FIRST REPORT OF BACTERIAL HEAD ROT DISEASE CAUSED BYPECTOBACTERIUM ATROSEPTICUM ON SUNFLOWER IN PAKISTAN

is an important oil seed crop in Pakistan. During a field visit at National Agricultural Research Center (NARC), Islamabad, Pakistan bacterial head rot disease caused by Pectobacterium atrosepticum (formly Erwinaia caratovora subsp. atroseptica) has been observed on both local and exotic hybrids of Sunflower crop. Pathogenicity test has been carried out to fulfill Koch’s postulates. White and creamy colony growth was observed upon isolation and purification of the bacteria. Biochemical tests were conducted at Crop Diseases Research Institute (CDRI), NARC, Islamabad. Pathogenicity test has confirmed the presence of Pectobacterium atrosepticum on sunflower. This is first report documented this pathogen on sunflower crop in Pakistan.

Download Full-text

First Report of Curvularia aeria on Etlingera linguiformis from Nagaland, India

Plant Disease ◽

10.1094/pdis-01-14-0060-pdn ◽

2014 ◽

Vol 98 (11) ◽

pp. 1580-1580 ◽

Cited By ~ 2

Author(s):

C. Kithan ◽

L. Daiho

Keyword(s):

Leaf Surface ◽

Agricultural Research ◽

Disease Incidence ◽

Indian Agricultural Research Institute ◽

Mountain Range ◽

Pathogenicity Test ◽

Distilled Water ◽

Conidial Suspension ◽

First Report ◽

Initial Symptoms

Etlingera linguiformis (Roxb.) R.M.Sm. of Zingiberaceae family is an important indigenous medicinal and aromatic plant of Nagaland, India, that grows well in warm climates with loamy soil rich in humus (1). The plant rhizome has medicinal benefits in treating sore throats, stomachache, rheumatism, and respiratory complaints, while its essential oil is used in perfumery. A severe disease incidence of leaf blight was observed on the foliar portion of E. linguiformis at the Patkai mountain range of northeast India in September 2012. Initial symptoms of the disease are small brown water soaked flecks appearing on the upper leaf surface with diameter ranging from 0.5 to 3 cm, which later coalesced to form dark brown lesions with a well-defined border. Lesions often merged to form large necrotic areas, covering more than 90% of the leaf surface, which contributed to plant death. The disease significantly reduces the number of functional leaves. As disease progresses, stems and rhizomes were also affected, reducing quality and yield. The diseased leaf tissues were surface sterilized with 0.2% sodium hypochlorite for 2 min followed by rinsing in sterile distilled water and transferred into potato dextrose agar (PDA) medium. After 3 days, the growing tips of the mycelium were transferred to PDA slants and incubated at 25 ± 2°C until conidia formation. Fungal colonies on PDA were dark gray to dark brown, usually zonate; stromata regularly and abundantly formed in culture. Conidia were straight to curved, ellipsoidal, 3-septate, rarely 4-septate, middle cells broad and darker than other two end cells, middle septum not median, smooth, 18 to 32 × 8 to 16 μm (mean 25.15 × 12.10 μm). Conidiophores were terminal and lateral on hyphae and stromata, simple or branched, straight or flexuous, often geniculate, septate, pale brown to brown, smooth, and up to 800 μm thick (2,3). Pathogen identification was performed by the Indian Type Culture Collection, Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi (ITCC Accession No. 7895.10). Further molecular identity of the pathogen was confirmed as Curvularia aeria by PCR amplification and sequencing of the internal transcribed spacer (ITS) regions of the ribosomal DNA by using primers ITS4 and ITS5 (4). The sequence was submitted to GenBank (Accession No. MTCC11875). BLAST analysis of the fungal sequence showed 100% nucleotide similarity with Cochliobolus lunatus and Curvularia aeria. Pathogenicity tests were performed by spraying with an aqueous conidial suspension (1 × 106 conidia /ml) on leaves of three healthy Etlingera plants. Three plants sprayed with sterile distilled water served as controls. The first foliar lesions developed on leaves 7 days after inoculation and after 10 to 12 days, 80% of the leaves were severely infected. Control plants remained healthy. The inoculated leaves developed similar blight symptoms to those observed on naturally infected leaves. C. aeria was re-isolated from the inoculated leaves, thus fulfilling Koch's postulates. The pathogenicity test was repeated twice. To our knowledge, this is the first report of the presence of C. aeria on E. linguiformis. References: (1) M. H. Arafat et al. Pharm. J. 16:33, 2013. (2) M. B. Ellis. Dematiaceous Hyphomycetes. CMI, Kew, Surrey, UK, 1971. (3) K. J. Martin and P. T. Rygiewicz. BMC Microbiol. 5:28, 2005. (4) C. V. Suberamanian. Proc. Indian Acad. Sci. 38:27, 1955.

