First Report of Ascochyta Leaf Spot of Quinoa Caused by Ascochyta sp. in the United States

The Andean crop quinoa (Chenopodium quinoa Willd.), an amaranthaceous pseudograin, is an important food and export crop for this region. Quinoa is susceptible to Ascochyta leaf spot reportedly caused by Ascochyta hyalospora and/or A. caulina (1,2), and quinoa seeds can be infested by A. hyalospora (3). Quinoa fields were established in Pennsylvania during summer 2011. Widespread leafspot symptoms were observed on quinoa in mid-August 2011 in Centre County, PA. Tan to reddish-brown, irregularly shaped lesions were observed with numerous black pycnidia randomly distributed within each lesion. Crushed pycnidia revealed sub-hyaline to light brown, 1 to 2, or less often 3 septate, cylindrical to ovoid spores, 13 to 25 μm long by 5 to 10 μm wide. Pure cultures of Ascochyta were obtained by plating pycnidia from surface disinfested leaves onto half strength acidified potato dextrose agar (APDA). To obtain conidia for pathogenicity trials, cultures were transferred to oatmeal agar and placed in a 20°C incubator with a 12-h photoperiod. Conidia were harvested by scraping 2-week-old cultures. The conidial suspension was filtered through cheesecloth and adjusted to 1.8 × 105 conidia/mL. Tween 20 (0.1%) was added to the final inoculum and sprayed (with a Crown Spra-tool) onto ten 1-month old quinoa plants. Six plants sprayed with sterile water with 0.1% Tween 20 served as controls. Plants were placed in a growth chamber and bagged for 48 h to maintain >95% humidity. After 48 h, tan, irregularly shaped lesions were observed on inoculated plants, but no symptoms were observed on control plants. Plants were grown for 2 more weeks to observe symptom development, and then leaves with characteristic lesions were collected for isolation. Symptomatic leaves were surface disinfested in 10% bleach for 1 min and tissue from the lesion periphery was plated onto APDA. Obtained cultures were morphologically and molecularly identical to those obtained from quinoa fields. For molecular identification of the pathogen, DNA was extracted from cultures of Ascochyta and amplified using ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) primers. Sequences obtained shared 99% maximum identity with a GenBank accession of A. obiones (GU230752.1), a species closely related to A. hyalospora and A. caulina (4). However, the obtained pathogen is morphologically more similar to A. hyalospora and A. chenopodii, but not to A. caulina or A. obiones. At this time, final species identification is impossible because no GenBank sequence data is available for A. hyalospora or A. chenopodii. To our knowledge, this is the first report of Ascochyta leaf spot of quinoa in the United States. The impact of Ascochyta leaf spot on domestic and global quinoa production is unknown, but management of foliar diseases of quinoa, including Ascochyta leaf spot, is a critical component of any disease management program for quinoa. References: (1) S. Danielsen. Food Rev. Int. 19:43, 2003. (2) M. Drimalkova. Plant Protect. Sci. 39:146, 2003. (3) G. Boerema. Neth. J. Plant. Pathol. 83:153, 1977. (4) J. de Gruyter. Stud. Mycol. 75:1, 2012.

Download Full-text

First Report of Alternaria alternata f. sp. cucurbitae Causing Alternaria Leaf Spot of Melon in the Mid-Atlantic Region of the United States

Plant Disease ◽

10.1094/pdis-92-4-0652b ◽

2008 ◽

Vol 92 (4) ◽

pp. 652-652 ◽

Cited By ~ 2

Author(s):

X. G. Zhou ◽

K. L. Everts

Keyword(s):

