scholarly journals First report of rhizome rot of banana caused by Klebsiella variicola in India

Plant Disease ◽  
2021 ◽  
Author(s):  
Murugan Loganathan ◽  
Raman Thangavelu ◽  
Pushpakanth P ◽  
Muthubharathi Kalimuthu ◽  
R Ramesh ◽  
...  
Keyword(s):  
Tamil Nadu ◽  
Early Stage ◽  
Soft Rot ◽  
Rpob Gene ◽  
Universal Primers ◽  
Biochemical Tests ◽  
First Report ◽  
Rot Disease ◽  
Biochemical Analyses ◽  
Rhizome Rot

Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5′ - AGAGTTTGATCCTGGCTCAG - 3′; 1492 R 5′ - GGTTACCTTGTTACGACTT - 3′) and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in nutrient broth for 48 h at 37±1°C and the cells were harvested by centrifugation. Five milliliters of the culture suspension (2×108 CFUmL-1) taken in a syringe was injected into rhizomes of three month old tissue cultured Grand Naine plants. Each bacterial isolate was injected into eight banana plants at soil level. Appropriate controls were maintained. Inoculated plants were maintained in a glasshouse at 32±2°C and after 30-35 days, rhizome rot symptoms appeared in all the three bacterial isolates inoculated plants but in none of the control plants. The Koch’s postulates were proved by re-isolation and identification.To the best of our knowledge, this is the first report of K. variicola causing rhizome rot disease of banana in India.

scholarly journals First Report of Bacterial Soft Rot Disease on Mammillaria mystax Caused by Enterobacter cloacae subsp. dissolvens in Mexico

Plant Disease ◽  
2020 ◽  
Vol 104 (5) ◽  
pp. 1536-1536
Author(s):  
Guadalupe Reyes-García ◽  
Santo Ángel Ortega-Acosta ◽  
Francisco Palemón-Alberto ◽  
Yanet Romero Ramírez ◽  
Jeiry Toribio-Jiménez ◽  
...  
Keyword(s):  
Enterobacter Cloacae ◽  
Soft Rot ◽  
Bacterial Soft Rot ◽  
First Report ◽  
Soft Rot Disease ◽  
Rot Disease

scholarly journals First Report of Soft Rot Disease of Papaya Caused by Klebsiella variicola in Bangladesh

2018 ◽  
Vol 63 (2) ◽  
pp. 201-205
Author(s):  
Shahadat HOSSAIN ◽  
Abu Ashraf KHAN ◽  
Md. Mahbubur RAHMAN ◽  
Kazuhiro IIYAMA ◽  
Naruto FURUYA
Keyword(s):  
Soft Rot ◽  
First Report ◽  
Soft Rot Disease ◽  
Rot Disease

First report of Dickeya fangzhongdai causing soft rot disease of Welsh onion in Taiwan

2019 ◽  
Vol 101 (3) ◽  
pp. 797-798 ◽  
Author(s):  
Wei-An Tsai ◽  
Pei-Rong Lin ◽  
Chien-Jui Huang
Keyword(s):  
Soft Rot ◽  
Welsh Onion ◽  
First Report ◽  
Soft Rot Disease ◽  
Rot Disease

scholarly journals First Report of Bacterial Leaf Spot of Basil Caused by Pseudomonas viridiflava in Hungary

Plant Disease ◽  
2012 ◽  
Vol 96 (1) ◽  
pp. 141-141 ◽  
Author(s):  
A. Végh ◽  
M. Hevesi ◽  
Zs. Némethy ◽  
L. Palkovics
Keyword(s):  
Leaf Spot ◽  
Sequence Similarity ◽  
Soft Rot ◽  
Hypersensitive Reaction ◽  
Bacterial Suspension ◽  
Bacterial Leaf Spot ◽  
Biochemical Tests ◽  
First Report ◽  
Arginine Dihydrolase ◽  
Pseudomonas Viridiflava

