First Report of a Leaf Spot and Stem Canker Caused by Myrothecium roridum on Watermelon in the United States

Myrothecium roridum Tode:Fr, pathogenic to a number of cucurbit species, causes fruit rots, cankers on crowns and stems, and leaf spots. Hosts include cantaloupe and honeydew (Cucurbita melo) and cucumber (Cucumis sativus) (1,3). In June 2004, following a period of heavy rainfall, numerous round-to-oblong, brown lesions with concentric rings were observed on leaves of watermelon (Citrullus lanatus) cv. Desert King at the Blackshank Farm in Tifton, GA. Disease was localized in the field and severity was low (<5% of leaf area affected). No symptoms were observed on fruit. Sections of tissue were removed from the margin between healthy and diseased tissue and plated on acidified, 25% potato dextrose agar (aPDA). A small plug of agar and mycelium were removed from colonies that emerged from lesions and were transferred to aPDA. Isolated colonies were characterized by a white, floccose mycelium with concentric, dark green-to-black rings of sporodochia bearing viscid masses of conidia. Conidia were cylindrical with rounded ends and measured 6 to 8 × 1.5 to 2.5 μm. The features of the fungus were consistent with the description of Myrothecium roridum (1,2). Pathogenicity tests were conducted in a temperature-controlled greenhouse. Twenty-five watermelon plants (cv. Desert King) were inoculated with a conidial suspension of M. roridum (5 × 105 conidia per ml) plus 0.1% vol/vol Tween 20. Inoculum was applied on leaves and stems until runoff with a hand-held mister, and plants were placed in a dew chamber for 72 h. Ten plants were sprayed with sterile, distilled water to serve as controls. Inoculated and noninoculated control plants were removed from the dew chamber and maintained at 25 to 28°C. Symptoms appeared 8 days after inoculation and were characterized by round, dark lesions with concentric rings; noninoculated plants were symptomless. Sections of symptomatic tissue were plated, and M. roridum was reisolated. Although M. roridum is a common pathogen of melons and cucumber, to our knowledge, this is the first field report of a leaf spot caused by M. roridum on watermelon in the United States. No further occurrences of the disease on watermelon have been observed in Georgia since the initial discovery of M. roridum in 2004; however, losses could be potentially severe if widespread infection of fruit were to occur. References: (1) B. D. Bruton. Crater Rot. Pages 49–50 in: Compendium of Cucurbit Diseases. T. A. Zitter et al., eds. The American Phytopathological Society, St. Paul, MN, 1996. (2) M. B. Ellis. Page 552 in: Dematiaceous Hyphomycetes. CAB International, Wallingford, UK, 1971. (3) D. F. Farr et al. Page 809 in: Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989.

Download Full-text

First Report of Myrothecium roridum Causing Myrothecium Leaf Spot on Salvia spp. in the United States

Plant Disease ◽

10.1094/pdis-91-6-0772b ◽

2007 ◽

Vol 91 (6) ◽

pp. 772-772 ◽

Cited By ~ 7

Author(s):

J. A. Mangandi ◽

T. E. Seijo ◽

N. A. Peres

Keyword(s):

