First Report of Myrothecium roridum Causing Myrothecium Leaf Spot on Salvia spp. in the United States

The genus Salvia includes at least 900 species distributed worldwide. Wild species are found in South America, southern Europe, northern Africa, and North America. Salvia, commonly referred to as sage, is grown commercially as a landscape plant. In August 2006, pale-to-dark brown, circular leaf spots 5 to 20 mm in diameter with concentric rings were observed on Salvia farinacea ‘Victoria Blue’. Approximately 5% of the plants in a central Florida nursery were affected. Lesions were visible on both leaf surfaces, and black sporodochia with white, marginal hyphal tuffs were present mostly on the lower surface in older lesions. Symptoms were consistent with those of Myrothecium leaf spot described on other ornamentals such as gardenia, begonia, and New Guinea impatiens (4). Isolations from lesions on potato dextrose agar produced white, floccose colonies with sporodochia in dark green-to-black concentric rings. Conidia were hyaline and cylindrical with rounded ends and averaged 7.4 × 2.0 μm. All characteristics were consistent with the description of Myrothecium roridum Tode ex Fr. (2,3). The internal transcribed spacer regions ITS1, ITS2, and the 5.8s rRNA genomic region of one isolate were sequenced (Accession No. EF151002) and compared with sequences in the National Center for Biotechnology Information (NCBI) database. Deposited sequences from M. roridum were 96.3 to 98.8% homologous to the isolate from salvia. To confirm pathogenicity, three salvia plants were inoculated by spraying with a conidial suspension of M. roridum (1 × 105 conidia per ml). Plants were covered with plastic bags and incubated in a growth chamber at 28°C for 7 days. Three plants were sprayed with sterile, distilled water as a control and incubated similarly. The symptoms described above were observed in all inoculated plants after 7 days, while control plants remained symptomless. M. roridum was reisolated consistently from symptomatic tissue. There are more than 150 hosts of M. roridum, including one report on Salvia spp. in Brunei (1). To our knowledge, this is the first report of Myrothecium leaf spot caused by M. roridum on Salvia spp. in the United States. Even the moderate level disease present caused damage to the foliage and reduced the marketability of salvia plants. Therefore, control measures may need to be implemented for production of this species in ornamental nurseries. References: (1) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory. Online publication. ARS, USDA, 2006, (2) M. B. Ellis. Page 449 in: Microfungi on Land Plants: An Identification Handbook. Macmillan Publishing, NY, 1985. (3) M. Fitton and P. Holliday. No. 253 in: CMI Descriptions of Pathogenic Fungi and Bacteria. The Eastern Press Ltd. Great Britain, 1970. (4) M. G. Daughtrey et al. Page 19 in: Compendium of Flowering Potted Plant Diseases. The American Phytopathological Society. St. Paul, MN, 1995.

Download Full-text

First Report of Myrothecium roridum Causing Leaf Spot on Garden Hydrangea in the United States

Plant Disease ◽

10.1094/pdis-04-10-0264 ◽

2010 ◽

Vol 94 (10) ◽

pp. 1266-1266 ◽

Cited By ~ 7

Author(s):

M. T. Mmbaga ◽

Y. Li ◽

M.-S. Kim

Keyword(s):