United States ◽

Disease Severity ◽

Body Length ◽

Alternaria Alternata ◽

Leaf Spot ◽

The United States ◽

Tween 20 ◽

Conidial Suspension ◽

First Report ◽

Alternaria Leaf Spot

Alternaria alternata f. sp. cucurbitae, the casual agent of Alternaria leaf spot, was first described in Greece where it caused severe losses to greenhouse-grown cucumbers (Cucumis sativus) (3,4). The fungus also attacks melon (C. melo) and watermelon (Citrullus lanatus) (1–3). In late June of 2006, following a period of windy and rainy days, numerous dark brown, circular lesions, 0.5 to 1 mm in diameter, were observed on leaves of melons in a field in Wicomico County, Maryland. The lesions gradually enlarged and coalesced into large, nearly circular, or irregularly shaped lesions that could be as long as 3 cm. The center of the lesions was light tan, surrounded by a dark brown ring and a chlorotic halo, and tended to split in the later development stages. Most of the lesions appeared on the edge of the leaves and no lesions developed on the stems and fruit. Lesions first started on old leaves and then developed on leaves in the middle part of the canopy. Leaf lesions were observed on melon cvs. Ananas, Honeydew Greenflesh, and Israeli. Disease severity ranged from 3 to 20% of the leaf area affected. Small pieces (3 × 3 mm) of tissue removed from the margin between healthy and diseased tissue were surface disinfected in 0.5% NaOCl for 2 min and plated on acidified, ¼-strength potato dextrose agar. Isolations made from diseased tissue frequently (61%) yielded fungal colonies with morphological features and spore dimensions that were consistent with the description of A. alternata f. sp. cucurbitae (1,3). Fungal isolates were characterized by small, short-beaked, multicellular conidia. Conidia were ovoid, obclavate, and sometimes ellipsoidal with the average overall body length of 39 μm (range, 17 to 80 μm) and width of 14 μm (range, 7 to 20 μm). Conidia were produced on short conidiophores in chains. The beaks were short (often less than one-third the body length) and conical or cylindrical. Pathogenicity of six single-spore isolates was determined on four melon cultivars (Honeydew Greenflesh, Israeli, Tam Dew, and Topmark) and one watermelon cultivar (Sugar Baby) in a greenhouse. Twenty plants of each cultivar at the one-true-leaf stage were sprayed with a conidial suspension (106 conidia/ml) of each isolate amended with 0.1% (vol/vol) of Tween 20 until runoff (1.5 to 2 ml per plant). Inoculation with sterile distilled water amended with 0.1% Tween 20 served as controls. The plants were placed in a dew growth chamber for 48 h at 24°C and subsequently maintained in a greenhouse at 21 to 29°C. At 4 to 5 days after inoculation, each isolate induced leaf lesions on each inoculated cultivar similar to typical lesions observed in the field. There was no significant difference in disease severity among the cultivars tested or between melon and watermelon. Control plants remained symptomless. The fungus was readily reisolated from symptomatic tissues. To our knowledge, this is the first report of A. alternata f. sp. cucurbitae causing Alternaria leaf spot of melon in the Mid-Atlantic United States and the only report outside Georgia in the southern region of the United States (D. B. Langston, personal communication) and Greece. References: (1) D. L. Vakalounakis. Plant Dis. 74:227, 1990. (2) D. L. Vakalounakis. Ann. Appl. Biol. 117:507, 1990. (3) D. L. Vakalounakis. Alternaria leaf spot. Page 24 in: Compendium of Cucurbit Diseases. T. A. Zitter et al., eds. The American Phytopathological Society, St. Paul, MN, 1996. (4) D. L. Vakalounakis and N. E. Malathrakis. J. Phytopathol. 121:325, 1988.

Download Full-text

First Report of Passalora Leaf Spot of Quinoa Caused by Passalora dubia in the United States

Plant Disease ◽

10.1094/pdis-05-12-0472-pdn ◽

2013 ◽

Vol 97 (1) ◽

pp. 139-139 ◽

Cited By ~ 3

Author(s):

A. L. Testen ◽

J. M. McKemy ◽

P. A. Backman

Keyword(s):

United States ◽

Leaf Spot ◽

Biological Control Agent ◽

Chenopodium Quinoa ◽

Its Region ◽

The United States ◽

Tween 20 ◽

Potato Dextrose Broth ◽

First Report ◽

Rainy Period

The Andean seed crop quinoa, Chenopodium quinoa Willd., is an important export of Bolivia, Ecuador, and Peru. Key foliar diseases of quinoa include quinoa downy mildew (caused by Peronospora variabilis Gäum) (1), Ascochyta leaf spot (caused by Ascochyta sp.) (1), and a Cercospora-like leaf spot, the latter of which has been observed on cultivated quinoa (Jose B. Ochoa, unpublished) and native Chenopodium species. Passalora dubia (Riess) U. Braun (syn. Cercospora dubia) was tested in Europe as a biological control agent for Chenopodium album (3) and has been reported on C. album in the United States (U.S. National Fungus Collections). Quinoa field plots were established in Pennsylvania during summer 2011 and Cercospora-like leaf spot symptoms were first observed on quinoa in Centre Co. and Lancaster Co. in August 2011, after an extended rainy period. Foliar symptoms were round to oval, brown to grey-black lesions, less than 1 cm in diameter, with darker brown, reddish margins. Similar symptoms were observed on C. album weeds within both fields. Using a hand lens, conidia were observed within sporulating lesions. Conidia were hyaline and septate, 25 to 98 μm × 5 to 10 μm, and had an average of six cells per conidium. The fungus was isolated by picking single conidia from sporulating lesions (under a dissecting scope) and incubated on V8 agar in the dark at 20°C to induce sporulation. For DNA extraction, cultures were grown in potato dextrose broth amended with yeast extract. The internal transcribed spacer (ITS) region was amplified using primers ITS4 and ITS5 (2), and the resulting sequence shared 99% maximum identity with a vouchered isolate of P. dubia (GenBank EF535655). To test the pathogenicity of our P. dubia isolate, 5.9 × 103 conidia/ml (suspended in sterile water with 0.1% Tween 20) or the control solution with no conidia were sprayed, using an atomizer, onto 2-month-old quinoa plants, with 18 replications per treatment. Plants were covered with a humidity dome and maintained at >99% RH for 48 h. Plants were grown in the greenhouse at approximately 65% RH. After 1 month, circular to oval light brown lesions (<1 cm diameter) with darker margins were observed on approximately 10% of the leaves of inoculated plants, whereas no symptoms were observed on the control plants. Infected leaves were collected, incubated in a humidity chamber, and conidia were picked from sporulating lesions and inoculated onto V8 agar amended with 3% (w/v) fresh, ground quinoa plant tissue (4). Cultures were maintained at 20°C with 16-h photoperiod to induce sporulation. The identity of the reisolated fungus was confirmed morphologically and by DNA sequencing to be identical to the isolate used to test Koch's postulates. P. dubia was also isolated from C. album lesions and infected C. album may have served as a source of inoculum for quinoa. To our knowledge, this is the first report of Passalora leaf spot of quinoa in the United States. References: (1) S. Danielsen. Food Rev. Int. 19:43, 2003. (2) S. Goodwin et al. Phytopathology 91:648, 2001. (3) P. Scheepens et al. Integ. Pest. Man. Rev. 2:71, 1997. (4) M. Vathakos. Phytopathology 69:832, 1979.