United States ◽

Leaf Spot ◽

Pathogenic Fungi ◽

Lower Surface ◽

The United States ◽

Plant Diseases ◽

Control Measures ◽

Conidial Suspension ◽

First Report ◽

Myrothecium Roridum

The genus Salvia includes at least 900 species distributed worldwide. Wild species are found in South America, southern Europe, northern Africa, and North America. Salvia, commonly referred to as sage, is grown commercially as a landscape plant. In August 2006, pale-to-dark brown, circular leaf spots 5 to 20 mm in diameter with concentric rings were observed on Salvia farinacea ‘Victoria Blue’. Approximately 5% of the plants in a central Florida nursery were affected. Lesions were visible on both leaf surfaces, and black sporodochia with white, marginal hyphal tuffs were present mostly on the lower surface in older lesions. Symptoms were consistent with those of Myrothecium leaf spot described on other ornamentals such as gardenia, begonia, and New Guinea impatiens (4). Isolations from lesions on potato dextrose agar produced white, floccose colonies with sporodochia in dark green-to-black concentric rings. Conidia were hyaline and cylindrical with rounded ends and averaged 7.4 × 2.0 μm. All characteristics were consistent with the description of Myrothecium roridum Tode ex Fr. (2,3). The internal transcribed spacer regions ITS1, ITS2, and the 5.8s rRNA genomic region of one isolate were sequenced (Accession No. EF151002) and compared with sequences in the National Center for Biotechnology Information (NCBI) database. Deposited sequences from M. roridum were 96.3 to 98.8% homologous to the isolate from salvia. To confirm pathogenicity, three salvia plants were inoculated by spraying with a conidial suspension of M. roridum (1 × 105 conidia per ml). Plants were covered with plastic bags and incubated in a growth chamber at 28°C for 7 days. Three plants were sprayed with sterile, distilled water as a control and incubated similarly. The symptoms described above were observed in all inoculated plants after 7 days, while control plants remained symptomless. M. roridum was reisolated consistently from symptomatic tissue. There are more than 150 hosts of M. roridum, including one report on Salvia spp. in Brunei (1). To our knowledge, this is the first report of Myrothecium leaf spot caused by M. roridum on Salvia spp. in the United States. Even the moderate level disease present caused damage to the foliage and reduced the marketability of salvia plants. Therefore, control measures may need to be implemented for production of this species in ornamental nurseries. References: (1) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory. Online publication. ARS, USDA, 2006, (2) M. B. Ellis. Page 449 in: Microfungi on Land Plants: An Identification Handbook. Macmillan Publishing, NY, 1985. (3) M. Fitton and P. Holliday. No. 253 in: CMI Descriptions of Pathogenic Fungi and Bacteria. The Eastern Press Ltd. Great Britain, 1970. (4) M. G. Daughtrey et al. Page 19 in: Compendium of Flowering Potted Plant Diseases. The American Phytopathological Society. St. Paul, MN, 1995.

Download Full-text

First Report of Alternaria alternata f. sp. cucurbitae Causing Alternaria Leaf Spot of Melon in the Mid-Atlantic Region of the United States

Plant Disease ◽

10.1094/pdis-92-4-0652b ◽

2008 ◽

Vol 92 (4) ◽

pp. 652-652 ◽

Cited By ~ 2

Author(s):

X. G. Zhou ◽

K. L. Everts

Keyword(s):

United States ◽

Disease Severity ◽

Body Length ◽

Alternaria Alternata ◽

Leaf Spot ◽

The United States ◽

Tween 20 ◽

Conidial Suspension ◽

First Report ◽

Alternaria Leaf Spot

Alternaria alternata f. sp. cucurbitae, the casual agent of Alternaria leaf spot, was first described in Greece where it caused severe losses to greenhouse-grown cucumbers (Cucumis sativus) (3,4). The fungus also attacks melon (C. melo) and watermelon (Citrullus lanatus) (1–3). In late June of 2006, following a period of windy and rainy days, numerous dark brown, circular lesions, 0.5 to 1 mm in diameter, were observed on leaves of melons in a field in Wicomico County, Maryland. The lesions gradually enlarged and coalesced into large, nearly circular, or irregularly shaped lesions that could be as long as 3 cm. The center of the lesions was light tan, surrounded by a dark brown ring and a chlorotic halo, and tended to split in the later development stages. Most of the lesions appeared on the edge of the leaves and no lesions developed on the stems and fruit. Lesions first started on old leaves and then developed on leaves in the middle part of the canopy. Leaf lesions were observed on melon cvs. Ananas, Honeydew Greenflesh, and Israeli. Disease severity ranged from 3 to 20% of the leaf area affected. Small pieces (3 × 3 mm) of tissue removed from the margin between healthy and diseased tissue were surface disinfected in 0.5% NaOCl for 2 min and plated on acidified, ¼-strength potato dextrose agar. Isolations made from diseased tissue frequently (61%) yielded fungal colonies with morphological features and spore dimensions that were consistent with the description of A. alternata f. sp. cucurbitae (1,3). Fungal isolates were characterized by small, short-beaked, multicellular conidia. Conidia were ovoid, obclavate, and sometimes ellipsoidal with the average overall body length of 39 μm (range, 17 to 80 μm) and width of 14 μm (range, 7 to 20 μm). Conidia were produced on short conidiophores in chains. The beaks were short (often less than one-third the body length) and conical or cylindrical. Pathogenicity of six single-spore isolates was determined on four melon cultivars (Honeydew Greenflesh, Israeli, Tam Dew, and Topmark) and one watermelon cultivar (Sugar Baby) in a greenhouse. Twenty plants of each cultivar at the one-true-leaf stage were sprayed with a conidial suspension (106 conidia/ml) of each isolate amended with 0.1% (vol/vol) of Tween 20 until runoff (1.5 to 2 ml per plant). Inoculation with sterile distilled water amended with 0.1% Tween 20 served as controls. The plants were placed in a dew growth chamber for 48 h at 24°C and subsequently maintained in a greenhouse at 21 to 29°C. At 4 to 5 days after inoculation, each isolate induced leaf lesions on each inoculated cultivar similar to typical lesions observed in the field. There was no significant difference in disease severity among the cultivars tested or between melon and watermelon. Control plants remained symptomless. The fungus was readily reisolated from symptomatic tissues. To our knowledge, this is the first report of A. alternata f. sp. cucurbitae causing Alternaria leaf spot of melon in the Mid-Atlantic United States and the only report outside Georgia in the southern region of the United States (D. B. Langston, personal communication) and Greece. References: (1) D. L. Vakalounakis. Plant Dis. 74:227, 1990. (2) D. L. Vakalounakis. Ann. Appl. Biol. 117:507, 1990. (3) D. L. Vakalounakis. Alternaria leaf spot. Page 24 in: Compendium of Cucurbit Diseases. T. A. Zitter et al., eds. The American Phytopathological Society, St. Paul, MN, 1996. (4) D. L. Vakalounakis and N. E. Malathrakis. J. Phytopathol. 121:325, 1988.