United States ◽

Leaf Spot ◽

Incubation Temperature ◽

Morphological Characteristics ◽

The United States ◽

Control Treatment ◽

Medium Size ◽

First Report ◽

Detached Leaves ◽

Myrothecium Roridum

Garden hydrangea (Hydrangea macrophylla) is a popular flowering shrub that grows well in Tennessee but foliar diseases impact their appearance, health, and market value. Leaves of garden hydrangea showed necrotic lesions with concentric rings of brown and dark brown at the Tennessee State University Research Center in McMinnville. A fungus was recovered from June and July leaf samples with 20% frequency of isolation from approximately 40 leaf pieces that were surface sterilized and plated in potato dextrose agar (PDA). Isolates developed white colonies and dark gray-to-black, spore-bearing mycelial cushions (sporodochia) that formed on older colonies (30 to 45 days old) at 25 ± 2°C. Conidia were hyaline to slightly dark, one-celled, ovoid to elongate with rounded ends, and 2.0 to 2.5 × 5.5 to 6.5 μm. These morphological characteristics were consistent with those described for Myrothecium roridum Tode ex Fr. (1). DNA sequence for three isolates of this fungus showed identical internal transcribed spacer (ITS) region sequences (GenBank Accession No. HM215150) with 99% maximum sequence identity to M. roridum isolates (GenBank Accession Nos. AJ301994.1 and AJ608978). Another close match (97%) was with M. gramineum (GenBank Accession No. FJ235084) and M. tongaense (GenBank Accession No. AY254157). Pathogenicity of M. roridum was evaluated on detached leaves from three hydrangea cultivars, Nikko Blue, All Summer Beauty, and Blue bird. Four, medium-size, detached leaves were placed in moist chambers and inoculated with 5-mm mycelial plugs from 14-day-old cultures; sterile PDA was used as the control treatment. A randomized, complete-block experimental design was used with a replication of four leaves per cultivar. Incubation temperature was 26 ± 2°C. Necrotic lesions started 4 to 5 days after inoculation in all inoculated leaves; lesions expanded to cover 10 to 25% of the leaf surface and formed concentric rings; sterile PDA plugs did not produce leaf lesions. This experiment was repeated twice and similar symptoms were produced; M. roridum was reisolated from all inoculated leaves. Spray inoculation of detached leaves of hydrangea cv. Pretty Maiden with 5 × 104 spores/ml produced similar symptoms; leaves sprayed with water remained symptom free. M. roridum has a wide host range and similar symptoms have been reported on other ornamentals including salvia (2), begonia ( http://mrec.ifas.ufl.edu/foliage/folnotes/begonias.htm ), gardenia ( http://cfextension.ifas.ufl.edu/agriculture/ nursery_production/ documents/Gardenia.pdf ), and cotton (3). To our knowledge, this is the first report of M. roridum causing leaf spot on H. macrophylla in the United States. References: (1) M. B. Ellis. Page 465 in: More Damatacous Hyphomycetes. CABI, Wallingford, UK. 1993. (2) J. A. Mangandi et al. Plant Dis. 91:772, 2007. (3) R. L. Munjal. Indian Phytopathol. New Delhi, 13:150, 1960.

Download Full-text

First Report of Alternaria alternata f. sp. cucurbitae Causing Alternaria Leaf Spot of Melon in the Mid-Atlantic Region of the United States

Plant Disease ◽

10.1094/pdis-92-4-0652b ◽

2008 ◽

Vol 92 (4) ◽

pp. 652-652 ◽

Cited By ~ 2

Author(s):

X. G. Zhou ◽

K. L. Everts

Keyword(s):

United States ◽

Disease Severity ◽

Body Length ◽

Alternaria Alternata ◽

Leaf Spot ◽

The United States ◽

Tween 20 ◽

Conidial Suspension ◽

First Report ◽

Alternaria Leaf Spot

Alternaria alternata f. sp. cucurbitae, the casual agent of Alternaria leaf spot, was first described in Greece where it caused severe losses to greenhouse-grown cucumbers (Cucumis sativus) (3,4). The fungus also attacks melon (C. melo) and watermelon (Citrullus lanatus) (1–3). In late June of 2006, following a period of windy and rainy days, numerous dark brown, circular lesions, 0.5 to 1 mm in diameter, were observed on leaves of melons in a field in Wicomico County, Maryland. The lesions gradually enlarged and coalesced into large, nearly circular, or irregularly shaped lesions that could be as long as 3 cm. The center of the lesions was light tan, surrounded by a dark brown ring and a chlorotic halo, and tended to split in the later development stages. Most of the lesions appeared on the edge of the leaves and no lesions developed on the stems and fruit. Lesions first started on old leaves and then developed on leaves in the middle part of the canopy. Leaf lesions were observed on melon cvs. Ananas, Honeydew Greenflesh, and Israeli. Disease severity ranged from 3 to 20% of the leaf area affected. Small pieces (3 × 3 mm) of tissue removed from the margin between healthy and diseased tissue were surface disinfected in 0.5% NaOCl for 2 min and plated on acidified, ¼-strength potato dextrose agar. Isolations made from diseased tissue frequently (61%) yielded fungal colonies with morphological features and spore dimensions that were consistent with the description of A. alternata f. sp. cucurbitae (1,3). Fungal isolates were characterized by small, short-beaked, multicellular conidia. Conidia were ovoid, obclavate, and sometimes ellipsoidal with the average overall body length of 39 μm (range, 17 to 80 μm) and width of 14 μm (range, 7 to 20 μm). Conidia were produced on short conidiophores in chains. The beaks were short (often less than one-third the body length) and conical or cylindrical. Pathogenicity of six single-spore isolates was determined on four melon cultivars (Honeydew Greenflesh, Israeli, Tam Dew, and Topmark) and one watermelon cultivar (Sugar Baby) in a greenhouse. Twenty plants of each cultivar at the one-true-leaf stage were sprayed with a conidial suspension (106 conidia/ml) of each isolate amended with 0.1% (vol/vol) of Tween 20 until runoff (1.5 to 2 ml per plant). Inoculation with sterile distilled water amended with 0.1% Tween 20 served as controls. The plants were placed in a dew growth chamber for 48 h at 24°C and subsequently maintained in a greenhouse at 21 to 29°C. At 4 to 5 days after inoculation, each isolate induced leaf lesions on each inoculated cultivar similar to typical lesions observed in the field. There was no significant difference in disease severity among the cultivars tested or between melon and watermelon. Control plants remained symptomless. The fungus was readily reisolated from symptomatic tissues. To our knowledge, this is the first report of A. alternata f. sp. cucurbitae causing Alternaria leaf spot of melon in the Mid-Atlantic United States and the only report outside Georgia in the southern region of the United States (D. B. Langston, personal communication) and Greece. References: (1) D. L. Vakalounakis. Plant Dis. 74:227, 1990. (2) D. L. Vakalounakis. Ann. Appl. Biol. 117:507, 1990. (3) D. L. Vakalounakis. Alternaria leaf spot. Page 24 in: Compendium of Cucurbit Diseases. T. A. Zitter et al., eds. The American Phytopathological Society, St. Paul, MN, 1996. (4) D. L. Vakalounakis and N. E. Malathrakis. J. Phytopathol. 121:325, 1988.

