAGGGGTTT), and CNRM-CPF (GAGTGTGTGTGAGCTTTCAAGTT) and CNRM-CPR (TTCGCCCCGTGTTGTAAAAC). Amplicons of the expected size of 828 bp (CGRMV) and 892 bp (CNRMV) were obtained from infected samples. Three amplicons for each virus were cloned into pGEM-T and three colonies per cloned fragment were sequenced in both directions. For CNRMV, Chilean isolates CP9754 (GenBank Accession No. KC432619) and CP9956N (KC432621) had 98% for nucleotide identity with isolate JK10 from India (FN546178), while isolate CP9879 (KC432620) had 97% of nucleotide identity. For CGRMV, Chilean isolate CP3359 (KC432616) had 98% identity with isolate HI17 from Poland (JX468873), while isolates CP9731 (KC432617) and CP9956G (KC432618) had 98% and 99% nucleotide identity with isolate ita7 (AF533161) from Italy, respectively. Nucleotide and amino acid sequence identity between Chilean isolates of CGRMV ranged between 94.5% and 99.3%, and from 97.8% to 99.2%, respectively. For Chilean isolates of CNRMV, sequence identity ranged between 98.0% and 98.5% (nucleotide), and from 98.6% to 98.9% (amino acid). Sequence analysis indicated that CGRMV isolates found in Chile belong to group II (3). Detection was confirmed by non-isotopic molecular hybridization. Riboprobes were designed on the basis of a consensus sequence of CP gene and labeled with digoxigenin (2); are complementary to the fragments located from the nucleotide 7415 to 7576 for CGRMV (reference sequence NC 001946.1), and 7475 to 7638 for CNRMV (reference sequence NC 002468.1). The cultivar Bing manifested symptoms only when infected by CNRMV. Results suggest that CNRMV is the cause of symptoms and yield loss observed in Bing, the most important cherry variety cultivated in Chile. To our knowledge, this is the first report of CGRMV and CNRMV infecting sweet cherry in South America. References: (1) M. E. Rott and W. Jelkmann. Eur. J. Plant Pathol. 107:411, 2001. (2) J. A Sánchez-Navarro et al. Plant Pathol. 47:780, 1998. (3) Y. P. Zhang et al. J. Plant. Pathol. 82:49, 2000.

Download Full-text

First Report of Cherry green ring mottle virus on Cherry and Peach Grown in China

Plant Disease ◽

10.1094/pdis-04-11-0326 ◽

2011 ◽

Vol 95 (10) ◽

pp. 1319-1319 ◽

Cited By ~ 7

Author(s):

J. F. Zhou ◽

G. P. Wang ◽

R. F. Kuang ◽

L. P. Wang ◽

N. Hong

Keyword(s):