Download Full-text

First Report of Myrothecium roridum Causing Myrothecium Leaf Spot on Salvia spp. in the United States

Plant Disease ◽

10.1094/pdis-91-6-0772b ◽

2007 ◽

Vol 91 (6) ◽

pp. 772-772 ◽

Cited By ~ 7

Author(s):

J. A. Mangandi ◽

T. E. Seijo ◽

N. A. Peres

Keyword(s):

United States ◽

Leaf Spot ◽

Pathogenic Fungi ◽

Lower Surface ◽

The United States ◽

Plant Diseases ◽

Control Measures ◽

Conidial Suspension ◽

First Report ◽

Myrothecium Roridum

The genus Salvia includes at least 900 species distributed worldwide. Wild species are found in South America, southern Europe, northern Africa, and North America. Salvia, commonly referred to as sage, is grown commercially as a landscape plant. In August 2006, pale-to-dark brown, circular leaf spots 5 to 20 mm in diameter with concentric rings were observed on Salvia farinacea ‘Victoria Blue’. Approximately 5% of the plants in a central Florida nursery were affected. Lesions were visible on both leaf surfaces, and black sporodochia with white, marginal hyphal tuffs were present mostly on the lower surface in older lesions. Symptoms were consistent with those of Myrothecium leaf spot described on other ornamentals such as gardenia, begonia, and New Guinea impatiens (4). Isolations from lesions on potato dextrose agar produced white, floccose colonies with sporodochia in dark green-to-black concentric rings. Conidia were hyaline and cylindrical with rounded ends and averaged 7.4 × 2.0 μm. All characteristics were consistent with the description of Myrothecium roridum Tode ex Fr. (2,3). The internal transcribed spacer regions ITS1, ITS2, and the 5.8s rRNA genomic region of one isolate were sequenced (Accession No. EF151002) and compared with sequences in the National Center for Biotechnology Information (NCBI) database. Deposited sequences from M. roridum were 96.3 to 98.8% homologous to the isolate from salvia. To confirm pathogenicity, three salvia plants were inoculated by spraying with a conidial suspension of M. roridum (1 × 105 conidia per ml). Plants were covered with plastic bags and incubated in a growth chamber at 28°C for 7 days. Three plants were sprayed with sterile, distilled water as a control and incubated similarly. The symptoms described above were observed in all inoculated plants after 7 days, while control plants remained symptomless. M. roridum was reisolated consistently from symptomatic tissue. There are more than 150 hosts of M. roridum, including one report on Salvia spp. in Brunei (1). To our knowledge, this is the first report of Myrothecium leaf spot caused by M. roridum on Salvia spp. in the United States. Even the moderate level disease present caused damage to the foliage and reduced the marketability of salvia plants. Therefore, control measures may need to be implemented for production of this species in ornamental nurseries. References: (1) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory. Online publication. ARS, USDA, 2006, (2) M. B. Ellis. Page 449 in: Microfungi on Land Plants: An Identification Handbook. Macmillan Publishing, NY, 1985. (3) M. Fitton and P. Holliday. No. 253 in: CMI Descriptions of Pathogenic Fungi and Bacteria. The Eastern Press Ltd. Great Britain, 1970. (4) M. G. Daughtrey et al. Page 19 in: Compendium of Flowering Potted Plant Diseases. The American Phytopathological Society. St. Paul, MN, 1995.

Download Full-text

First Report of Stemphylium globuliferum Causing Stemphylium Leaf Spot on Alfalfa (Medicago sativa) in the United States

Plant Disease ◽

10.1094/pdis-08-13-0828-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 993-993 ◽

Cited By ~ 2

Author(s):

D. A. Samac ◽

J. Willbur ◽

L. Behnken ◽

F. Brietenbach ◽

G. Blonde ◽

...