Download Full-text

First Report of Ascochyta Leaf Spot of Quinoa Caused by Ascochyta sp. in the United States

Plant Disease ◽

10.1094/pdis-11-12-1008-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 844-844 ◽

Cited By ~ 4

Author(s):

A. L. Testen ◽

J. M. McKemy ◽

P. A. Backman

Keyword(s):

United States ◽

Leaf Spot ◽

Sequence Data ◽

Chenopodium Quinoa ◽

The United States ◽

Management Program ◽

Tween 20 ◽

Conidial Suspension ◽

First Report ◽

The Impact

The Andean crop quinoa (Chenopodium quinoa Willd.), an amaranthaceous pseudograin, is an important food and export crop for this region. Quinoa is susceptible to Ascochyta leaf spot reportedly caused by Ascochyta hyalospora and/or A. caulina (1,2), and quinoa seeds can be infested by A. hyalospora (3). Quinoa fields were established in Pennsylvania during summer 2011. Widespread leafspot symptoms were observed on quinoa in mid-August 2011 in Centre County, PA. Tan to reddish-brown, irregularly shaped lesions were observed with numerous black pycnidia randomly distributed within each lesion. Crushed pycnidia revealed sub-hyaline to light brown, 1 to 2, or less often 3 septate, cylindrical to ovoid spores, 13 to 25 μm long by 5 to 10 μm wide. Pure cultures of Ascochyta were obtained by plating pycnidia from surface disinfested leaves onto half strength acidified potato dextrose agar (APDA). To obtain conidia for pathogenicity trials, cultures were transferred to oatmeal agar and placed in a 20°C incubator with a 12-h photoperiod. Conidia were harvested by scraping 2-week-old cultures. The conidial suspension was filtered through cheesecloth and adjusted to 1.8 × 105 conidia/mL. Tween 20 (0.1%) was added to the final inoculum and sprayed (with a Crown Spra-tool) onto ten 1-month old quinoa plants. Six plants sprayed with sterile water with 0.1% Tween 20 served as controls. Plants were placed in a growth chamber and bagged for 48 h to maintain >95% humidity. After 48 h, tan, irregularly shaped lesions were observed on inoculated plants, but no symptoms were observed on control plants. Plants were grown for 2 more weeks to observe symptom development, and then leaves with characteristic lesions were collected for isolation. Symptomatic leaves were surface disinfested in 10% bleach for 1 min and tissue from the lesion periphery was plated onto APDA. Obtained cultures were morphologically and molecularly identical to those obtained from quinoa fields. For molecular identification of the pathogen, DNA was extracted from cultures of Ascochyta and amplified using ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) primers. Sequences obtained shared 99% maximum identity with a GenBank accession of A. obiones (GU230752.1), a species closely related to A. hyalospora and A. caulina (4). However, the obtained pathogen is morphologically more similar to A. hyalospora and A. chenopodii, but not to A. caulina or A. obiones. At this time, final species identification is impossible because no GenBank sequence data is available for A. hyalospora or A. chenopodii. To our knowledge, this is the first report of Ascochyta leaf spot of quinoa in the United States. The impact of Ascochyta leaf spot on domestic and global quinoa production is unknown, but management of foliar diseases of quinoa, including Ascochyta leaf spot, is a critical component of any disease management program for quinoa. References: (1) S. Danielsen. Food Rev. Int. 19:43, 2003. (2) M. Drimalkova. Plant Protect. Sci. 39:146, 2003. (3) G. Boerema. Neth. J. Plant. Pathol. 83:153, 1977. (4) J. de Gruyter. Stud. Mycol. 75:1, 2012.