Download Full-text

First Report of Fusarium Wilt of Lavandula pubescens Caused by Fusarium oxysporum in Saudi Arabia

Plant Disease ◽

10.1094/pdis-94-9-1163b ◽

2010 ◽

Vol 94 (9) ◽

pp. 1163-1163 ◽

Cited By ~ 2

Author(s):

K. Perveen ◽

N. Bokhari

Keyword(s):

Saudi Arabia ◽

Fusarium Oxysporum ◽

Vascular Tissue ◽

Agricultural Research ◽

Indian Agricultural Research Institute ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Potential Threat ◽

King Saud University ◽

First Report

In November 2008, a wilt of lavender (Lavandula pubescens) seedlings was observed in the greenhouse at King Saud University, Riyadh, Saudi Arabia. Affected seedlings were wilted and the root system was poorly developed. Diseased stems developed a dark coloration that extended down to the roots. Vascular tissue of the affected seedlings appeared red or brown. Isolations consistently yielded a fungus growing from the discolored stem tissue when placed on potato dextrose agar. The macroscopic characteristics of the colony, as well as microscopic structures, were used to identify the fungus as Fusarium oxysporum (2). Oval to elliptical microconidia without septa and originating from short phialides were used to distinguish the species from F. solani (1). The fungus was authenticated by the ITCC (Indian Type Collection Centre), Indian Agricultural Research Institute, New Delhi, India, and given I.D. No. 7532.09. For conducting further experiments, healthy seedlings of L. pubescens were obtained from the botanical garden of the King Saud University and grown in steam-sterilized soil. Healthy seedlings of lavender were inoculated using a root-dip method with a conidial suspension (1 × 107 CFU/ml) of one strain of F. oxysporum obtained from infected plants. Inoculated seedlings were then transplanted into steam-sterilized soil. Plants inoculated with sterilized water (1 ml per plant) served as control treatments. Wilt symptoms and vascular discoloration in the roots and crown developed within 20 days on all plants inoculated with the pathogen, while control plants remained asymptomatic. F. oxysporum was consistently reisolated from symptomatic plants. The pathogenicity test was conducted twice. To our knowledge, this is the first report of F. oxysporum on L. pubescens in Saudi Arabia or elsewhere in the world, and this newly identified disease may be a potential threat to commercial production of lavender. References: (1) J. F. Leslie and B. A. Summerell. Page 212 in: The Fusarium Laboratory Manual. Blackwell Publishing Professional, Hoboken, NJ, 2006. (2) P. C. Nelson et al. Clin. Microbiol. Rev. 7:479, 1994.

Download Full-text

First Report of Bacterial Stalk and Head Rot Disease Caused by Pectobacterium atrosepticum on Sunflower in Turkey

Plant Disease ◽

10.1094/pdis-93-12-1352b ◽

2009 ◽

Vol 93 (12) ◽

pp. 1352-1352 ◽

Cited By ~ 10

Author(s):

K. K. Baştaş ◽

H. Hekimhan ◽

S. Maden ◽

M. Tör

Keyword(s):