Keyword(s):

United States ◽

Medicago Sativa ◽

Leaf Spot ◽

Uv Light ◽

The United States ◽

Tween 20 ◽

Species Discrimination ◽

Cool Temperature ◽

First Report ◽

Initial Symptoms

Stemphylium leaf spot occurs in most areas where alfalfa (Medicago sativa) is grown. In the United States, Stemphylium botryosum is reported to be the predominant pathogen (1), although S. vesicarium and S. herbarum are also observed. S. alfalfae was isolated on alfalfa in Australia (4) and S. globuliferum was reported in Egypt and Korea. In April and May 2012, alfalfa plants with leaf spot symptoms were observed in Rosemount and Waseca, MN, and in Arlington, Tomah, and Waupaca, WI. Initial symptoms consisted of white to tan spots with a brown border, 2 to 3 mm in diameter, circular to oval, enlarging to 5 to 8 mm in diameter. Large lesions often coalesced. Small, narrow, brown lesions occurred on petioles. Lower killed leaves remained attached to the primary stem. Spots were larger than those caused by the cool temperature biotype of S. botryosum. Conidia formed on lesions after 48 h in a moist chamber. Conidia were removed with a fine glass rod, germinated on 1% water agar, and single hyphae transferred to V8 agar (V8A). After 2 weeks under room light, plates were placed under UV light to stimulate spore production. Conidia on host material were borne singly on straight, unbranched, smooth conidiophores, medium brown at the apex. Conidia were medium to dark brown with small papillae, subspherical with 3 to 4 transverse and 3 to 4 complete or near complete longitudinal septa, with a distinct constriction at the median transverse septum. Conidia were 27.5 to 32.5 μm long × 20 to 22.5 μm wide with a length/width (L/W) ratio of 1.2 to 1.5. Conidia on V8A were smaller, 25 to 30 μm long × 12.5 to 19 μm wide with a L/W of 1.6 to 1.8. Ascostromata 300 μm in diameter formed on leaves held at 4°C for 2 months as well as on culture plates after 1 month. Ascospores from leaves were golden brown to reddish, 40 to 42.5 × 20 μm, slightly broader in the upper half of the spore, with 7 to 8 transverse septa and one complete longitudinal septum with several incomplete septa. Ascospores from culture were smaller, 27.5 to 30 × 12.5 to 15 μm wide. These morphological features are consistent with the description for S. globuliferum (3). DNA was extracted from pure cultures of SAr301 and SWp202, isolated from plants grown in Arlington and Waupaca, respectively, and used to amplify ITS1-5.8S-ITS2 rDNA using primers ITS1 and ITS4, GPD with primers GPD1 and GPD2, EF-1α with EF446f and EF1473R, and the intergenic spacer between vmaA and vpsA with primers ATPF2 and GTP604R (2). In sequence comparisons made by BLASTn searches of GenBank, the ITS (KF479193), GPD (KF479194), and EF-1α (KF479195) sequences from S. globuliferum were different from the gene sequences of S. botryosum but identical to those from S. vesicarium, S. herbarum, and S. alfalfae. The vmaA-vpsA spacer sequence (KF479196) of S. globuliferum had 3 nucleotide differences from S. vesicarium and S. herbarum and 4 nucleotide differences from S. alfalfae, demonstrating that this sequence is useful for species discrimination. Conidia from strains SAr301 and SWp 202 were suspended at 104/ml in sterile water with 0.01% Tween 20 and used to inoculate 12 alfalfa plants using a handheld sprayer. Plants were kept at 100% RH for 48 h, then grown at 20°C with a 16-h photoperiod. After 2 weeks, lesions similar to those seen in the field were observed on leaves of all plants. Symptomatic leaves placed in moist chambers produced conidia with the size and morphology of S. globuliferum within 48 h. This is the first report to our knowledge of S. globuliferum causing disease on alfalfa in the United States. Cultures were deposited in the University of Minnesota Mycological Culture Collection. References: (1) W. A. Cowling et al. Phytopathology 71:679, 1981. (2) P. Inderbitzin et al. Mycologia 101:320, 2009. (3) E. G. Simmons. Mycologia 61:1, 1969. (4) E. G. Simmons. Sydowia 38:284, 1985.

Download Full-text

First Report of a Leaf Spot and Stem Canker Caused by Myrothecium roridum on Watermelon in the United States

Plant Disease ◽

10.1094/pd-89-0342a ◽

2005 ◽

Vol 89 (3) ◽

pp. 342-342 ◽

Cited By ~ 11

Author(s):

K. W. Seebold ◽

D. B. Langston ◽

R. C. Kemerait ◽

J. E. Hudgins

Keyword(s):