Download Full-text

First Report of Botrytis cinerea Causing Leaf Spot of Aquilegia vulgaris in Japan

Plant Disease ◽

10.1094/pdis-93-4-0425a ◽

2009 ◽

Vol 93 (4) ◽

pp. 425-425 ◽

Cited By ~ 2

Author(s):

M. Zhang ◽

T. Tsukiboshi ◽

I. Okabe

Keyword(s):

United States ◽

Botrytis Cinerea ◽

Leaf Spot ◽

Leaf Tissue ◽

The United States ◽

Plant Diseases ◽

Its2 Region ◽

Commonwealth Mycological Institute ◽

First Report ◽

Leaf Spots

European columbine, Aquilegia vulgaris L., Ranunculaceae, is an herbaceous flower widely used in gardens, parterres, and courtyards and is a traditional herbal plant. During the summer of 2008, leaf spots were observed on a plant cultivated along a roadside area in Nasushiobara, Tochigi, Japan. In some courtyards, the leaf spot affected more than 60% of the plants. Early symptoms appeared as small, round or elliptic, brown lesions on the leaves. Lesions expanded to 5 to 15 × 4 to 10 mm, irregular spots that were dark brown to black in the middle, with pale yellow-brown or purple-brown margins. In continuously wet or humid conditions, thick, gray mycelium and conidia appeared on the surface of leaf spots. Conidiophores were melanized at the base and hyaline near the apex, branched, and septated (approximately 3 mm × 16 to 18 μm). Conidia were hyaline, aseptate, ellipsoidal to obovoid, with a slightly protuberant hilum, and ranged from 9 to 14.5 × 5.5 to 6.5 μm. The pathogen was identified as Botrytis cinerea Pers.:Fr on the basis of morphology and sequence of ITS1-5.8s-ITS2 region of rDNA. The sequence (GenBank Accession No. FJ424510) exactly matched the sequences of two Botryotinia fuckeliana (anamorph Botrytis cinerea), (e.g., GenBank Accession Nos. AY686865 and FJ169666) (2). The fungus was isolated on potato dextrose agar (PDA) from a single conidium found on the symptomatic leaf tissue. Colonies of B. cinerea were first hyaline and later turned gray to black when the spores differentiated. Koch's postulates were performed with three whole plants of potted aquilegia. Leaves were inoculated with mycelia plugs harvested from the periphery of a 7-day-old colony; an equal number of plants were inoculated with the plugs of PDA medium only and served as controls. All plants were covered with plastic bags for 24 h to maintain high relative humidity and incubated at 25°C. After 8 days, all mycelium-inoculated plants showed symptoms identical to those observed on leaves from A. vulgaris infected in the field, whereas controls remained symptom free. Reisolation of the fungus from lesions on inoculated leaves confirmed that the causal agent was B. cinerea. B. cinerea has been previously reported on A. vulgaris in the United States and China (1,3). To our knowledge, this is the first report of leaf spots caused by B. cinerea on A. vulgaris in Japan. References: (1) Anonymous. Index of Plant Diseases in the United States. USDA Agric. Handb. No 165, 1960. (2) M. B. Ellis. Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew, England, 1971. (3) Z. Y. Zhang. Flora Fungorum Sinicorum. Vol. 26. Botrytis, Ramularia. Science Press, Beijing, 2006.

Download Full-text

First Report of a Leaf Spot and Stem Canker Caused by Myrothecium roridum on Watermelon in the United States

Plant Disease ◽

10.1094/pd-89-0342a ◽

2005 ◽

Vol 89 (3) ◽

pp. 342-342 ◽

Cited By ~ 11

Author(s):

K. W. Seebold ◽

D. B. Langston ◽

R. C. Kemerait ◽

J. E. Hudgins

Keyword(s):