Relative Humidity ◽

Acid Production ◽

Plant Protection ◽

Methyl Glucoside ◽

Pectobacterium Atrosepticum ◽

First Report ◽

Molecular Tests ◽

University Department ◽

Head Rot ◽

Reducing Substances

Bacterial stalk and head rot on sunflower (Helianthus annuus) was investigated in Konya Province of Turkey in 2008. Disease incidence was estimated as 30%. Bacteria appeared as droplets and ooze and symptoms were dark and water-soaked necrotic areas on stems and heads. Twenty-four strains were isolated from lesions on stalks and heads of sunflower cv. TR3080 from a 25-ha field and identified as Pectobacterium atrosepticum (formerly Erwinia caratovora subsp. atroseptica) (2) on the basis of biochemical, physiological (3), and molecular tests (1). Bacteria were gram negative, rod shaped, fermentative, nonfluorescent on King's B medium; positive for gelatin liquefaction, CVP test, catalase, and pectolytic activity, growth on 5% NaCl, reducing substances from sucrose, acid-production from lactose and α-methyl glucoside; and negative for growth at 37°C, acid production from sorbitol and maltose, phosphatase activity, tests for egg yolk (lecithin), sensitivity to erythromycin, and pigmentation on yeast dextrose calcium carbonate agar medium. To distinguish between P. atrosepticum and P. carotovorum, particular attention was paid to the growth at 37°C, reducing substances from sucrose and the utilization of α-methyl glucoside. Mesophyll cells of tobacco plants (Nicotiana tobaccum cv. White Burley) were infiltrated with bacterial suspensions (108 cells/ml) or water (control). Brown, collapsed areas of tissues (hypersensitive response) were observed at the injection sites after incubation for 48 h at 28°C and 80% relative humidity. A P. atrosepticum-specific primer set, Y45/Y46 (3), was used in PCR reactions to generate a 439-bp DNA fragment. Reference strains, Eca17 from Aegean University, Department of Plant Protection (İzmir, Turkey) and NCPPB 1277 from Selcuk University, Department of Plant Protection, Konya, Turkey, were employed in all biochemical, physiological, and molecular tests as positive controls and similar results were obtained. Koch's postulates were carried out to establish a causal relationship between the bacteria and the disease. A bacterial suspension (108 CFU/ml) was injected into sunflower shoot tips and inoculated plants were incubated for 2 weeks at 28°C and 80% relative humidity. All bacterial strains obtained from the stalks and heads produced the rot symptoms and ooze following inoculation to the susceptible sunflower cv. TR 3080. No symptoms were observed on controls that were inoculated with sterile water. The bacteria were isolated from the lesions on stalks and heads and their identities confirmed by the biochemical, physiological, and molecular tests. All tests were performed three times on three plants per strain. To our knowledge, this is the first report of P. atrosepticum on sunflower in Turkey. Further research is needed to determine how far the disease is spread in Turkey since other provinces also grow sunflowers. References: (1) L. Gardan et al. Int. J. Syst. Evol. Microbiol. 53:381, 2003. (2) L. Hauben et al. Syst. Appl. Microbiol. 21:384, 1998. (3) A. Darrasse et al. Appl. Environ. Microbiol. 60:298, 1994.

Download Full-text

First Report of Black Stem Caused by Botryosporium longibrachiatum on Statice in Korea

Plant Disease ◽

10.1094/pdis-02-14-0205-pdn ◽

2014 ◽

Vol 98 (10) ◽

pp. 1431-1431 ◽

Cited By ~ 2

Author(s):

I. Y. Choi ◽

B. S. Kim ◽

J. H. Park ◽

S. E. Cho ◽

H. D. Shin

Keyword(s):