United States ◽

Leaf Spot ◽

Citrullus Lanatus ◽

Stem Canker ◽

The United States ◽

Tween 20 ◽

Conidial Suspension ◽

American Phytopathological Society ◽

Leaf Spots ◽

Myrothecium Roridum

Myrothecium roridum Tode:Fr, pathogenic to a number of cucurbit species, causes fruit rots, cankers on crowns and stems, and leaf spots. Hosts include cantaloupe and honeydew (Cucurbita melo) and cucumber (Cucumis sativus) (1,3). In June 2004, following a period of heavy rainfall, numerous round-to-oblong, brown lesions with concentric rings were observed on leaves of watermelon (Citrullus lanatus) cv. Desert King at the Blackshank Farm in Tifton, GA. Disease was localized in the field and severity was low (<5% of leaf area affected). No symptoms were observed on fruit. Sections of tissue were removed from the margin between healthy and diseased tissue and plated on acidified, 25% potato dextrose agar (aPDA). A small plug of agar and mycelium were removed from colonies that emerged from lesions and were transferred to aPDA. Isolated colonies were characterized by a white, floccose mycelium with concentric, dark green-to-black rings of sporodochia bearing viscid masses of conidia. Conidia were cylindrical with rounded ends and measured 6 to 8 × 1.5 to 2.5 μm. The features of the fungus were consistent with the description of Myrothecium roridum (1,2). Pathogenicity tests were conducted in a temperature-controlled greenhouse. Twenty-five watermelon plants (cv. Desert King) were inoculated with a conidial suspension of M. roridum (5 × 105 conidia per ml) plus 0.1% vol/vol Tween 20. Inoculum was applied on leaves and stems until runoff with a hand-held mister, and plants were placed in a dew chamber for 72 h. Ten plants were sprayed with sterile, distilled water to serve as controls. Inoculated and noninoculated control plants were removed from the dew chamber and maintained at 25 to 28°C. Symptoms appeared 8 days after inoculation and were characterized by round, dark lesions with concentric rings; noninoculated plants were symptomless. Sections of symptomatic tissue were plated, and M. roridum was reisolated. Although M. roridum is a common pathogen of melons and cucumber, to our knowledge, this is the first field report of a leaf spot caused by M. roridum on watermelon in the United States. No further occurrences of the disease on watermelon have been observed in Georgia since the initial discovery of M. roridum in 2004; however, losses could be potentially severe if widespread infection of fruit were to occur. References: (1) B. D. Bruton. Crater Rot. Pages 49–50 in: Compendium of Cucurbit Diseases. T. A. Zitter et al., eds. The American Phytopathological Society, St. Paul, MN, 1996. (2) M. B. Ellis. Page 552 in: Dematiaceous Hyphomycetes. CAB International, Wallingford, UK, 1971. (3) D. F. Farr et al. Page 809 in: Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989.

Download Full-text

First report of Curvularia lunata causing Curvularia leaf spot of corn in Delaware

Plant Disease ◽

10.1094/pdis-04-21-0742-pdn ◽

2021 ◽

Author(s):

Madeline Grace Henrickson ◽

Alyssa M Koehler

Keyword(s):

Leaf Spot ◽

The United States ◽

Reference Sequence ◽

Penicillin G ◽

Tween 20 ◽

Curvularia Lunata ◽

Conidial Suspension ◽

Sterile Water ◽

Moist Chamber ◽

First Report

In mid-August 2020, small circular tan-colored lesions were detected in leaves of corn, Zea mays, in Sussex county Delaware. Symptoms were observed in many fields, affecting multiple hybrids that were at approximately the dough growth stage (R4). Lesions were present on most plants and individual ear leaf severity ratings ranged from 3 to 14 %. Symptomatic corn leaves were selected from the field and kept in a moist chamber for 24 hrs at 25 °C. In lesions, melanized spores were observed ranging from 21.94 µm to 30.51 µm in length and 7.83µm to 11.70µm in width (n=20). One cm2 leaf sections were extracted and sterilized in a 0.85% sodium hypochlorite solution for 30s followed by a sterile water rinse for 30s. Leaf pieces were then plated onto potato dextrose agar amended with 50µg/ml penicillin-G-sodium salt and streptomycin sulfate. Petri dishes were incubated at 25 °C with a 12-hr photoperiod for 14 days. Colonies were brown-black to lighter gray in color. Media was stained from orange, to dark brown, or not at all. Conidia were melanized and curved with three transverse septa matching the size above. Colony and spore morphology were consistent with the description of Curvularia lunata (Garcia-Aroca et al. 2018). Pure cultures were obtained, and a representative isolate was sequenced to confirm fungal identity by amplifying the internal transcribed spacer (ITS) region with primers ITS4 and ITS5. BLAST search results confirmed 100% similarity (483/531 bp) to the C. lunata reference sequence (MK623264). The sequence was deposited in GenBank as accession number MW794323. To complete Koch’s postulates, corn (hybrid: Hubner H6187RCSS) was planted into 10 cm pots and maintained at 25°C and a 12 hr photoperiod. A conidial suspension was made by soaking a Petri dish of a 3-week-old fungal colony with 20 ml of sterile water and a drop of Tween-20 solution then, scraping mycelia to dislodge spores. The conidial concentration was calibrated to 5 x 105 spores/ml and 15 ml were applied to each whorl of four three-collar stage plants using a Preval sprayer (Nakoma Products, Bridgeview, IL). Four plants were inoculated with 15 ml sterile DI water as a control. This experiment was repeated twice. Each plant was moved to an incubator and covered with a plastic bag for 24 hr to maintain humidity. Conditions in the incubator were maintained at 25 °C with a 12-hr photoperiod. Inoculated plants displayed small, oval-shaped lesions within four days. No symptoms were observed on the control plants. Symptomatic leaves were harvested and placed into a moist chamber for 24 hrs to sporulate and lesions were plated onto PDA as described above. Culture morphology was consistent with the original isolate, with spores slightly larger ranging from 22.35 µm to 39.29 µm in length, and 8.36 µm to 11.69 µm in width (n=20). Isolates obtained from inoculated plants were sequenced and maintained 100% identity with the reference sequence described above. C. lunata was first reported in Louisiana in 2017 (Garcia-Aroca et al. 2018) and in Kentucky in 2018 (Anderson et al. 2019). This is the first report of Curvularia leaf spot on corn in Delaware. Symptoms developed late in the season, so it is unlikely that yield was affected in 2020. However, the economic impact of this disease in the United States is still unclear, it will be important to monitor potential impacts of this disease in Delaware corn production. References 1.Anderson NR, et al., 2019, Plant Disease, 103, 2692, doi: 0.1094/PDIS-03-19-0629-PDN. 2. Garcia-Aroca T, et al., 2018, Plant health progress, 19, 140, doi: 10.1094/PHP-02-18-0008-BR.