Amino Acid ◽

Sweet Cherry ◽

Sandwich Elisa ◽

Amino Acid Sequences ◽

Central China ◽

Mottle Virus ◽

Rt Pcr ◽

Green Ring ◽

Cp Gene ◽

Pcr Products

Cherry green ring mottle virus (CGRMV; a member of the genus Foveavirus in the family Flexiviridae) has a single-stranded, positive-sense RNA genome of approximately 8.4 kb (4). The viral infection on several Prunus spp. has been mainly reported in Japan, New Zealand, and some countries in Africa, Europe, and North America (3). The virus can cause leaf yellowing on sour and tart cherry. Sweet cherry plants are symptomless hosts of the virus. During the growing season of 2010, leaf samples were collected randomly from one ornamental cherry (Prunus serrulata L.) and 26 sweet cherry (P. avium (L.) L.) plants grown in Shangdong and Henan provinces in northern China and 64 peach (P. persica L. Batsch) plants grown in Hubei Province in central China and tested for the presence of CGRMV by reverse transcription (RT)-PCR. Total RNA was extracted from leaves using the CTAB protocol reported by Li et al (2). Primer set, CGRMV1/CGRMV2 (1), was used for the amplification of a 949-bp fragment, which contains the complete CP gene of 807 bp. PCR products with the expected size were identified in one ornamental cherry, seven sweet cherry, and eight peach plants. Although some of sampled plants showed leaf chlorosis, we did not find the specific association between the symptom and CGRMV infection. The obtained PCR products were cloned into the vector pMD18-T (TaKaRa, Dalian, China). Three independent clones from each isolate were sequenced by Genscript Corp., Nanjing, China. Results showed that CP sequences from the Chinese CGRMV isolates shared 87.7 to 99.8% nucleotide and 93.3 to 100% deduced amino acid similarities, and clones intra each isolate shared more than 99% nt similarities. The CP gene sequences of two representative isolates from cherry (YT-Ch-1) and peach (Pe-HB-18) were submitted to GenBank with Accession Nos. HQ539656 and JF810672, respectively. The neighbor-joining phylogenetic trees generated with nucleotide and amino acid sequences of CP genes by Clustal X v1.8 revealed that all Chinese CGRMV isolates fell into two well-resolved clades. Most of the Chinese CGRMV isolates (12 of 16 isolates, including the isolate YT-Ch-1) were grouped in a large clade represented by isolate ITA5 (GenBank Accession No. AF533159). Four isolates from peach (including the isolate Pe-HB-18) clustered into another clade represented by isolate ITA6 (GenBank Accession No. AF533160). In July 2010, peach GF305 seedlings were inoculated by side grafting with budwoods from two CGRMV positive cherry plants. In May 2011, some newly developed leaves from all inoculated plants showed vein yellowing. The CGRMV infection in these inoculated peach GF305 plants was detected by RT-PCR and protein A sandwich-ELISA using antiserum raised against the recombinant CP of CGRMV isolate YT-Ch-1 (unpublished data). These results further confirmed the CGRMV infection on field cherry plants as detected by RT-PCR. To our knowledge, this is the first record of the presence of CGRMV in ornamental and sweet cherry and peach plants in China, which provides valuable information for further evaluating the sanitary status of the virus in sweet cherry and peach orchards in China. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. J. Virol. Methods 154:48, 2008. (3) K. G. Parker et al. USDA. Agric. Handb. No. 437:193, 1976. (4) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.

Download Full-text

First report of cucurbit chlorotic yellows virus (CCYV) infecting pumpkin in India

Plant Disease ◽

10.1094/pdis-07-21-1473-pdn ◽

2021 ◽

Author(s):

Ashwini Kumar ◽

Bichhinna Maitri Rout ◽

Shakshi Choudhary ◽

Amish K. Sureja ◽

V. K. Baranwal ◽

...

Keyword(s):

Amino Acid ◽

Amino Acid Sequence ◽

Amino Acid Sequence Identity ◽

Rt Pcr ◽

Specific Primers ◽

First Report ◽

Virus Particles ◽

Sequence Identity ◽

Cp Gene ◽

Cucurbit Chlorotic Yellows Virus

Pumpkin (Cucurbita moschata), a member of the family Cucurbitaceae, is widely cultivated throughout the world including India. During August 2020 to January 2021, stunted pumpkin plants (cv. Pusa Vishwas), showing chlorotic patches, mosaic, and vein banding on leaves (e-Xtra Fig.1), were observed in the experimental fields of the Indian Agricultural Research Institute (IARI), New Delhi, India. Leaf-dip electron microscopy (EM) of the symptomatic plants (12 out of 37 samples) revealed the association of long flexuous virus particles measuring 650-950nm×10-12nm, suggestive of the presence of either crinivirus or potyvirus or both. Subsequently, a reverse transcription-polymerase chain reaction (RT-PCR) was performed on RNA extracted from the samples that had long flexuous virus particles using generic primers for criniviruses i.e. CriniPol-F: GCY CCS AGR GTK AAT GA and CriniPol-R: ACC TTG RGA YTT RTC AAA targeting partial RNA-dependent RNA polymerase coding region (Martin et al. 2003) and specific primers for papaya ringspot virus (PRSV) targeting a part of 3’ NIb and full coat protein (CP) gene (Basavaraj et al., 2019) separately. All tested samples were positive for both crinivirus and PRSV as expected size amplicons were obtained, accounting for about 32% prevalence. As PRSV is a well-studied virus infecting cucurbits, further work was not carried on this virus and only the RT-PCR amplicon indicative of crinivirus (~515 bp) was cloned into the pGEM-T easy cloning vector (Promega, Madison, WI) and sequenced for further confirmation of the virus presence. The obtained sequence (GenBank accession No MZ318672) shared up to 90% nucleotide and 100% amino acid sequence identity with the corresponding genomic region of a cucurbit chlorotic yellows virus (CCYV) isolate from Greece (LT841297). To confirm the identity of the crinivirus species present in the same pumpkin sample, the CP gene (753bp) was amplified and sequenced using CCYV CP gene-specific primers CP-F (5’-ATG GAG AAG ACY GAC AAT AAA CAA AAT GAT GA-3’) and CP-R (5’-TTA TTT ACT ACA ACC TCC CGG TGC CAA C-3’) (modified from Kheireddine et al. 2020). Sequence analysis using the BioEdit tool (version 2.0) revealed that the crinivirus present in pumpkin (KC577202) shared 95 to 100% nucleotide (and 98 to 100% amino acid) sequence identity with the corresponding gene sequences of CCYV isolates originating from cucurbitaceous hosts from diverse locations. The presence of CCYV was further validated by a whitefly transmission-based bioassay followed by RT-PCR confirmation. The bioassay was performed by the whitefly species Bemisia tabaci (biotype Asia II7) using the acquisition access period and inoculation access period of 24 hours each. Six whitefly individuals per plant were used for inoculating ten pumpkin plants (cv. Pusa Vishwas) at the first true leaf stage grown in pots containing soilrite as the medium in insect-proof cages. All ten plants inoculated using whiteflies exhibited chlorosis and stunting symptoms 12-15 days post-inoculation (e-Xtra Fig.2) and were found positive for CCYV in RT-PCR assay performed using CCYV CP gene-specific primers. Though CCYV had been reported worldwide (Tzanetakis et al. 2013), its occurrence had not been reported from India. Results of the present study confirm the infection of pumpkin plants by CCYV and constitute the first report of its presence in India. Further, there is a need to investigate the extent of its spread and impact of this virus on the production of cucurbitaceous crops in the country.