Agricultural Research ◽

Its Region ◽

Culture Collection ◽

New Delhi ◽

Pathogenicity Test ◽

Voucher Specimen ◽

First Report ◽

Sweet Basil ◽

Fungal Dna ◽

Poor Ventilation

Perennial statice is widely cultivated worldwide. In Korea, hybrid statice (Limonium latifolium × bellidifolium) is grown as a commercial cut flower crop in polyethylene-film-covered greenhouses. In April 2013, hundreds of hybrid statice plants of the cvs. Yellow Cream and Pinky Cream were found symptomatic of a previously unknown disease, with 10 to 15% incidence in 10 greenhouses of 1,600 m2 surveyed in Gochang County, Korea. Affected stems turned dark brown and were usually covered with a fungus resembling the hoar-frost fungus, Botryosporium longibrachiatum (3), especially in a cool and humid environment. Symptoms consisted of stem blackening, as is typical for burley tobacco (1) and sweet basil (2). According to the farmer of the hybrid statice, stems blackened in the winter and spring of January to April when the tunnels were mostly closed, thus reaching 100% relative humidity (RH) every night due to poor ventilation. The fungus had an elongate main axis with lateral fertile branches in acropetal succession. Conidiophores were simple, erect, macronematous, 32 to 79 μm in length, with a terminal cluster of three to five ampullae. Conidiogneous cells were polyblastic. Conidia were ellipsoidal, elliptical-fusiform, hyaline, 7.6 to 9.5 × 3.0 to 4.2 μm. Colonies on potato dextrose agar (PDA) were floccose, non-pigmented, and chalk-white in color. Morphological and cultural characteristics of the fungus were consistent with previous reports of B. longibrachiatum (Oudem.) Maire (2,3). A voucher specimen was deposited in the Korea University Herbarium (KUS). Isolate KUS-F27305 was submitted to the Korean Agricultural Culture Collection (Accession No. KACC47263). Fungal DNA was extracted from isolate KACC47263 with DNeasy Plant Mini Kits. The complete internal transcribed spacer (ITS) region of rDNA was amplified with the primers ITS1/ITS4 and sequenced. The resulting sequence of 604 bp was deposited in GenBank (Accession No. KF372591). A BLAST search in GenBank exhibited ≥99% nucleotide identity with the ITS sequence of B. longibrachiatum (JX666334) from sweet basil in Korea. To confirm pathogenicity, colonized mycelial agar blocks from isolate KACC47263 were transferred individually onto stem apices and leaves of five statice plants of the cv. Yellow Cream. Five control plants were treated similarly with non-colonized agar blocks. The plants were incubated in a humid chamber at 22 ± 2°C with a 12-h photoperiod for 48 h, and then maintained in 100% RH. After 3 to 4 days, necrotic lesions identical to those observed in the original greenhouses, started to develop on the stem and leaves of inoculated plants, leading to blackened stems covered with the hoar-frost fungus after 14 days. B. longibrachiatum was re-isolated from the lesions of inoculated plants, fulfilling Koch's postulates. No symptoms were observed on control plants. The pathogenicity test was repeated with the cv. Pinky Cream with identical results. To our knowledge, this is the first report of B. longibrachiatum infecting perennial statice globally as well as in Korea. We propose the name black stem of statice for this disease, analogous to the disease on basil (2). References: (1) T. R. Anderson and T. W. Welacky. Plant Dis. 67:1158, 1983. (2) J. H. Park et al. Plant Dis. 97:425, 2013. (3) C. V. Subramanian. Hyphomycetes. Indian Council of Agricultural Research, New Delhi, India, 1971.

Download Full-text

First report of rhizome rot of banana caused by Klebsiella variicola in India

Plant Disease ◽

10.1094/pdis-10-20-2316-pdn ◽

2021 ◽

Author(s):

Murugan Loganathan ◽

Raman Thangavelu ◽

Pushpakanth P ◽

Muthubharathi Kalimuthu ◽

R Ramesh ◽

...

Keyword(s):

Tamil Nadu ◽

Early Stage ◽

Soft Rot ◽

Rpob Gene ◽

Universal Primers ◽

Biochemical Tests ◽

First Report ◽

Rot Disease ◽

Biochemical Analyses ◽

Rhizome Rot

Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5′ - AGAGTTTGATCCTGGCTCAG - 3′; 1492 R 5′ - GGTTACCTTGTTACGACTT - 3′) and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in nutrient broth for 48 h at 37±1°C and the cells were harvested by centrifugation. Five milliliters of the culture suspension (2×108 CFUmL-1) taken in a syringe was injected into rhizomes of three month old tissue cultured Grand Naine plants. Each bacterial isolate was injected into eight banana plants at soil level. Appropriate controls were maintained. Inoculated plants were maintained in a glasshouse at 32±2°C and after 30-35 days, rhizome rot symptoms appeared in all the three bacterial isolates inoculated plants but in none of the control plants. The Koch’s postulates were proved by re-isolation and identification.To the best of our knowledge, this is the first report of K. variicola causing rhizome rot disease of banana in India.