Download Full-text

First Report of Ascochyta Leaf Spot of Quinoa Caused by Ascochyta sp. in the United States

Plant Disease ◽

10.1094/pdis-11-12-1008-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 844-844 ◽

Cited By ~ 4

Author(s):

A. L. Testen ◽

J. M. McKemy ◽

P. A. Backman

Keyword(s):

United States ◽

Leaf Spot ◽

Sequence Data ◽

Chenopodium Quinoa ◽

The United States ◽

Management Program ◽

Tween 20 ◽

Conidial Suspension ◽

First Report ◽

The Impact

The Andean crop quinoa (Chenopodium quinoa Willd.), an amaranthaceous pseudograin, is an important food and export crop for this region. Quinoa is susceptible to Ascochyta leaf spot reportedly caused by Ascochyta hyalospora and/or A. caulina (1,2), and quinoa seeds can be infested by A. hyalospora (3). Quinoa fields were established in Pennsylvania during summer 2011. Widespread leafspot symptoms were observed on quinoa in mid-August 2011 in Centre County, PA. Tan to reddish-brown, irregularly shaped lesions were observed with numerous black pycnidia randomly distributed within each lesion. Crushed pycnidia revealed sub-hyaline to light brown, 1 to 2, or less often 3 septate, cylindrical to ovoid spores, 13 to 25 μm long by 5 to 10 μm wide. Pure cultures of Ascochyta were obtained by plating pycnidia from surface disinfested leaves onto half strength acidified potato dextrose agar (APDA). To obtain conidia for pathogenicity trials, cultures were transferred to oatmeal agar and placed in a 20°C incubator with a 12-h photoperiod. Conidia were harvested by scraping 2-week-old cultures. The conidial suspension was filtered through cheesecloth and adjusted to 1.8 × 105 conidia/mL. Tween 20 (0.1%) was added to the final inoculum and sprayed (with a Crown Spra-tool) onto ten 1-month old quinoa plants. Six plants sprayed with sterile water with 0.1% Tween 20 served as controls. Plants were placed in a growth chamber and bagged for 48 h to maintain >95% humidity. After 48 h, tan, irregularly shaped lesions were observed on inoculated plants, but no symptoms were observed on control plants. Plants were grown for 2 more weeks to observe symptom development, and then leaves with characteristic lesions were collected for isolation. Symptomatic leaves were surface disinfested in 10% bleach for 1 min and tissue from the lesion periphery was plated onto APDA. Obtained cultures were morphologically and molecularly identical to those obtained from quinoa fields. For molecular identification of the pathogen, DNA was extracted from cultures of Ascochyta and amplified using ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) primers. Sequences obtained shared 99% maximum identity with a GenBank accession of A. obiones (GU230752.1), a species closely related to A. hyalospora and A. caulina (4). However, the obtained pathogen is morphologically more similar to A. hyalospora and A. chenopodii, but not to A. caulina or A. obiones. At this time, final species identification is impossible because no GenBank sequence data is available for A. hyalospora or A. chenopodii. To our knowledge, this is the first report of Ascochyta leaf spot of quinoa in the United States. The impact of Ascochyta leaf spot on domestic and global quinoa production is unknown, but management of foliar diseases of quinoa, including Ascochyta leaf spot, is a critical component of any disease management program for quinoa. References: (1) S. Danielsen. Food Rev. Int. 19:43, 2003. (2) M. Drimalkova. Plant Protect. Sci. 39:146, 2003. (3) G. Boerema. Neth. J. Plant. Pathol. 83:153, 1977. (4) J. de Gruyter. Stud. Mycol. 75:1, 2012.