Download Full-text

First Report of Carnation mottle virus in Phalaenopsis Orchids

Plant Disease ◽

10.1094/pdis-10-10-0757 ◽

2011 ◽

Vol 95 (3) ◽

pp. 354-354 ◽

Cited By ~ 4

Author(s):

Y.-X. Zheng ◽

C.-C. Chen ◽

F.-J. Jan

Keyword(s):

Amino Acid ◽

Ringspot Virus ◽

Mottle Virus ◽

Impatiens Necrotic Spot Virus ◽

Electron Microscopic ◽

First Report ◽

Cp Gene ◽

Plant Pathol ◽

Conserved Region ◽

Carnation Mottle Virus

In November 2003, two Phalaenopsis orchids from two different nurseries with symptoms of chlorotic rings on leaves were observed in Changhua County of central Taiwan. Symptomatic plants were collected and examined for the presence of viruses. Electron microscopic examination of ultrathin sections of leaf tissues from the symptomatic orchids found isometric virions of 32 nm in diameter. Subsequently, an isolate (herein designated as ‘92-orchid-1’) with particles of similar size were isolated from one symptomatic orchid and established in Chenopodium quinoa (3). After indirect ELISA tests using antisera against Carnation mottle virus (CarMV), Cucumber mosaic virus, Cymbidium ringspot virus, Tomato bushy stunt virus, Capsicum chlorosis virus, Impatiens necrotic spot virus, Tomato spotted wilt virus, Tomato ringspot virus, and Lisianthus necrosis virus, this isolate reacted positively with the antiserum produced against CarMV (1). CarMV-TW-infected and healthy C. quinoa were used as positive and negative controls, respectively. To further characterize this virus, the conserved region of the polymerase gene (ORF1RT) of Carmoviruses was amplified with degenerate primer pairs, FJJ2003-17 (5′-TATATCTCGAGCAA(A/C)TAGGGG(G/T)GCCT) and FJJ2003-18 (5′-TATAGGATCCCC(C/T)A(A/T)(A/G)GC(A/T)GTGTTCA), by reverse transcription (RT)-PCR using the total RNA isolated from the leaves of 92-orchid-1-, CarMV-TW-infected, and healthy C. quinoa (3). The 894-nt ORF1RT conserved region of isolate 92-orchid-1 (GenBank Accession No. HQ117873) shared 97.1, 65.6, 61.7, and 63.5% nucleotide identities and 98.3, 70.2, 66.1, and 64.7% amino acid identities with those of CarMV (X02986), Pelargonium flower break virus (NC_005286), Saguaro cactus virus (NC_001780), and Angelonia flower break virus (NC_007733), respectively. The sequence comparison of the ORF1RT conserved region indicated that 92-orchid-1 was a carmovirus related to CarMV. Sequence analyses of the coat protein (CP) gene (GenBank Accession No. HQ117872) amplified with the specific CP primer pairs of CarMV (FJJ2004-53: 5′-ACTGCGCTCGAGCTACTCTGTTGACAGTTCTA, and 2004-54: 5′-ATATATGGATCCCGTCCCGCCGTGTGTGTCTA) showed the isolate shared 95.8 to 98.8% nucleotide identities and 96.8 to 98.9% amino acid identities with those of 40 CarMV isolates. Furthermore, the CP gene shared 96.9, 97.0, and 98.8% nucleotide identities and 98.0, 95.7, and 98.3% amino acid identities with isolates from carnation (GenBank Accession No. AY383566) (1), calla lily (GenBank Accession No. HQ117870) (2), and lisianthus (GenBank Accession No. FJ843021), respectively, in Taiwan. These results suggested that this isolate was CarMV but distinct from the above-mentioned three isolates and designated CarMV-Ph. From 2004 to 2007, a further survey of 280 symptomatic Phalaenopsis plants by ELISA using CarMV polyclonal antibodies (1) found that approximately 4% of those tested were infected. To our knowledge, this is the first report of CarMV in Phalaenopsis orchids and the occurrence has substantial implications for the important nursery and floral industry in Taiwan. References: (1) C. C. Chen et al. Plant Pathol. Bull. 12:199, 2003. (2) C. C. Chen et al. Plant Dis. 87:1539, 2003. (3) Y. X. Zheng et al. Eur. J. Plant Pathol. 121:87, 2008.