Download Full-text

First Report of the Occurrence of White Leaf Streak in Louisiana Rice

Plant Disease ◽

10.1094/pdis.1998.82.11.1282c ◽

1998 ◽

Vol 82 (11) ◽

pp. 1282-1282 ◽

Cited By ~ 1

Author(s):

A. K. M. Shahjahan ◽

M. C. Rush ◽

J. P. Jones ◽

D. E. Groth

Keyword(s):

United States ◽

Leaf Spot ◽

The United States ◽

Research Station ◽

Conidial Suspension ◽

Cultivated Rice ◽

First Report ◽

Brown Leaf Spot ◽

White Leaf ◽

Brown Leaf

White leaf streak, caused by Mycovellosiella oryzae (Deighton and Shaw) Deighton (syn. Ramularia oryzae), was found in Louisiana rice. The symptoms closely resemble those of narrow brown leaf spot caused by Cercospora janseana (Racib.) O. Const. (syn. C. oryzae (Miyake)), and it is difficult to distinguish between these two diseases. Initially both produce similar elongated light brown lesions, but later the lesions of white leaf streak become wider with a whitish center and are surrounded by a narrow light brown margin (2,3). The disease was first observed at the Rice Research Station, Crowley, LA, in 1996 on older leaves of the cultivar Lemont at maturity. Leaves containing the unusual lesion types were placed in a moist chamber and incubated at 28°C for 5 days. Abundant conidia were produced and the fungus was isolated on acidified potato dextrose agar (APDA) by single spore isolation and by plating infected tissues after surface sterilization in 40% Clorox for 10 to 15 min. The colonies grew slowly on APDA and were dark gray in color. The conidia formed in branched chains or singly. They were hyaline, cylindrical with tapering ends and a thick hilum; 0 to 3 septate, and 15 to 35 m long (1,3). Pathogenicity tests were conducted in the greenhouse on the Lemont and Cypress rice cultivars by spraying a conidial suspension (103–4 conidia per ml) onto leaf blades at boot stage. Conidia were produced by growing the fungus on PDA for 10 to 14 days. Inoculated plants were placed inside a humid chamber in a greenhouse and maintained for 4 to 5 weeks. Many elongated lesions similar to those observed in the field were produced 3 to 4 weeks after inoculation. Reisolation from these lesions yielded M. oryzae. With the same methods, 45 cultivars and lines were inoculated to determine their reactions to this disease. Most of the cultivars grown in the southern United States were moderately susceptible or susceptible to white leaf streak. Foreign cultivars tested, including BR-7, BR-11, Cica-4, Cica-6, Cica-7. Cica-8, Cica-9, Oryzica llanos, Rax clear, Teqing, and Tetep, were resistant. In 1997, the disease was found prevalent on many cultivars grown at the Rice Research Station, Crowley, LA. As symptoms of both white leaf streak and narrow brown leaf spot were sometimes observed on the same leaf; it is possible that the disease has been present, but not identified as a separate disease because of the similarity of the symptoms of the two diseases. A thorough survey is necessary to determine the extent of its occurrence and further studies are necessary to determine its yield loss potential. At present it appears to be a minor problem for Louisiana rice. White leaf streak has previously been recorded from Papua New Guinea on cultivated Oryza sativa, and from the Solomon Islands, Sabah, Nizeria, and Sierra Leone on cultivated O. glabberima Steudel and on wild perennial rice O. berthii A. Chev. (2). This is the first report of white leaf streak on cultivated rice in the United States. References: (1) F. C. Deighton. Mycol. Pap., CMI 144:1,1979. (2) F. C. Deighton and D. Shaw. Trans. Br. Mycol. Soc. 43: 515, 1960. (3) B. C. Sutton and A. K. M. Shahjahan. Nova Hedwigia 25:197, 1981.