Download Full-text

First Report of Alternaria Leaf Spot of Banana Caused by Alternaria alternata in the United States

Plant Disease ◽

10.1094/pdis-01-13-0007-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1116-1116 ◽

Cited By ~ 3

Author(s):

V. Parkunan ◽

S. Li ◽

E. G. Fonsah ◽

P. Ji

Keyword(s):

United States ◽

Alternaria Alternata ◽

Leaf Spot ◽

Morphological Characteristics ◽

The United States ◽

Its Sequencing ◽

Single Spore ◽

First Report ◽

Alternaria Leaf Spot ◽

Leaf Spots

Research efforts were initiated in 2003 to identify and introduce banana (Musa spp.) cultivars suitable for production in Georgia (1). Selected cultivars have been evaluated since 2009 in Tifton Banana Garden, Tifton, GA, comprising of cold hardy, short cycle, and ornamental types. In spring and summer of 2012, 7 out of 13 cultivars (African Red, Blue Torres Island, Cacambou, Chinese Cavendish, Novaria, Raja Puri, and Veinte Cohol) showed tiny, oval (0.5 to 1.0 mm long and 0.3 to 0.9 mm wide), light to dark brown spots on the adaxial surface of the leaves. Spots were more concentrated along the midrib than the rest of the leaf and occurred on all except the newly emerged leaves. Leaf spots did not expand much in size, but the numbers approximately doubled during the season. Disease incidences on the seven cultivars ranged from 10 to 63% (10% on Blue Torres Island and 63% on Novaria), with an average of 35% when a total of 52 plants were evaluated. Six cultivars including Belle, Ice Cream, Dwarf Namwah, Kandarian, Praying Hands, and Saba did not show any spots. Tissue from infected leaves of the seven cultivars were surface sterilized with 0.5% NaOCl, plated onto potato dextrose agar (PDA) media and incubated at 25°C in the dark for 5 days. The plates were then incubated at room temperature (23 ± 2°C) under a 12-hour photoperiod for 3 days. Grayish black colonies developed from all the samples, which were further identified as Alternaria spp. based on the dark, brown, obclavate to obpyriform catenulate conidia with longitudinal and transverse septa tapering to a prominent beak attached in chains on a simple and short conidiophore (2). Conidia were 23 to 73 μm long and 15 to 35 μm wide, with a beak length of 5 to 10 μm, and had 3 to 6 transverse and 0 to 5 longitudinal septa. Single spore cultures of four isolates from four different cultivars were obtained and genomic DNA was extracted and the internal transcribed spacer (ITS1-5.8S-ITS2) regions of rDNA (562 bp) were amplified and sequenced with primers ITS1 and ITS4. MegaBLAST analysis of the four sequences showed that they were 100% identical to two Alternaria alternata isolates (GQ916545 and GQ169766). ITS sequence of a representative isolate VCT1FT1 from cv. Veinte Cohol was submitted to GenBank (JX985742). Pathogenicity assay was conducted using 1-month-old banana plants (cv. Veinte Cohol) grown in pots under greenhouse conditions (25 to 27°C). Three plants were spray inoculated with the isolate VCT1FT1 (100 ml suspension per plant containing 105 spores per ml) and incubated under 100% humidity for 2 days and then kept in the greenhouse. Three plants sprayed with water were used as a control. Leaf spots identical to those observed in the field were developed in a week on the inoculated plants but not on the non-inoculated control. The fungus was reisolated from the inoculated plants and the identity was confirmed by morphological characteristics and ITS sequencing. To our knowledge, this is the first report of Alternaria leaf spot caused by A. alternata on banana in the United States. Occurrence of the disease on some banana cultivars in Georgia provides useful information to potential producers, and the cultivars that were observed to be resistant to the disease may be more suitable for production. References: (1) E. G. Fonsah et al. J. Food Distrib. Res. 37:2, 2006. (2) E. G. Simmons. Alternaria: An identification manual. CBS Fungal Biodiversity Center, Utrecht, Netherlands, 2007.