Download Full-text

First Report of Cowpea mild mottle virus in Cowpea and French Bean in Taiwan

Plant Disease ◽

10.1094/pdis-10-12-0935-pdn ◽

2013 ◽

Vol 97 (7) ◽

pp. 1001-1001 ◽

Cited By ~ 6

Author(s):

C. A. Chang ◽

L. Y. Chien ◽

C. F. Tsai ◽

Y. Y. Lin ◽

Y. H. Cheng

Keyword(s):

Amino Acid ◽

Amino Acid Sequence ◽

French Bean ◽

Mottle Virus ◽

Replicase Gene ◽

Degenerate Primers ◽

French Beans ◽

Cp Gene ◽

Asparagus Bean ◽

Sequence Identities

In 2009, more than 50% of vine type French beans were found bearing severe viral symptoms in a vegetable garden in Nantou County, Taiwan. Infected plants were stunted and exhibited pronounced mottling symptoms on their leaves. The symptomatic plants were mechanically inoculated on Chenopodium quinoa and local lesions developed 7 to 10 days after inoculation. The virus source established by back isolation the single lesion from C. quinoa on French beans developed symptoms similar to those found in the field. Host range test showed that this isolate could only infect leguminous plants, including soybean, mung bean, pea, peanut, asparagus bean, cowpea, adzuki bean, and lima bean, but not cucurbitaceous and solanaceous plants. Since only Cucumber mosaic virus (CMV) has been reported in Taiwan to induce similar symptoms in French beans, we tested both the field collected and inoculated French beans by CMV antiserum in ELISA but obtained a negative result. Due to subsequent electron microscopy studies that found potyvirus and carlavirus like particles in the leaf dips of infected French beans, we conducted reverse transcription (RT)-PCR using generic degenerate primers for potyviruses (Hrp5/Pot1 (2) and PotZ/Pot1 (3)) and carlaviruses (Decarla-u2 (5′-TGCACTGARTCMGAYTATGARGCYTT-3′ and Decarla-d1 (5′-GCACATRTCRTCVCCDGCAAA-3′) previously designed in our lab. No amplification was found from the potyvirus primers, while the carlavirus one gave an expected amplicon of 285 bp, which was found sharing 81% nucleotide sequence identity with the replicase gene of Cowpea mild mottle virus (CpMMV) (GenBank Accession No. FJ560903). A primer pair (CpMMV-CPu: 5′-TTTACTCTTAggTWATggAgTC-3′ and CpMMV-CPd: 5′-CCTATTAAAACACACAAHTCAAA-3′) was thus designed to amplify the complete coat protein (CP) gene based on the reported CP sequences and obtained an expected 867-bp product from our French bean isolate. This 867-bp sequence (JX020701) was confirmed to have 97.6% amino acid sequence identities with the CP gene of a Puerto Rican CpMMV isolate (GU191840). In a separate survey, another isolate from asparagus bean (CpMMV-V) causing mild mottling symptom was obtained. Analyses of the CP gene of CpMMV-V (JX070669) confirmed that it shared 88.8% and 97.8% of nucleotide and amino acid sequence identities with the French bean isolate, respectively. Different from most carlaviruses with aphid transmissibility, CpMMV has been shown to be transmitted non-persistently by whiteflies (1). Both CpMMV isolates from Taiwan were confirmed to be transmitted by silver leaf whiteflies (Bemicia argentifolii Bellows and Perring). This is the first record of whitefly transmissible legume virus in Taiwan. Since whitefly has been a problem in agriculture worldwide, CpMMV can be a new emerging threat for Taiwan's legume crop production. References: (1) M. Iwaki et al. Plant Dis. 66:365, 1982. (2) S. S. Pappu et al. J. Virol. Methods 41:9, 1993. (3) F. M. Zerbini et al. Phytopathology 85:746.