Download Full-text

First Report of Cabbage Head Rot Caused by Fusarium avenaceum in Poland

Plant Disease ◽

10.1094/pdis-05-14-0507-pdn ◽

2014 ◽

Vol 98 (12) ◽

pp. 1741-1741 ◽

Cited By ~ 2

Author(s):

J. Robak ◽

A. Czubatka ◽

A. Czajka ◽

U. Smolinska

Keyword(s):

Aerial Mycelium ◽

Colony Growth ◽

The United States ◽

Control Treatment ◽

Its2 Region ◽

Academic Press ◽

Laboratory Manual ◽

First Report ◽

Head Rot ◽

Excised Tissue

Cabbage (Brassica oleracea L. var. capitata L.) is an important crop in Poland. Symptoms of a disease affecting cabbage were observed in 2012 and 2013 both in mid-August during the growing season and during storage in January and February. The disease affected about 30 to 40% of crops grown on ~9,000 ha over three locations: Charsznica in south Poland and Bedlno and Skierniewice in central Poland. Circular, watery lesions ranging from 10 to 60 mm in diameter on the surface of affected cabbage heads included whitish aerial mycelium that developed orange sporodochia in the center of each lesion. After 2 to 3 weeks, infection covered each entire cabbage head. A fungal pathogen was isolated from the orange lesions and from infected internal tissue. After sterilization of the excised tissue in 70% ethanol, the sections were each rinsed twice with sterilized water, dried on sterilized filter paper, and plated onto potato dextrose agar (PDA). Isolations consistently yielded morphologically homogeneous fungal colonies with abundant aerial mycelium that ranged from yellow to brownish yellow. The fungus produced pigmentation that changed the agar medium from dark yellow to brownish-burgundy. The mean colony growth was 66 mm after 7 days at 25°C. The fungus formed macroconidia, but microconidia and chlamydospores were not observed. Macroconidia were slender, slightly falcate, usually 3- to 5-septate, 44.7 to 60.7 × 3.7 to 5.5 μm, and formed in abundant orange sporodochia. On PDA, the isolates lost the ability to form sporodochia. Morphological and cultural features were typical of those of F. avenaceum (Fries) Saccardo (2). Koch's postulates were conducted to establish pathogenicity of each of four of the isolates on cabbage heads of the cv. Jaguar F1 (Bejo Seeds, Poland). The outer leaf of each head was inoculated with an 8-mm-diameter PDA plug colonized by the appropriate isolate (four cabbage heads/isolate), and the heads stored in a growth chamber at 25°C. After 5 to 7 days, lesions similar to those observed on naturally infested cabbage were observed on all the inoculated cabbage leaves. Four cabbage heads treated similarly with water as a control treatment remained symptomless. The experiment was repeated. DNA extracted from two of the four isolates was subjected to a PCR assay with primers ITS5 and ITS4 (4) for species identification based on the ITS1 and ITS2 sequences of ribosomal DNA (rDNA). The two sequences differed by 1 bp in the ITS2 region and had 100% identity with ITS sequences of F. avenaceum Accession Nos. AY147283 and AY147285 in GenBank. The sequences were deposited in GenBank as KM189440 and KM189441. Descriptions of fusarium head rot of cabbage in the United States (1) and Canada (3) were consistent with these observations in Poland. To our knowledge, this is the first report of F. avenaceum causing head rot of cabbage in Poland and in Europe. References: (1) H. R. Dillard and A. C. Cobb. Phytopathology 96:30. 2006. (2) J. F. Leslie and B. A. Summerell. Page 132 in: The Fusarium Laboratory Manual, Blackwell Publishing, Hoboken, NJ, 2006. (3) R. D. Peters et al. HortSci. 42:737. 2007. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First Report of a Ceratocystis manginecans Causing Quick Decline of Psidium guajava in Pakistan

Plant Disease ◽

10.1094/pdis-09-20-1953-pdn ◽

2021 ◽

Author(s):

Romana Anjum ◽

Iqrar Ahmad Khan ◽

Mark L. Gleason ◽

Noumal Hassani

Keyword(s):