Download Full-text

Characterization of Leaf Spot Pathogens from Several Spinach Production Areas in the United States

Plant Disease ◽

10.1094/pdis-11-19-2450-re ◽

2020 ◽

Vol 104 (7) ◽

pp. 1994-2004

Author(s):

Bo Liu ◽

Larry Stein ◽

Kimberly Cochran ◽

Lindsey J. du Toit ◽

Chunda Feng ◽

...

Keyword(s):

United States ◽

South Carolina ◽

Leaf Spot ◽

The United States ◽

Leaf Damage ◽

Leaf Spots ◽

Pathogenicity Tests ◽

Agar Media ◽

Production Areas

Leaf spot diseases have become a major concern in spinach production in the United States. Determining the causal agents of leaf spots on spinach, their prevalence and pathogenicity, and fungicide efficacy against these pathogens is vital for effective disease management. Spinach leaves with leaf spots were collected from Texas, California, Arizona, and South Carolina from 2016 to 2018, incubated in a moist chamber, and plated on potato dextrose and tryptic soy agar media. Fungal and bacterial colonies recovered were identified based on morphology and sequence analysis of the internal transcribed spacer rDNA and 16S rRNA, respectively. Two predominant genera were isolated: (i) Colletotrichum spp., which were identified to species based on sequences of both introns of the glutamate synthetase (GS-I) and glyceraldehyde-3-phosphate dehydrogenase (gapdh-I) genes; and (ii) Stemphylium spp., identified to species based on sequences of the gapdh and calmodulin (cmdA) genes. Anthracnose (Colletotrichum spinaciae) and Stemphylium leaf spot (Stemphylium vesicarium and S. beticola) were the predominant diseases. Additional fungi recovered at very limited frequencies that were also pathogenic to spinach included Colletotrichum coccodes, C. truncatum, Cercospora beticola, and Myrothecium verrucaria. All of the bacterial isolates were not pathogenic on spinach. Pathogenicity tests showed that C. spinaciae, S. vesicarium, and S. beticola caused significant leaf damage. The fungicides Bravo WeatherStik (chlorothalonil), Dithane F-45 (mancozeb), Cabrio (pyraclostrobin), and Merivon (fluxapyroxad and pyraclostrobin) were highly effective at reducing leaf spot severity caused by an isolate of each of C. spinaciae and S. vesicarium, when inoculated individually and in combination.

Download Full-text

First Report of Myrothecium roridum Causing Leaf Spot on Garden Hydrangea in the United States

Plant Disease ◽

10.1094/pdis-04-10-0264 ◽

2010 ◽

Vol 94 (10) ◽

pp. 1266-1266 ◽

Cited By ~ 7

Author(s):

M. T. Mmbaga ◽

Y. Li ◽

M.-S. Kim

Keyword(s):

United States ◽

Leaf Spot ◽

Incubation Temperature ◽

Morphological Characteristics ◽

The United States ◽

Control Treatment ◽

Medium Size ◽

First Report ◽

Detached Leaves ◽

Myrothecium Roridum

Garden hydrangea (Hydrangea macrophylla) is a popular flowering shrub that grows well in Tennessee but foliar diseases impact their appearance, health, and market value. Leaves of garden hydrangea showed necrotic lesions with concentric rings of brown and dark brown at the Tennessee State University Research Center in McMinnville. A fungus was recovered from June and July leaf samples with 20% frequency of isolation from approximately 40 leaf pieces that were surface sterilized and plated in potato dextrose agar (PDA). Isolates developed white colonies and dark gray-to-black, spore-bearing mycelial cushions (sporodochia) that formed on older colonies (30 to 45 days old) at 25 ± 2°C. Conidia were hyaline to slightly dark, one-celled, ovoid to elongate with rounded ends, and 2.0 to 2.5 × 5.5 to 6.5 μm. These morphological characteristics were consistent with those described for Myrothecium roridum Tode ex Fr. (1). DNA sequence for three isolates of this fungus showed identical internal transcribed spacer (ITS) region sequences (GenBank Accession No. HM215150) with 99% maximum sequence identity to M. roridum isolates (GenBank Accession Nos. AJ301994.1 and AJ608978). Another close match (97%) was with M. gramineum (GenBank Accession No. FJ235084) and M. tongaense (GenBank Accession No. AY254157). Pathogenicity of M. roridum was evaluated on detached leaves from three hydrangea cultivars, Nikko Blue, All Summer Beauty, and Blue bird. Four, medium-size, detached leaves were placed in moist chambers and inoculated with 5-mm mycelial plugs from 14-day-old cultures; sterile PDA was used as the control treatment. A randomized, complete-block experimental design was used with a replication of four leaves per cultivar. Incubation temperature was 26 ± 2°C. Necrotic lesions started 4 to 5 days after inoculation in all inoculated leaves; lesions expanded to cover 10 to 25% of the leaf surface and formed concentric rings; sterile PDA plugs did not produce leaf lesions. This experiment was repeated twice and similar symptoms were produced; M. roridum was reisolated from all inoculated leaves. Spray inoculation of detached leaves of hydrangea cv. Pretty Maiden with 5 × 104 spores/ml produced similar symptoms; leaves sprayed with water remained symptom free. M. roridum has a wide host range and similar symptoms have been reported on other ornamentals including salvia (2), begonia ( http://mrec.ifas.ufl.edu/foliage/folnotes/begonias.htm ), gardenia ( http://cfextension.ifas.ufl.edu/agriculture/ nursery_production/ documents/Gardenia.pdf ), and cotton (3). To our knowledge, this is the first report of M. roridum causing leaf spot on H. macrophylla in the United States. References: (1) M. B. Ellis. Page 465 in: More Damatacous Hyphomycetes. CABI, Wallingford, UK. 1993. (2) J. A. Mangandi et al. Plant Dis. 91:772, 2007. (3) R. L. Munjal. Indian Phytopathol. New Delhi, 13:150, 1960.