United States ◽

Leaf Spot ◽

Citrullus Lanatus ◽

Stem Canker ◽

The United States ◽

Tween 20 ◽

Conidial Suspension ◽

American Phytopathological Society ◽

Leaf Spots ◽

Myrothecium Roridum

Myrothecium roridum Tode:Fr, pathogenic to a number of cucurbit species, causes fruit rots, cankers on crowns and stems, and leaf spots. Hosts include cantaloupe and honeydew (Cucurbita melo) and cucumber (Cucumis sativus) (1,3). In June 2004, following a period of heavy rainfall, numerous round-to-oblong, brown lesions with concentric rings were observed on leaves of watermelon (Citrullus lanatus) cv. Desert King at the Blackshank Farm in Tifton, GA. Disease was localized in the field and severity was low (<5% of leaf area affected). No symptoms were observed on fruit. Sections of tissue were removed from the margin between healthy and diseased tissue and plated on acidified, 25% potato dextrose agar (aPDA). A small plug of agar and mycelium were removed from colonies that emerged from lesions and were transferred to aPDA. Isolated colonies were characterized by a white, floccose mycelium with concentric, dark green-to-black rings of sporodochia bearing viscid masses of conidia. Conidia were cylindrical with rounded ends and measured 6 to 8 × 1.5 to 2.5 μm. The features of the fungus were consistent with the description of Myrothecium roridum (1,2). Pathogenicity tests were conducted in a temperature-controlled greenhouse. Twenty-five watermelon plants (cv. Desert King) were inoculated with a conidial suspension of M. roridum (5 × 105 conidia per ml) plus 0.1% vol/vol Tween 20. Inoculum was applied on leaves and stems until runoff with a hand-held mister, and plants were placed in a dew chamber for 72 h. Ten plants were sprayed with sterile, distilled water to serve as controls. Inoculated and noninoculated control plants were removed from the dew chamber and maintained at 25 to 28°C. Symptoms appeared 8 days after inoculation and were characterized by round, dark lesions with concentric rings; noninoculated plants were symptomless. Sections of symptomatic tissue were plated, and M. roridum was reisolated. Although M. roridum is a common pathogen of melons and cucumber, to our knowledge, this is the first field report of a leaf spot caused by M. roridum on watermelon in the United States. No further occurrences of the disease on watermelon have been observed in Georgia since the initial discovery of M. roridum in 2004; however, losses could be potentially severe if widespread infection of fruit were to occur. References: (1) B. D. Bruton. Crater Rot. Pages 49–50 in: Compendium of Cucurbit Diseases. T. A. Zitter et al., eds. The American Phytopathological Society, St. Paul, MN, 1996. (2) M. B. Ellis. Page 552 in: Dematiaceous Hyphomycetes. CAB International, Wallingford, UK, 1971. (3) D. F. Farr et al. Page 809 in: Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989.

Download Full-text

First Report of Myrothecium Leaf Spot Caused by Myrothecium roridum on Pepper in the United States

Plant Disease ◽

10.1094/pdis-06-17-0918-pdn ◽

2018 ◽

Vol 102 (1) ◽

pp. 246 ◽

Cited By ~ 1

Author(s):

B. Jordan ◽

A. K. Culbreath ◽

J. Brock ◽

B. Dutta

Keyword(s):

United States ◽

Leaf Spot ◽

The United States ◽

First Report ◽

Myrothecium Roridum

Download Full-text

First Report of the Occurrence of White Leaf Streak in Louisiana Rice

Plant Disease ◽

10.1094/pdis.1998.82.11.1282c ◽

1998 ◽

Vol 82 (11) ◽

pp. 1282-1282 ◽

Cited By ~ 1

Author(s):

A. K. M. Shahjahan ◽

M. C. Rush ◽

J. P. Jones ◽

D. E. Groth

Keyword(s):