Download Full-text

First Report of Alternaria Leaf Spot of Banana Caused by Alternaria alternata in the United States

Plant Disease ◽

10.1094/pdis-01-13-0007-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1116-1116 ◽

Cited By ~ 3

Author(s):

V. Parkunan ◽

S. Li ◽

E. G. Fonsah ◽

P. Ji

Keyword(s):

United States ◽

Alternaria Alternata ◽

Leaf Spot ◽

Morphological Characteristics ◽

The United States ◽

Its Sequencing ◽

Single Spore ◽

First Report ◽

Alternaria Leaf Spot ◽

Leaf Spots

Research efforts were initiated in 2003 to identify and introduce banana (Musa spp.) cultivars suitable for production in Georgia (1). Selected cultivars have been evaluated since 2009 in Tifton Banana Garden, Tifton, GA, comprising of cold hardy, short cycle, and ornamental types. In spring and summer of 2012, 7 out of 13 cultivars (African Red, Blue Torres Island, Cacambou, Chinese Cavendish, Novaria, Raja Puri, and Veinte Cohol) showed tiny, oval (0.5 to 1.0 mm long and 0.3 to 0.9 mm wide), light to dark brown spots on the adaxial surface of the leaves. Spots were more concentrated along the midrib than the rest of the leaf and occurred on all except the newly emerged leaves. Leaf spots did not expand much in size, but the numbers approximately doubled during the season. Disease incidences on the seven cultivars ranged from 10 to 63% (10% on Blue Torres Island and 63% on Novaria), with an average of 35% when a total of 52 plants were evaluated. Six cultivars including Belle, Ice Cream, Dwarf Namwah, Kandarian, Praying Hands, and Saba did not show any spots. Tissue from infected leaves of the seven cultivars were surface sterilized with 0.5% NaOCl, plated onto potato dextrose agar (PDA) media and incubated at 25°C in the dark for 5 days. The plates were then incubated at room temperature (23 ± 2°C) under a 12-hour photoperiod for 3 days. Grayish black colonies developed from all the samples, which were further identified as Alternaria spp. based on the dark, brown, obclavate to obpyriform catenulate conidia with longitudinal and transverse septa tapering to a prominent beak attached in chains on a simple and short conidiophore (2). Conidia were 23 to 73 μm long and 15 to 35 μm wide, with a beak length of 5 to 10 μm, and had 3 to 6 transverse and 0 to 5 longitudinal septa. Single spore cultures of four isolates from four different cultivars were obtained and genomic DNA was extracted and the internal transcribed spacer (ITS1-5.8S-ITS2) regions of rDNA (562 bp) were amplified and sequenced with primers ITS1 and ITS4. MegaBLAST analysis of the four sequences showed that they were 100% identical to two Alternaria alternata isolates (GQ916545 and GQ169766). ITS sequence of a representative isolate VCT1FT1 from cv. Veinte Cohol was submitted to GenBank (JX985742). Pathogenicity assay was conducted using 1-month-old banana plants (cv. Veinte Cohol) grown in pots under greenhouse conditions (25 to 27°C). Three plants were spray inoculated with the isolate VCT1FT1 (100 ml suspension per plant containing 105 spores per ml) and incubated under 100% humidity for 2 days and then kept in the greenhouse. Three plants sprayed with water were used as a control. Leaf spots identical to those observed in the field were developed in a week on the inoculated plants but not on the non-inoculated control. The fungus was reisolated from the inoculated plants and the identity was confirmed by morphological characteristics and ITS sequencing. To our knowledge, this is the first report of Alternaria leaf spot caused by A. alternata on banana in the United States. Occurrence of the disease on some banana cultivars in Georgia provides useful information to potential producers, and the cultivars that were observed to be resistant to the disease may be more suitable for production. References: (1) E. G. Fonsah et al. J. Food Distrib. Res. 37:2, 2006. (2) E. G. Simmons. Alternaria: An identification manual. CBS Fungal Biodiversity Center, Utrecht, Netherlands, 2007.

Download Full-text

First Report of a Leaf Spot Disease of Bells-of-Ireland (Moluccella laevis) Caused by Cercospora apii in California

Plant Disease ◽

10.1094/pdis.2003.87.2.203a ◽

2003 ◽

Vol 87 (2) ◽

pp. 203-203

Author(s):

S. T. Koike ◽

S. A. Tjosvold ◽

J. Z. Groenewald ◽

P. W. Crous

Keyword(s):

Leaf Spot ◽

Sequence Data ◽

Disease Incidence ◽

Leaf Spot Disease ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

First Report ◽

Spot Disease ◽

Leaf Spots ◽

Initial Symptoms

Bells-of-Ireland (Moluccella laevis) (Lamiaceae) is an annual plant that is field planted in coastal California (Santa Cruz County) for commercial cutflower production. In 2001, a new leaf spot disease was found in these commercially grown cutflowers. The disease was most serious in the winter-grown crops in 2001 and 2002, with a few plantings having as much as 100% disease incidence. All other plantings that were surveyed during this time had at least 50% disease. Initial symptoms consisted of gray-green leaf spots. Spots were generally oval in shape, often delimited by the major leaf veins, and later turned tan. Lesions were apparent on both adaxial and abaxial sides of the leaves. A cercosporoid fungus having fasciculate conidiophores, which formed primarily on the abaxial leaf surface, was consistently associated with the spots. Based on morphology and its host, this fungus was initially considered to be Cercospora molucellae Bremer & Petr., which was previously reported on leaves of M. laevis in Turkey (1). However, sequence data obtained from the internal transcribed spacer region (ITS1, ITS2) and the 5.8S gene (STE-U 5110, 5111; GenBank Accession Nos. AY156918 and AY156919) indicated there were no base pair differences between the bells-of-Ireland isolates from California, our own reference isolates of C. apii, as well as GenBank sequences deposited as C. apii. Based on these data, the fungus was subsequently identified as C. apii sensu lato. Pathogenicity was confirmed by spraying a conidial suspension (1.0 × 105 conidia/ml) on leaves of potted bells-of-Ireland plants, incubating the plants in a dew chamber for 24 h, and maintaining them in a greenhouse (23 to 25°C). After 2 weeks, all inoculated plants developed leaf spots that were identical to those observed in the field. C. apii was again associated with all leaf spots. Control plants, which were treated with water, did not develop any symptoms. The test was repeated and the results were similar. To our knowledge this is the first report of C. apii as a pathogen of bells-of-Ireland in California. Reference: (1) C. Chupp. A Monograph of the Fungus Genus Cercospora. Cornell University Press, Ithaca, New York, 1954.