In April 2011, typical bacterial spot symptoms were observed on sweet basil plantlets (Ocimum basilicum L.) in a supermarket in Budapest, Hungary. Affected plants had dark brown-to-black lesions on the cotyledons. Spots on the leaves were first water soaked and then became necrotic and progressed inward from the margins. Symptoms were similar to those reported by Little et al. (3) on basil affected by Pseudomonas viridiflava. Bacteria consistently isolated from leaf lesions formed mucoid colonies with a green fluorescent pigment on King's B medium. Strains were gram negative. In LOPAT (levan-oxidase-potato rot-arginine dihydrolase-tobacco hypersensitivity) tests (2), all induced a hypersensitive reaction (HR) in tobacco (Nicotiana tabacum L. cv. White Burley) leaves (1), caused soft rot of potato tuber slices, and were negative for levan, oxidase, and arginine dihydrolase. Biochemical tests, API 20NE and API 50 CH (Biomérieux, Marcy l'Etoile, France), were also used for identification. The pathogenicity of three isolates was tested twice by injecting 20-day-old healthy basil plants with a bacterial suspension (107 CFU/ml). Controls were injected with sterile distilled water. Plants were kept at 25 to 28°C and 80 to 100% relative humidity. Forty-eight hours after inoculation, dark brown-to-black lesions were observed only on inoculated plants. The bacterium was reisolated from lesions of all plants tested, fulfilling Koch's postulates. No lesions were observed on controls. To identify the pathogen, a PCR technique was used. The 16SrDNA region was amplified with general bacterial primer pair (63f forward and 1389r reverse) (4) then the PCR products were cloned into Escherichia coli DH5α cells and a recombinant plasmid was sequenced by M13 forward and reverse primers. The sequence was deposited in GenBank (Accession No. HE585219). On the basis of the symptoms, biochemical tests, and 16SrDNA sequence homology (99% sequence similarity with a number of P. viridiflava isolates), the pathogen was identified as P. viridiflava. To our knowledge, this is the first report of bacterial leaf spot of basil in Hungary, which can seriously affect the basil production. References: (1) Z. Klement. Nature 199:299, 1963. (2) R. A. Lelliot et al. Appl. Bacteriol. 29:470, 1966. (3) E. L. Little et al. Plant Dis. 78:831, 1994. (4) A. M. Osborn et al. Environ. Microbiol. 2:39, 2000.

scholarly journals First Report of Pantoea sp. Induced Soft Rot Disease of Pleurotus eryngii in Korea

Plant Disease ◽  
2007 ◽  
Vol 91 (1) ◽  
pp. 109-109 ◽  
Author(s):  
M. K. Kim ◽  
J. S. Ryu ◽  
Y. H. Lee ◽  
H. D. Yun
Keyword(s):  
16S Rdna ◽  
Water Drop ◽  
Soft Rot ◽  
Pleurotus Eryngii ◽  
Rdna Sequence ◽  
Pantoea Ananatis ◽  
16S Rdna Sequence ◽  
First Report ◽  
Soft Rot Disease ◽  
Rot Disease

The king oyster mushroom, Pleurotus eryngii, has become a popular crop because of its unique flavor and texture and is cultivated in many areas in Korea. In 2003, symptoms of water-soaked lesions and soft rot in the stipes and pileus of cultivated P. eryngii was observed in Jinju, Korea. Diseased tissue was plated on nutrient media. Dominate colonies were yellow, convex, circular with smooth margins, and had a shiny texture. Computer analysis of the data gathered, using the API kit (50CHE, bioMérieux, Marcy-l'Etoile, France), showed that the strain belongs to the Enterobacteriaceae. Although the API system did not give an exact identification, the metabolic profile of the bacterial strain closely resembled the database profile of Pantoea sp. (positive for acid production from the fermentation of d-fructose, d-galactose, d-glucose, d-trehalose, and d-ribose and negative for oxidase, urease, pectate, and thiosulfate). The 16S rDNA sequence of the bacterium was determined (GenBank Accession No. AY530796). When compared with those in GenBank, the bacterium was determined to belong to the Enterobacteriaceae family of the Gammaproteobacteria, and the highest degree of sequence similarity was found to be with Pantoea ananatis strain BD 588 (97.4%) and Pantoea ananatis strain Pna 97-1 (97.3%). In the phylogenetic tree, the bacterium clearly related to the Pantoea lineage, as evidenced by the high bootstrap value. A BLAST search with 16S rDNA sequence of the bacterium supported the API results that the isolate belongs to a species of Pantoea. Pathogenicity tests of this new Pantoea isolate were carried out with bacterial suspensions (approximately 1 × 106 CFU/ml) that were grown for 24 h in Luria-Bertani broth cultures. These were used to inoculate directly on the mycelia of P. eryngii that had been cultivated for 35 days in a plastic bottle. The water and broth were also inoculated to another set of bottles as a control experiment. Inoculated bottles were incubated in a cultivation room at 16 to 17°C with relative humidity between 80 and 95%. Early symptoms of the disease included a dark brown water drop that developed on hypha and primordium of the mushrooms after 5 to 7 days. After 13 days, water-soaked lesions developed on the stipes and pileus, and the normal growth of the mushrooms was inhibited. An offensive odor then developed along with a severe soft rot that was similar to the disease symptoms observed under natural conditions. Mushrooms in control bottles did not develop symptoms. Koch's postulates were fulfilled by isolating bacteria from typical lesions from inoculated mushrooms that were identical to the inoculated strain in colony morphology and biochemical characteristics. Pantoea ananatis was first reported as a pathogen of pineapple fruit causing brown rot (3). Several bacterial diseases, such as brown blotch on cultivated mushrooms by Pseudomonas tolaasii (2) and bacterial soft rot on winter mushroom by Erwinia carotovora subsp. Carotovora, causing severe damage to mushrooms are known (1). However, no Pantoea sp. induced disease of edible mushroom has been previously reported. To our knowledge, this is the first report of soft rot disease on P. eryngii caused by Pantoea sp. References: (1) H. Okamoto et al. Ann. Phytopathol. Soc. Jpn. 65:460. 1999. (2) S. G. Paine. Ann. Appl. Biol. 5:206. 1919. (3) F. B. Serrano. Philipp. J. Sci. 36:271, 1928.