Download Full-text

First Report of Leaf Spot Caused by Cercospora bizzozeriana on Lepidium draba in the United States

Plant Disease ◽

10.1094/pdis-93-1-0108b ◽

2009 ◽

Vol 93 (1) ◽

pp. 108-108 ◽

Cited By ~ 1

Author(s):

A. J. Caesar ◽

R. T. Lartey ◽

D. K. Berner ◽

T. Souissi

Keyword(s):

United States ◽

North America ◽

Sugar Beet ◽

Leaf Spot ◽

The United States ◽

Initial Report ◽

Voucher Specimen ◽

First Report ◽

Leaf Spots ◽

Lepidium Draba

The herbaceous perennial Lepidium draba L. is an invasive weed of rangelands and riparian areas in North America and Australia. As of 2002, it had infested 40,500 ha of rangeland in Oregon and large areas in Wyoming and Utah. Little is known of plant pathogens occurring on L. draba, especially in the United States, that could be useful for biological control of the weed. Leaf spots were first noted on a stand of L. draba near Shepherd, MT in 1997. The spots were mostly circular but sometimes irregularly shaped and whitish to pale yellow. The pathogen was erroneously assumed to be Cercospora beticola since its morphological traits closely resembled that species and the area had large fields of sugar beet with heavy Cercospora leaf spot incidence. Diseased leaves of L. draba were collected in 1997 and 2007. Conidia, borne singly on dark gray, unbranched conidiophores produced on dark stromata late in the season, were elongate, hyaline, multiseptate, 38 to 120 × 2 to 6 μm (mostly 38 to 50 × 2 to 5 μm) and had bluntly rounded tips and wider, truncate bases. These characteristics were consistent with the description of C. bizzozeriana Saccardo & Berlese (2). To isolate the fungus, spores were picked from fascicles of conidiophores with a fine-tipped glass rod, suspended in sterile water, and spread on plates of water agar. Germinated spores were transferred to potato dextrose agar (PDA). The ITS1, 5.8S, and ITS2 sequences of this fungus (GenBank Accession No. EU887131) were identical to sequences of an isolate of C. bizzozeriana from Tunisia (GenBank Accession No. DQ370428). However, these sequences were also identical to those of a number of Cercospora spp. in GenBank, including C. beticola. We also compared the actin gene sequences of the Montana isolate of C. bizzozeriana (GenBank Accession No. FJ205397) and an isolate of C. beticola from Montana (GenBank Accession No. AF443281); the sequences were 94.6% similar, an appreciable difference. For pathogenicity tests, cultures were grown on carrot leaf decoction agar. Aqueous suspensions of 104 spores per ml from cultures were sprayed on 6-week-old L. draba plants. Plants were covered with plastic bags and placed on the greenhouse bench at 20 to 25°C for 96 h. Koch's postulates were completed by reisolating the fungus from the circular leaf spots that appeared within 10 days, usually on lower leaves. Spores of C. bizzozeriana were also sprayed on seedlings of sugar beet, collard, mustard, radish, cabbage, and kale under conditions identical to those above. No symptoms occurred. After the discovery of the disease in 1997, plants of L. draba in eastern Montana, Wyoming, and Utah were surveyed from 1998 to 2003 for similar symptoms and signs, but none were found. This, to our knowledge, is the first report of C. bizzozeriana in the United States. The initial report of the fungus in North America was from Manitoba in 1938 (1). It has recently been reported as occurring on L. draba in Tunisia (4) and Russia (3) and is reported as common in Europe (2). A voucher specimen has been deposited with the U.S. National Fungus Collections (BPI No. 878750A). References: (1) G. R. Bisby. The Fungi of Manitoba and Saskatchewan. Natl. Res. Council of Canada, Ottawa, 1938. (2) C. Chupp. A Monograph of the Fungus Genus Cercospora. C. Chupp, Ithaca, NY, 1953. (3) Z. Mukhina et al. Plant Dis. 92:316, 2008. (4) T. Souissi et al. Plant Dis. 89:206, 2005.