Elongation Factor ◽

Morphological Characteristics ◽

Psidium Guajava ◽

Malt Extract ◽

Pathogenicity Test ◽

Vascular Bundles ◽

Isolation And Purification ◽

First Report ◽

Decline Disease ◽

One Year

Psidium guajava is a widely grown fruit tree of Asia for food and medicinal purposes. Also being reported to have anti-inflammatory, antimicrobial, antioxidant, antidiarrheal, antimutagenic properties (Somu, 2012). In April 2018, quick decline disease of guava was observed in orchards of Sheikhupura, Lahore, Faisalabad, Kasur and Chiniot districts of Punjab, Pakistan. Approximately 68% of the trees were found declined with mummified fruits. Initial infection symptoms appeared as wilting of leaves, bark discoloration, followed by the leaf drooping, crown area discoloration, bark splitting, mummified fruits, dying of branches and lately whole tree death in weeks to months. The fungus formed a dark brown to black discoloration (3 to 5 cm wide and 7 to 9 cm long) in vascular bundles of P. guajava tree. Sixty-five samples of discolored wood from the main stem were collected, and pathogen was isolated using carrot bait method (Moller and DeVay, 1968). Isolation and purification were done on 2% Malt extract agar (MEA) plates incubated at 25 ± 2 °C in 12 h light and dark period. After 6 days of incubation, fungal hyphae, fruiting structures, sexual & asexual spores were observed on MEA plates. Black globose to subglobose ascomata with bases (151-) 200 (-278) µm in diameter with long neck (511-) 535 to 600 (-671) µm long, (23-) 28 to 39 (-47) µm wide at base, (13-) 13- 19 (-25) µm wide at tip and light brown to hyaline divergent ostiolar hyphae (50µm) were developed and produces hat-shaped hyaline ascospores 3 to 5 µm long and 6-7 µm (with sheath) and 4 µm (without sheath) wide. After 7 days, initially white mycelium turned into olivaceous green and produced primary phialidic conidiophore with emerging primary cylindrical hyaline conidia (7 to 12 × 4 to 6 µm), secondary conidiophore with emerging chain of secondary barrel-shaped hyaline conidia (9-) 10 to 12 (-13) µm long × (5-) 5 to 9 (-11) µm wide and dark brown dematiaceous chlamydospores conidia (12 ×10 µm) were observed. All morphological characteristics were consistent to the description of Ceratocystis manginecans (Van Wyk, et al., 2007). For further confirmation, from a purified isolate GWD10, genomic DNA was extracted. The internal transcribed spacer (ITS) and translation elongation factor 1-alpha (TEF 1-α) region were amplified with primer pairs ITS1/ITS4 and EF1/EF2 (Jacobs et al., 2004; White et al., 1990) respectively. Generated sequences (Accession Nos. MN 365128 & MT952139) on BLAST analysis showed 100% homology for ITS and TEF with Ceratocystis manginecans (Accession No., KC261852 CMW 13582 Voucher, NR-119532.1 type material, MH863135; EF433317, respectively) reported from Oman and Pakistan (Van Wyk et al., 2007 & Vu et al., 2019). For pathogenicity test, one-year-old healthy P. guajava plants were inoculated by making a T-shaped slit of 5 × 7.5 mm in the bark. Two weeks old cultures of GWD10, 5-mm mycelial discs were aseptically transferred and covered with moistened sterilized cotton swab followed parafilm to maintain humidity. Fifteen plants were inoculated with fungal cultures and five plants were inoculated with MEA plugs as controls. All plants were maintained at 25 ± 2 °C with 80 ± 5% relative humidity (RH) in greenhouse Initial bark discoloration developed after 14 days of inoculation. After 40 days of inoculation plants started wilting and dying, similar to the symptoms were observed in naturally infected trees. Control plants remained asymptomatic. To fulfill Koch’s pustulates, the same pathogen was re-isolated from the test plants and identified on morphological features to GWD10. The pathogen has been associated with mango decline in Oman and Pakistan (Van Wyk et al., 2007), acacia wilt in Indonesia (Harrington et al., 2015) and siris wilt in Pakistan (Razzaq et al., 2020). P guajava is an important fruit and medicinal plant, and the infection of C. manginecans is a great concern to the producers of P. guajava (Harrington et al., 2015; Huang et al., 2003). To our knowledge, this is the first report of Ceratocystis manginecans causing quick decline of P. guajava worldwide.