scholarly journals First Report of Soft Rot Disease of Peach Caused by Pantoea ananatis in China

Plant Disease ◽  
2016 ◽  
Vol 100 (2) ◽  
pp. 516-516 ◽  
Author(s):  
L. Liao ◽  
R. Hei ◽  
Y. Tang ◽  
S. Liu ◽  
J. Zhou
Keyword(s):  
Soft Rot ◽  
Pantoea Ananatis ◽  
First Report ◽  
Soft Rot Disease ◽  
Rot Disease

scholarly journals First Report of Pantoea anthophila Causing Soft Rot Disease in Clausena lansium (Wampee) in China

Plant Disease ◽  
2015 ◽  
Vol 99 (3) ◽  
pp. 416-416 ◽  
Author(s):  
J. N. Zhou ◽  
S. Y. Liu ◽  
Y. F. Chen ◽  
L. S. Liao
Keyword(s):  
Disease Incidence ◽  
Soft Rot ◽  
The Philippines ◽  
Luria Bertani ◽  
Bacterial Suspension ◽  
16S Rrna Sequence ◽  
First Report ◽  
Surface Sterilization ◽  
Soft Rot Disease ◽  
Rot Disease

Clausena lansium, also known as wampee (Clausena wampi), is a plant species native to China, Vietnam, the Philippines, Malaysia, and Indonesia, where it is widely cultivated, and also grown in India, Sri Lanka, Queensland, Florida, and Hawaii, but less frequently (3). The fruit can be consumed fresh or made into juice, jam, or succade. In summer to fall 2014, a soft rot disease was found in a wampee planting region in Yunan County, Guangdong Province, China. On Sept. 18, we collected diseased samples from a wampee orchard with about 20% disease incidence. The infected fruit initially showed pinpoint spots on the peel, water-soaked lesions, and light to dark brown discoloration. Spots expanded in 2 days, and tissues collapsed after 5 days. Severely affected fruit showed cracking or nonodorous decay. Five diseased samples were collected, and causal agents were isolated from symptomatic tissues 1 cm under the peel after surface sterilization in 0.3% NaOCl for 10 min and rinsing in sterile water three times. Tissues were placed on a Luria Bertani (LB) plate for culture. Ten representative isolates were selected for further characterization. No colony was isolated from healthy tissues. Colonies were round, smooth, with irregular edges, and produced a yellow pigment in culture. Biolog identification (Version 4.20.05) showed that all strains were gram negative, negative for indole production, and utilized glucose, maltose, trehalose, sucrose, D-lactose, and pectin but not sorbitol or gelatin. The isolates were identified as Pantoea agglomerans (SIM 0.69). Multilocus sequence analysis (MLSA) was conducted for rapid classification of the strains. Sequences of atpD, gyrB, infB, and rpoB were amplified using corresponding primers (2). All sequences of the 10 isolates were identical in each gene. BLASTn was performed, and maximum likelihood trees based on the concatenated nucleotide sequences of the four genes were constructed using MEGA6. Bootstrap values after 1,000 replicates were expressed as percentages. Results showed that the tested strain named CL1 was most homologous to P. anthophila, with 98% identity for atpD (KM521543), 100% for gyrB (KM521544), infB (KM521545), and rpoB (KM521546). The 16S rRNA sequence (KM521542) amplified by primers 27f and 1492r shared 99% identity with that of P. anthophila M19_2C (JN644500). P. anthophila was previously reclassified from P. agglomerans (3); therefore, we suggest naming this wampee pathogen P. anthophila. Subsequently, 10 wampee fruits were injected with 20 μl of bacterial suspension (1 × 108 CFU/ml) of strains CL1 and CL2, respectively, and another 10 were injected with 20 μl of LB medium as controls, all kept at 28°C for 4 days. Symptoms similar to those of natural infections were observed on inoculated fruits but not on the negative controls. Bacteria were isolated from diseased tissues and further identified as P. anthophila by gyrB sequencing. P. anthophila was reported to naturally infect balsam and marigold (1,2). To our knowledge, this is the first report of P. anthophila naturally causing soft rot disease and cracking on C. lansium (wampee). References: (1) C. Brady et al. Syst. Appl. Microbiol. 31:447, 2008. (2) C. Brady et al. Int. J. Syst. Evol. Microbiol. 59:2339, 2009. (3) J. Morton. Fruits of Warm Climates. Echo Point Books & Media, Miami, FL, 1987.