Download Full-text

Volutella leaf blight and stem canker on Japanese pachysandra in the Czech Republic

Plant Protection Science ◽

10.17221/2350-pps ◽

2008 ◽

Vol 43 (No. 1) ◽

pp. 10-12 ◽

Cited By ~ 1

Author(s):

I. Šafránková

Keyword(s):

United States ◽

Czech Republic ◽

Stem Canker ◽

The United States ◽

Leaf Blight ◽

The Czech Republic ◽

Plant Parts ◽

Leaf Spots ◽

Stems And Leaves ◽

Serious Disease

Woody ornamental cover plants of Japanese pachysandra (P. terminalis S. et Z.) are planted in parks and gardens in the Czech Republic. A serious disease of these plants is Volutella leaf blight and stem canker caused by the fungus Pseudonectria pachysandricola (anamorph Volutella pachysandricola). It was described by DODGE (1944) in the United States and appeared in Europe in the 1980s. Volutella pachysandricola was isolated from Japanese pachysandra (P. terminalis cvs. Green Carpet and Variegata) from leaf spots and stem and stolon cankers in Brno in 2000−2003. The tan or brown spots with brown margins, often with concentric zones, develop on infected leaves. Stem and stolon cankers appear as water-soaked diseased areas, the stem often turns brown, shrivels and girdles. The infection often begins in damaged or senescent plant parts and spreads into the healthy tissues. Pink-orange sporodochia with spores form on newly killed stems and leaves during humid spring and summer periods. Ascospores develop in red-orange perithecia on the same tissues.

Download Full-text

Three New Fungal Leaf Spot Diseases of Spinach in the United States and the Evaluation of Fungicide Efficacy for Disease Management

Plant Disease ◽

10.1094/pdis-04-20-0918-re ◽

2021 ◽

pp. PDIS-04-20-0918

Author(s):

Bo Liu ◽

Larry Stein ◽

Kimberly Cochran ◽

Lindsey J. du Toit ◽

Chunda Feng ◽

...

Keyword(s):

United States ◽

Sequence Analysis ◽

Leaf Spot ◽

The United States ◽

Leaf Spots ◽

Fungicide Efficacy ◽

Windblown Sand ◽

Pathogenicity Tests ◽

Spinach Leaf ◽

Production Areas

Leaf spot diseases of spinach, caused by Colletotrichum spinaciae, has become a major production constraint in several production areas, including Texas, in recent years. Leaf spot symptoms were observed in several fields in Texas in 2016 and 2017, with typical anthracnose-like symptoms and leaves with small, circular, and sunken lesions that appeared similar to injury from windblown sand. The lesions were plated on potato dextrose agar, from which fungal cultures were recovered. The fungi were identified based on morphology and sequence analysis of the introns of glutamate synthetase and glyceraldehyde-3-phosphate dehydrogenase (for isolates determined to be Colletotrichum spp.) and the internal transcribed spacer ribosomal DNA (for isolates determined to be Myrothecium spp.). Based on foliar symptoms, fungal colony and spore morphology, pathogenicity tests of fungal isolates on the spinach cultivar ‘Viroflay’, and DNA sequence analysis of the isolates, the symptoms on spinach leaves for two sets of samples were caused by Colletotrichum coccodes and Colletotrichum truncatum, and leaf spots resembling damage from windblown sand were caused by Myrothecium verrucaria. This is the first report of spinach leaf spot diseases caused by C. coccodes, C. truncatum, and M. verrucaria in the United States. C. coccodes and C. truncatum caused severe symptoms on the spinach cultivar ‘Viroflay’, whereas M. verrucaria caused symptoms of intermediate severity. Fungicide efficacy tests demonstrated that chlorothalonil, mancozeb, pyraclostrobin, fluxapyroxad + pyraclostrobin, and penthiopyrad were completely effective at preventing leaf spots caused by any of these pathogens when applied 24 h before inoculation of ‘Viroflay’ plants in greenhouse trials.