United States ◽

Leaf Spot ◽

The United States ◽

Research Station ◽

Conidial Suspension ◽

Cultivated Rice ◽

First Report ◽

Brown Leaf Spot ◽

White Leaf ◽

Brown Leaf

White leaf streak, caused by Mycovellosiella oryzae (Deighton and Shaw) Deighton (syn. Ramularia oryzae), was found in Louisiana rice. The symptoms closely resemble those of narrow brown leaf spot caused by Cercospora janseana (Racib.) O. Const. (syn. C. oryzae (Miyake)), and it is difficult to distinguish between these two diseases. Initially both produce similar elongated light brown lesions, but later the lesions of white leaf streak become wider with a whitish center and are surrounded by a narrow light brown margin (2,3). The disease was first observed at the Rice Research Station, Crowley, LA, in 1996 on older leaves of the cultivar Lemont at maturity. Leaves containing the unusual lesion types were placed in a moist chamber and incubated at 28°C for 5 days. Abundant conidia were produced and the fungus was isolated on acidified potato dextrose agar (APDA) by single spore isolation and by plating infected tissues after surface sterilization in 40% Clorox for 10 to 15 min. The colonies grew slowly on APDA and were dark gray in color. The conidia formed in branched chains or singly. They were hyaline, cylindrical with tapering ends and a thick hilum; 0 to 3 septate, and 15 to 35 m long (1,3). Pathogenicity tests were conducted in the greenhouse on the Lemont and Cypress rice cultivars by spraying a conidial suspension (103–4 conidia per ml) onto leaf blades at boot stage. Conidia were produced by growing the fungus on PDA for 10 to 14 days. Inoculated plants were placed inside a humid chamber in a greenhouse and maintained for 4 to 5 weeks. Many elongated lesions similar to those observed in the field were produced 3 to 4 weeks after inoculation. Reisolation from these lesions yielded M. oryzae. With the same methods, 45 cultivars and lines were inoculated to determine their reactions to this disease. Most of the cultivars grown in the southern United States were moderately susceptible or susceptible to white leaf streak. Foreign cultivars tested, including BR-7, BR-11, Cica-4, Cica-6, Cica-7. Cica-8, Cica-9, Oryzica llanos, Rax clear, Teqing, and Tetep, were resistant. In 1997, the disease was found prevalent on many cultivars grown at the Rice Research Station, Crowley, LA. As symptoms of both white leaf streak and narrow brown leaf spot were sometimes observed on the same leaf; it is possible that the disease has been present, but not identified as a separate disease because of the similarity of the symptoms of the two diseases. A thorough survey is necessary to determine the extent of its occurrence and further studies are necessary to determine its yield loss potential. At present it appears to be a minor problem for Louisiana rice. White leaf streak has previously been recorded from Papua New Guinea on cultivated Oryza sativa, and from the Solomon Islands, Sabah, Nizeria, and Sierra Leone on cultivated O. glabberima Steudel and on wild perennial rice O. berthii A. Chev. (2). This is the first report of white leaf streak on cultivated rice in the United States. References: (1) F. C. Deighton. Mycol. Pap., CMI 144:1,1979. (2) F. C. Deighton and D. Shaw. Trans. Br. Mycol. Soc. 43: 515, 1960. (3) B. C. Sutton and A. K. M. Shahjahan. Nova Hedwigia 25:197, 1981.

Download Full-text

First Report of Alternaria Leaf Spot of Banana Caused by Alternaria alternata in the United States

Plant Disease ◽

10.1094/pdis-01-13-0007-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1116-1116 ◽

Cited By ~ 3

Author(s):

V. Parkunan ◽

S. Li ◽

E. G. Fonsah ◽

P. Ji

Keyword(s):

United States ◽

Alternaria Alternata ◽

Leaf Spot ◽

Morphological Characteristics ◽

The United States ◽

Its Sequencing ◽

Single Spore ◽

First Report ◽

Alternaria Leaf Spot ◽

Leaf Spots

Research efforts were initiated in 2003 to identify and introduce banana (Musa spp.) cultivars suitable for production in Georgia (1). Selected cultivars have been evaluated since 2009 in Tifton Banana Garden, Tifton, GA, comprising of cold hardy, short cycle, and ornamental types. In spring and summer of 2012, 7 out of 13 cultivars (African Red, Blue Torres Island, Cacambou, Chinese Cavendish, Novaria, Raja Puri, and Veinte Cohol) showed tiny, oval (0.5 to 1.0 mm long and 0.3 to 0.9 mm wide), light to dark brown spots on the adaxial surface of the leaves. Spots were more concentrated along the midrib than the rest of the leaf and occurred on all except the newly emerged leaves. Leaf spots did not expand much in size, but the numbers approximately doubled during the season. Disease incidences on the seven cultivars ranged from 10 to 63% (10% on Blue Torres Island and 63% on Novaria), with an average of 35% when a total of 52 plants were evaluated. Six cultivars including Belle, Ice Cream, Dwarf Namwah, Kandarian, Praying Hands, and Saba did not show any spots. Tissue from infected leaves of the seven cultivars were surface sterilized with 0.5% NaOCl, plated onto potato dextrose agar (PDA) media and incubated at 25°C in the dark for 5 days. The plates were then incubated at room temperature (23 ± 2°C) under a 12-hour photoperiod for 3 days. Grayish black colonies developed from all the samples, which were further identified as Alternaria spp. based on the dark, brown, obclavate to obpyriform catenulate conidia with longitudinal and transverse septa tapering to a prominent beak attached in chains on a simple and short conidiophore (2). Conidia were 23 to 73 μm long and 15 to 35 μm wide, with a beak length of 5 to 10 μm, and had 3 to 6 transverse and 0 to 5 longitudinal septa. Single spore cultures of four isolates from four different cultivars were obtained and genomic DNA was extracted and the internal transcribed spacer (ITS1-5.8S-ITS2) regions of rDNA (562 bp) were amplified and sequenced with primers ITS1 and ITS4. MegaBLAST analysis of the four sequences showed that they were 100% identical to two Alternaria alternata isolates (GQ916545 and GQ169766). ITS sequence of a representative isolate VCT1FT1 from cv. Veinte Cohol was submitted to GenBank (JX985742). Pathogenicity assay was conducted using 1-month-old banana plants (cv. Veinte Cohol) grown in pots under greenhouse conditions (25 to 27°C). Three plants were spray inoculated with the isolate VCT1FT1 (100 ml suspension per plant containing 105 spores per ml) and incubated under 100% humidity for 2 days and then kept in the greenhouse. Three plants sprayed with water were used as a control. Leaf spots identical to those observed in the field were developed in a week on the inoculated plants but not on the non-inoculated control. The fungus was reisolated from the inoculated plants and the identity was confirmed by morphological characteristics and ITS sequencing. To our knowledge, this is the first report of Alternaria leaf spot caused by A. alternata on banana in the United States. Occurrence of the disease on some banana cultivars in Georgia provides useful information to potential producers, and the cultivars that were observed to be resistant to the disease may be more suitable for production. References: (1) E. G. Fonsah et al. J. Food Distrib. Res. 37:2, 2006. (2) E. G. Simmons. Alternaria: An identification manual. CBS Fungal Biodiversity Center, Utrecht, Netherlands, 2007.