Download Full-text

Antigenic variation among isolates of infectious salmon anaemia virus correlates with genetic variation of the viral haemagglutinin gene

Journal of General Virology ◽

10.1099/0022-1317-82-12-2869 ◽

2001 ◽

Vol 82 (12) ◽

pp. 2869-2879 ◽

Cited By ~ 38

Author(s):

Frederick S. B. Kibenge ◽

Molly J. T. Kibenge ◽

Patricia K. McKenna ◽

Paul Stothard ◽

Rebecca Marshall ◽

...

Keyword(s):

Amino Acid ◽

Sequence Analysis ◽

Amino Acid Sequence ◽

Antigenic Variation ◽

Comparative Sequence Analysis ◽

Infectious Salmon Anaemia Virus ◽

Marine Aquaculture ◽

Sequence Identity ◽

Ha Gene ◽

Infectious Salmon Anaemia

Infectious salmon anaemia virus (ISAV), an orthomyxovirus-like virus, is an important fish pathogen in marine aquaculture. Virus neutralization of 24 ISAV isolates in the TO cell line using rabbit antisera to the whole virus and comparative sequence analysis of their haemagglutinin (HA) genes have allowed elaboration on the variation of ISAV isolates. The 24 viruses were neutralized to varying degrees, revealing two major antigenic groups, one American and one European. Sequence analysis of the HA gene also revealed two groups of viruses (genotypes) that correlated with the antigenic groupings. The two HA subtypes had nucleotide sequence identity of only ⩽79·4% and amino acid sequence identity of ⩽84·5% whereas, within each subtype, the sequence identities were 90·7% or higher. This grouping was also evident upon phylogenetic analysis, which revealed two distinct phylogenetic families. Between the two groups, the amino acid sequence was most variable in the C-terminal region and included deletions of 4–16 amino acids in all isolates relative to ISAV isolate RPC/NB-980 280-2. In order to view the relationships among these sequences and the HA sequences of the established orthomyxoviruses, a second phylogenetic tree was constructed which showed the ISAV sequences to be more closely related to sequences from Influenzavirus A and Influenzavirus B than to sequences from Influenzavirus C and Thogotovirus. The extensive deletions in the gene of European ISAV isolates lead us to speculate that the archetypal ISAV was probably of Canadian origin.

Download Full-text

Engineered Resistance Against Papaya ringspot virus in Venezuelan Transgenic Papayas

Plant Disease ◽

10.1094/pdis.2004.88.5.516 ◽

2004 ◽

Vol 88 (5) ◽

pp. 516-522 ◽

Cited By ~ 28

Author(s):

Gustavo Fermin ◽

Valentina Inglessis ◽

Cesar Garboza ◽

Sairo Rangel ◽

Manuel Dagert ◽

...

Keyword(s):

Amino Acid ◽

Agrobacterium Tumefaciens ◽

Coat Protein ◽

Amino Acid Sequence ◽

Sequence Similarity ◽

Ringspot Virus ◽

Amino Acid Sequence Similarity ◽

Papaya Ringspot Virus ◽

Local Varieties ◽

Cp Gene

Local varieties of papaya grown in the Andean foothills of Mérida, Venezuela, were transformed independently with the coat protein (CP) gene from two different geographical Papaya ringspot virus (PRSV) isolates, designated VE and LA, via Agrobacterium tumefaciens. The CP genes of both PRSV isolates show 92 and 96% nucleotide and amino acid sequence similarity, respectively. Four PRSV-resistant R0 plants were intercrossed or selfed, and the progenies were tested for resistance against the homologous isolates VE and LA, and the heterologous isolates HA (Hawaii) and TH (Thailand) in greenhouse conditions. Resistance was affected by sequence similarity between the transgenes and the challenge viruses: resistance values were higher for plants challenged with the homologous isolates (92 to 100% similarity) than with the Hawaiian (94% similarity) and, lastly, Thailand isolates (88 to 89% similarity). Our results show that PRSV CP gene effectively protects local varieties of papaya against homologous and heterologous isolates of PRSV.