scholarly journals MORPHOLOGICAL AND GENOMIC VARIABLITY OF SCLEROTIUM ROLFSII SACC. CAUSING STEM ROT OF TUBEROSE

2021 ◽  
Vol 21 (no 1) ◽  
Author(s):  
N.H. Sankar Reddy ◽  
T. Sivakumar ◽  
P. Balabaskar ◽  
K. Kuralarasi
Keyword(s):  
Tamil Nadu ◽  
Growth Parameters ◽  
Sclerotium Rolfsii ◽  
Its Region ◽  
Stem Rot ◽  
Universal Primers ◽  
Mycelia Growth ◽  
Rot Disease ◽  
The One ◽  
Rdna Amplification

Tuberose is one of the most important ornamental bulbous flower crop cultivated for cut and loose flower trade. The flower has been used for ornaments, bouquets and buttonholes or crown and frequently used during marriages and religious ceremonies. The tuberose was often infected by various numbers of diseases; among that S. rolfsii is the one of the major disease which causes stem rot disease. The S. rolfsii were collected from various locations of Tamil Nadu were examined for morphological and genomic variability. Fifteen isolates of S. rolfsii was assessed and various morphological growth parameters (Mycelia growth, No. of sclerotia/ plate, colour of sclerotia, time taken for sclerotial production (days) and variations among S. rolfsii isolates was recorded. ITS region of rDNA amplification with specific ITS1 and ITS4 universal primers produced approximately 600 to 700 bp in all the isolates confirmed that all the isolates obtained are S. rolfsii. The sequences of isolates viz., Sr1 and Sr2 were identified as S. rolfsii through BLAST search in NCBI website (www.blast.ncbi.nlm.nih.gov/Blast). The sequences were deposited in the Gene Bank with the accession numbers MK880692, MK880693.

scholarly journals FIRST REPORT OF BACTERIAL HEAD ROT DISEASE CAUSED BYPECTOBACTERIUM ATROSEPTICUM ON SUNFLOWER IN PAKISTAN

2017 ◽  
Vol 29 (1) ◽  
pp. 167
Author(s):  
Shahzad Asad ◽  
Anjum Munir ◽  
Ayub Khan ◽  
Ishaq Ahmad ◽  
Muhammad Arshad
Keyword(s):  
Agricultural Research ◽  
Colony Growth ◽  
Pathogenicity Test ◽  
Biochemical Tests ◽  
Isolation And Purification ◽  
Pectobacterium Atrosepticum ◽  
First Report ◽  
Sunflower Crop ◽  
Rot Disease ◽  
Head Rot

is an important oil seed crop in Pakistan. During a field visit at National Agricultural Research Center (NARC), Islamabad, Pakistan bacterial head rot disease caused by Pectobacterium atrosepticum (formly Erwinaia caratovora subsp. atroseptica) has been observed on both local and exotic hybrids of Sunflower crop. Pathogenicity test has been carried out to fulfill Koch’s postulates. White and creamy colony growth was observed upon isolation and purification of the bacteria. Biochemical tests were conducted at Crop Diseases Research Institute (CDRI), NARC, Islamabad. Pathogenicity test has confirmed the presence of Pectobacterium atrosepticum on sunflower. This is first report documented this pathogen on sunflower crop in Pakistan.

Sign in / Sign up

Export Citation Format

Share Document