Download Full-text

First Report of Leaf Spot of Rudbeckia hirta var. pulcherrima Caused by Septoria rudbeckiae in Korea

Plant Disease ◽

10.1094/pdis-02-12-0172-pdn ◽

2012 ◽

Vol 96 (6) ◽

pp. 911-911 ◽

Cited By ~ 1

Author(s):

J. H. Park ◽

S. E. Cho ◽

K. S. Han ◽

H. D. Shin

Keyword(s):

Leaf Spot ◽

The United States ◽

Flowering Plant ◽

Leaf Spot Disease ◽

Morphological Identification ◽

Its Sequence ◽

Conidial Suspension ◽

First Report ◽

Rudbeckia Hirta ◽

Close Phylogenetic Relationship

Rudbeckia hirta L. var. pulcherrima Farw. (synonym R. bicolor Nutt.), known as the black-eyed Susan, is a flowering plant belonging to the family Asteraceae. The plant is native to North America and was introduced to Korea for ornamental purposes in the 1950s. In July 2011, a previously unknown leaf spot was first observed on the plants in a public garden in Namyangju, Korea. Leaf spot symptoms developed from lower leaves as small, blackish brown lesions, which enlarged to 6 mm in diameter. In the later stages of disease development, each lesion was usually surrounded with a yellow halo, detracting from the beauty of the green leaves of the plant. A number of black pycnidia were present in diseased leaf tissue. Later, the disease was observed in several locations in Korea, including Pyeongchang, Hoengseong, and Yangpyeong. Voucher specimens were deposited at the Korea University Herbarium (KUS-F25894 and KUS-F26180). An isolate was obtained from KUS-F26180 and deposited at the Korean Agricultural Culture Collection (Accession No. KACC46694). Pycnidia were amphigenous, but mostly hypogenous, scattered, dark brown-to-rusty brown, globose, embedded in host tissue or partly erumpent, 50 to 80 μm in diameter, with ostioles 15 to 25 μm in diameter. Conidia were substraight to mildly curved, guttulate, hyaline, 25 to 50 × 1.5 to 2.5 μm, and one- to three-septate. Based on the morphological characteristics, the fungus was consistent with Septoria rudbeckiae Ellis & Halst. (1,3,4). Morphological identification of the fungus was confirmed by molecular data. Genomic DNA was extracted using the DNeasy Plant Mini DNA Extraction Kit (Qiagen Inc., Valencia, CA.). The internal transcribed spacer (ITS) region of rDNA was amplified using the ITS1/ITS4 primers and sequenced. The resulting sequence of 528 bp was deposited in GenBank (Accession No. JQ677043). A BLAST search showed that there was no matching sequence of S. rudbeckiae; therefore, this is the first ITS sequence of the species submitted to GenBank. The ITS sequence showed >99% similarity with those of many Septoria species, indicating their close phylogenetic relationship. Pathogenicity was tested by spraying leaves of three potted young plants with a conidial suspension (2 × 105 conidia/ml), which was harvested from a 4-week-old culture on potato dextrose agar. Control leaves were sprayed with sterile water. The plants were covered with plastic bags to maintain 100% relative humidity (RH) for the first 24 h. Plants were then maintained in a greenhouse (22 to 28°C and 70 to 80% RH). After 5 days, leaf spot symptoms identical to those observed in the field started to develop on the leaves inoculated with the fungus. No symptoms were observed on control plants. S. rudbeckiae was reisolated from the lesions of inoculated plants, confirming Koch's postulates. A leaf spot disease associated with S. rudbeckiae has been reported on several species of Rudbeckia in the United States, Romania, and Bulgaria (1–4). To our knowledge, this is the first report of leaf spot on R. hirta var. pulcherrima caused by S. rudbeckiae in Korea. References: (1) J. B. Ellis and B. D. Halsted. J. Mycol. 6:33, 1890. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ February 2, 2012. (3) E. Radulescu et al. Septoriozele din Romania. Ed. Acad. Rep. Soc. Romania, Bucuresti, Romania, 1973. (4) S. G. Vanev et al. Fungi Bulgaricae 3:1, 1997.