Download Full-text

Turkey and Chicken Interleukin-2 Cross-React inIn VitroProliferation Assays Despite Limited Amino Acid Sequence Identity

Journal of Interferon & Cytokine Research ◽

10.1089/107999000312568 ◽

2000 ◽

Vol 20 (2) ◽

pp. 161-170 ◽

Cited By ~ 31

Author(s):

Shelly Lawson ◽

Lisa Rothwell ◽

Pete Kaiser

Keyword(s):

Amino Acid ◽

Amino Acid Sequence ◽

Amino Acid Sequence Identity ◽

Interleukin 2 ◽

Sequence Identity

Download Full-text

Genetic and Biochemical Characterization of OXA-535, a Distantly Related OXA-48-Like β-Lactamase

Antimicrobial Agents and Chemotherapy ◽

10.1128/aac.01198-18 ◽

2018 ◽

Vol 62 (10) ◽

Cited By ~ 2

Author(s):

L. Dabos ◽

A. B. Jousset ◽

R. A. Bonnin ◽

N. Fortineau ◽

A. Zavala ◽

...

Keyword(s):

Amino Acids ◽

Amino Acid ◽

Amino Acid Sequence ◽

Amino Acid Sequence Identity ◽

Biochemical Characterization ◽

Content Type ◽

Sequence Identity

ABSTRACT OXA-535 is a chromosome-encoded carbapenemase of Shewanella bicestrii JAB-1 that shares only 91.3% amino acid sequence identity with OXA-48. Catalytic efficiencies are similar to those of OXA-48 for most β-lactams, except for ertapenem, where a 2,000-fold-higher efficiency was observed with OXA-535. OXA-535 and OXA-436, a plasmid-encoded variant of OXA-535 differing by three amino acids, form a novel cluster of distantly related OXA-48-like carbapenemases. Comparison of blaOXA-535 and blaOXA-436 genetic environments suggests that an ISCR1 may be responsible for blaOXA-436 gene mobilization from the chromosome of Shewanella spp. to plasmids.

Download Full-text

cDNA nucleotide sequence encoding the ZPC protein of Australian hydromyine rodents: a novel sequence of the putative sperm-combining site within the family Muridae

Zygote ◽

10.1017/s0967199402004021 ◽

2002 ◽

Vol 10 (4) ◽

pp. 291-299 ◽

Cited By ~ 4

Author(s):

Christine A. Swann ◽

Rory M. Hope ◽

William G. Breed

Keyword(s):

Amino Acid ◽

Nucleotide Sequence ◽

Amino Acid Sequence ◽

Cdna Sequence ◽

Amino Acid Sequence Identity ◽

Sequence Data ◽

Coding Region ◽

Cdna Sequences ◽

Sequence Identity ◽

Murid Rodents

This comparative study of the cDNA sequence of the zona pellucida C (ZPC) glycoprotein in murid rodents focuses on the nucleotide and amino acid sequence of the putative sperm-combining site. We ask the question: Has divergence evolved in the nucleotide sequence of ZPC in the murid rodents of Australia? Using RT-PCR and (RACE) PCR, the complete cDNA coding region of ZPC in the Australian hydromyine rodents Notomys alexis and Pseudomys australis, and a partial cDNA sequence from a third hydromyine rodent, Hydromys chrysogaster, has been determined. Comparison between the cDNA sequences of the hydromyine rodents reveals that the level of amino acid sequence identity between N. alexis and P. australis is 96%, whereas that between the two species of hydromyine rodents and M. musculus and R. norvegicus is 88% and 87% respectively. Despite being reproductively isolated from each other, the three species of hydromyine rodents have a 100% level of amino acid sequence identity at the putative sperm-combining site. This finding does not support the view that this site is under positive selective pressure. The sequence data obtained in this study may have important conservation implications for the dissemination of immunocontraception directed against M. musculus using ZPC antibodies.

Download Full-text