Download Full-text

Phytophthora mediterranea sp. nov., a New Species Closely Related to Phytophthora cinnamomi from Nursery Plants of Myrtus communis in Italy

Forests ◽

10.3390/f12060682 ◽

2021 ◽

Vol 12 (6) ◽

pp. 682

Author(s):

Carlo Bregant ◽

Antonio A. Mulas ◽

Giovanni Rossetto ◽

Antonio Deidda ◽

Lucia Maddau ◽

...

Keyword(s):

New Species ◽

Root Rot ◽

Phytophthora Cinnamomi ◽

Colony Growth ◽

Phytophthora Species ◽

Maximum Temperature ◽

Pathogenicity Test ◽

Forest Nurseries ◽

Collar And Root Rot ◽

A New Species

Monitoring surveys of Phytophthora related diseases in four forest nurseries in Italy revealed the occurrence of fourteen Phytophthora species to be associated with collar and root rot on fourteen plants typical of Mediterranean and alpine regions. In addition, a multilocus phylogeny analysis based on nuclear ITS and ß-tubulin and mitochondrial cox1 sequences, as well as micromorphological features, supported the description of a new species belonging to the phylogenetic clade 7c, Phytophthora mediterranea sp. nov. Phytophthora mediterranea was shown to be associated with collar and root rot symptoms on myrtle seedlings. Phylogenetically, P. mediterranea is closely related to P. cinnamomi but the two species differ in 87 nucleotides in the three studied DNA regions. Morphologically P. mediterranea can be easily distinguished from P. cinnamomi on the basis of its smaller sporangia, colony growth pattern and higher optimum and maximum temperature values. Data from the pathogenicity test showed that P. mediterranea has the potential to threaten the native Mediterranean maquis vegetation. Finally, the discovery of P. cinnamomi in alpine nurseries, confirms the progressive expansion of this species towards cold environments, probably driven by climate change.

Download Full-text

Pectobacterium spp. Associated with Bacterial Stem Rot Syndrome of Potato in Canada

Phytopathology ◽

10.1094/phyto-04-12-0083-r ◽

2012 ◽

Vol 102 (10) ◽

pp. 937-947 ◽

Cited By ~ 50

Author(s):

S. H. De Boer ◽

X. Li ◽

L. J. Ward

Keyword(s):

Gene Sequence ◽

Blackleg Disease ◽

Chain Reaction ◽

Biochemical Tests ◽

Pectobacterium Atrosepticum ◽

Physiological Characterization ◽

Specific Polymerase Chain Reaction ◽

Sequence Identification ◽

Carotovorum Subsp ◽

Polymerase Chain

Pectobacterium atrosepticum, P. carotovorum subsp. brasiliensis, P. carotovorum subsp. carotovorum, and P. wasabiae were detected in potato stems with blackleg symptoms using species- and subspecies-specific polymerase chain reaction (PCR). The tests included a new assay for P. wasabiae based on the phytase gene sequence. Identification of isolates from diseased stems by biochemical or physiological characterization, PCR, and multi-locus sequence typing (MLST) largely confirmed the PCR detection of Pectobacterium spp. in stem samples. P. atrosepticum was most commonly present but was the sole Pectobacterium sp. detected in only 52% of the diseased stems. P. wasabiae was most frequently present in combination with P. atrosepticum and was the sole Pectobacterium sp. detected in 13% of diseased stems. Pathogenicity of P. wasabiae on potato and its capacity to cause blackleg disease were demonstrated by stem inoculation and its isolation as the sole Pectobacterium sp. from field-grown diseased plants produced from inoculated seed tubers. Incidence of P. carotovorum subsp. brasiliensis was low in diseased stems, and the ability of Canadian strains to cause blackleg in plants grown from inoculated tubers was not confirmed. Canadian isolates of P. carotovorum subsp. brasiliensis differed from Brazilian isolates in diagnostic biochemical tests but conformed to the subspecies in PCR specificity and typing by MLST.

Download Full-text