Download Full-text

First Report of Downy Mildew Caused by Plasmopara obducens on Impatiens in California

Plant Disease ◽

10.1094/pdis.2004.88.8.909b ◽

2004 ◽

Vol 88 (8) ◽

pp. 909-909 ◽

Cited By ~ 14

Author(s):

S. N. Wegulo ◽

S. T. Koike ◽

M. Vilchez ◽

P. Santos

Keyword(s):

United States ◽

Downy Mildew ◽

Disease Incidence ◽

Leaf Tissue ◽

The United States ◽

Plant Diseases ◽

Single Type ◽

First Report ◽

Commercial Grower ◽

Impatiens Walleriana

During February 2004, diseased double impatiens (Impatiens walleriana) plants were received from a commercial grower in southern California. The upper surfaces of symptomatic leaves were pale yellow with no distinct lesions. Diseased leaves later wilted, and severely affected leaves abscised from the stem. At the nursery, only double impatiens plants in the Fiesta series were infected, and some cultivars were more heavily infected than others. Disease incidence in cv. Sparkler Hot pink was nearly 100%. The interior of infected leaves was colonized by coenocytic mycelium. A conspicuous white growth was observed only on the underside of leaves. Sporangiophores were hyaline, thin walled, emergent from stomata, and had slightly swollen bases. Sporangiophore branching was distinctly monopodial. Smaller sporangiophore branches were arranged at right angles to the supporting branches, and tips of branches measured 8 to 14 μm long. Sporangia were ovoid and hyaline with a single pore on the distal ends. Distal ends of sporangia were predominantly flat but occasionally had a slight papilla. Short pedicels were present on the attached ends. Sporangia measured 19.4 to 22.2 (-25.0) μm × 13.9 to 16.7 (-19.4) μm. Oospores were not observed in leaf tissue. On the basis of symptoms and morphology of the organism, the pathogen was identified as Plasmopara obducens J. Schröt. Pathogenicity tests were done on double type cvs. Fiesta, Tioga Red, and Tioga Cherry Red and on single type cvs. Cajun Watermelon and Accent Lilac. Plants were spray inoculated with sporangiospore suspensions (1 × 104 sporangiospores per milliliter), incubated for 24 h in a dew chamber (18 to 20°C), and then maintained in a greenhouse (22 to 24°C). Symptoms and signs of downy mildew developed after 12 days only on inoculated cv. Fiesta plants, and the pathogen morphology matched that of the originally observed pathogen. Nontreated control plants did not develop downy mildew. To our knowledge, this is the first report of downy mildew on impatiens in California. P. obducens is one of two causal agents of downy mildew of impatiens (2,4). The other pathogen, Bremiella sphaerosperma, has dichotomous sporangiophore branching and causes lesions with well-defined margins (2,4). In the United States, the disease has been recorded in the eastern and northeastern states and in Indiana, Minnesota, Mississippi, Montana, and Wisconsin (3). In Canada, the disease has been recorded in Manitoba and Quebec (1). References: (1) I. L. Conners. An Annotated Index of Plant Diseases in Canada and Fungi Recorded on Plants in Alaska, Canada, and Greenland. Research Branch, Canada Department of Agriculture, Publication 1251, 1967. (2) O. Constantinescu. Mycologia 83:473, 1991. (3) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, 1989. (4) G. W. Wilson. Bull. Torrey Bot. Club 34:387, 1907.

Download Full-text