Download Full-text

First Report of Volutella Blight on Pachysandra Caused by Volutella pachysandricola in China

Plant Disease ◽

10.1094/pdis-11-11-0997 ◽

2012 ◽

Vol 96 (4) ◽

pp. 584-584

Author(s):

Q. Bai ◽

Y. Xie ◽

R. Dong ◽

J. Gao ◽

Y. Li

Keyword(s):

Morphological Characteristics ◽

Stem Canker ◽

Botanical Garden ◽

The United States ◽

Culture Collection ◽

Leaf Blight ◽

Conidial Suspension ◽

First Report ◽

Leaf Spots ◽

Plastic Bags

Pachysandra (Pachysandra terminalis, Buxaceae) and Japanese Pachysandra, also called Japanese Spurge, is a woody ornamental groundcover plant distributed mostly in Zhejiang, Guizhou, Henan, Hubei, Sichuan, Shanxi, and Gansu provinces in China. In April 2010, P. terminalis asymptomatic plants were shipped from Beijing Botanical Garden Institute of Botany Chinese Academy of Science to the garden nursery of Jilin Agricultural University (43°48′N, 125°23′E), Jilin Province. In June 2011, Volutella blight (sometimes called leaf blight and stem canker) of P. terminalis was observed on these plants. Infected leaves showed circular or irregular, tan-to-brown spots often with concentric rings and dark margins. The spots eventually grew and coalesced until the entire leaf died. Cankers appeared as greenish brown and water-soaked diseased areas, subsequently turning brown or black, and shriveled and often girdled the stems and stolons. During wet, humid weather in autumn, reddish orange, cushion-like fruiting structures of the fungus appeared on the stem cankers and undersides of leaf spots. Symptoms of the disease were consistent with previous descriptions (2–4). Five isolates were obtained from necrotic tissue of leaf spots and cankers of stems and stolons and cultured on potato dextrose agar. The colony surface was salmon colored and slimy. Conidia were hyaline, one celled, spindle shaped, and 12.57 to 22.23 × 3.33 to 4.15 μm with rounded ends. Morphological characteristics of the fungus were consistent with the description by Dodge (2), and the fungus was identified as Volutella pachysandricola (telemorph Pseudonectria pachysandricola). The internal transcribed spacer (ITS) regions of the nuclear rDNA were amplified using primers ITS4/ITS5 (1). The ITS sequences were 553 bp long and identical among these five isolates (GenBank Accession No. HE612114). They were 100% identical to Pseudonectria pachysandricola voucher KUS-F25663 (Accession No. JN797821) and 99% identical to P. pachysandricola culture-collection DAOM (Accession No. HQ897807). Pathogenicity was confirmed by spraying leaves of clonally propagated cuttings of P. terminalis with a conidial suspension (1 × 106 conidia/ml) of the isolated V. pachysandricola. Control leaves were sprayed with sterile water. Plants were covered with plastic bags and kept in a greenhouse at 20 to 25°C for 72 h. After 5 to 8 days, typical disease symptoms appeared on leaves, while the control plants remained healthy. V. pachysandricola was reisolated from the leaf spots of inoculated plants. Pachysandra leaf blight and stem canker also called Volutella blight, is the most destructive disease of P. terminalis and previously reported in the northern humid areas of the United States (Illinois, Connecticut, Ohio, Indiana, Iowa, Massachusetts, Missouri, Kentucky, and Wisconsin), northern Europe (Britain, Germany, and Poland), and the Czech Republic. To our knowledge, this is the first report of the disease caused by V. pachysandricola in China. The disease may become a more significant problem in P. terminalis cultivation areas if the disease spreads on P. terminalis in nursery beds. References: (1) D. E. L. Cooke et al. Mycol. Res. 101:667, 1997. (2) B. O. Dodge. Mycologia 36:532, 1944. (3) S. M. Douglas. Online publication. Volutella Blight of Pachysandra. The Connecticut Agricultural Experiment Station, 2008. (4) I. Safrankova. Plant Protect. Sci.43:10, 2007.

Download Full-text