Download Full-text

First Report of Leaf Spot of Rudbeckia hirta var. pulcherrima Caused by Septoria rudbeckiae in Korea

Plant Disease ◽

10.1094/pdis-02-12-0172-pdn ◽

2012 ◽

Vol 96 (6) ◽

pp. 911-911 ◽

Cited By ~ 1

Author(s):

J. H. Park ◽

S. E. Cho ◽

K. S. Han ◽

H. D. Shin

Keyword(s):

Leaf Spot ◽

The United States ◽

Flowering Plant ◽

Leaf Spot Disease ◽

Morphological Identification ◽

Its Sequence ◽

Conidial Suspension ◽

First Report ◽

Rudbeckia Hirta ◽

Close Phylogenetic Relationship

Rudbeckia hirta L. var. pulcherrima Farw. (synonym R. bicolor Nutt.), known as the black-eyed Susan, is a flowering plant belonging to the family Asteraceae. The plant is native to North America and was introduced to Korea for ornamental purposes in the 1950s. In July 2011, a previously unknown leaf spot was first observed on the plants in a public garden in Namyangju, Korea. Leaf spot symptoms developed from lower leaves as small, blackish brown lesions, which enlarged to 6 mm in diameter. In the later stages of disease development, each lesion was usually surrounded with a yellow halo, detracting from the beauty of the green leaves of the plant. A number of black pycnidia were present in diseased leaf tissue. Later, the disease was observed in several locations in Korea, including Pyeongchang, Hoengseong, and Yangpyeong. Voucher specimens were deposited at the Korea University Herbarium (KUS-F25894 and KUS-F26180). An isolate was obtained from KUS-F26180 and deposited at the Korean Agricultural Culture Collection (Accession No. KACC46694). Pycnidia were amphigenous, but mostly hypogenous, scattered, dark brown-to-rusty brown, globose, embedded in host tissue or partly erumpent, 50 to 80 μm in diameter, with ostioles 15 to 25 μm in diameter. Conidia were substraight to mildly curved, guttulate, hyaline, 25 to 50 × 1.5 to 2.5 μm, and one- to three-septate. Based on the morphological characteristics, the fungus was consistent with Septoria rudbeckiae Ellis & Halst. (1,3,4). Morphological identification of the fungus was confirmed by molecular data. Genomic DNA was extracted using the DNeasy Plant Mini DNA Extraction Kit (Qiagen Inc., Valencia, CA.). The internal transcribed spacer (ITS) region of rDNA was amplified using the ITS1/ITS4 primers and sequenced. The resulting sequence of 528 bp was deposited in GenBank (Accession No. JQ677043). A BLAST search showed that there was no matching sequence of S. rudbeckiae; therefore, this is the first ITS sequence of the species submitted to GenBank. The ITS sequence showed >99% similarity with those of many Septoria species, indicating their close phylogenetic relationship. Pathogenicity was tested by spraying leaves of three potted young plants with a conidial suspension (2 × 105 conidia/ml), which was harvested from a 4-week-old culture on potato dextrose agar. Control leaves were sprayed with sterile water. The plants were covered with plastic bags to maintain 100% relative humidity (RH) for the first 24 h. Plants were then maintained in a greenhouse (22 to 28°C and 70 to 80% RH). After 5 days, leaf spot symptoms identical to those observed in the field started to develop on the leaves inoculated with the fungus. No symptoms were observed on control plants. S. rudbeckiae was reisolated from the lesions of inoculated plants, confirming Koch's postulates. A leaf spot disease associated with S. rudbeckiae has been reported on several species of Rudbeckia in the United States, Romania, and Bulgaria (1–4). To our knowledge, this is the first report of leaf spot on R. hirta var. pulcherrima caused by S. rudbeckiae in Korea. References: (1) J. B. Ellis and B. D. Halsted. J. Mycol. 6:33, 1890. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ February 2, 2012. (3) E. Radulescu et al. Septoriozele din Romania. Ed. Acad. Rep. Soc. Romania, Bucuresti, Romania, 1973. (4) S. G. Vanev et al. Fungi Bulgaricae 3:1, 1997.

Download Full-text