scholarly journals First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston
Keyword(s):  
South Carolina ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Pcr Products ◽  
Primer Sequence ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of Tomato yellow leaf curl virus in Louisiana

Plant Disease ◽  
2001 ◽  
Vol 85 (2) ◽  
pp. 230-230 ◽  
Author(s):  
R. A. Valverde ◽  
P. Lotrakul ◽  
A. D. Landry ◽  
J. E. Boudreaux
Keyword(s):  
The United States ◽  
Tomato Yellow Leaf ◽  
Yield Reduction ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Tomato Plants ◽  
First Report ◽  
Biotype B ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (Geminiviridae) that causes a serious disease of tomato throughout the world. In 1997, the strain from Israel of TYLCV (TYLCV-IS) was found infecting tomatoes in Florida for the first time in the United States (1). During late spring of 2000, approximately 90% of the tomato plants (Lycopersicon esculentum) in a farm near New Orleans exhibited severe stunting, leaf cupping, and chlorosis. Symptoms were similar to those caused by TYLCV. Whiteflies (Bemisia tabaci biotype B) were present in the field but in relatively low numbers. The effect on yield reduction varied from negligible (late infections) to 100% (early infections). Six selected plants showing symptoms were assayed by polymerase chain reaction (PCR) using begomovirus-specific primers. Capsicum frutescens infected with an isolate of Texas pepper virus from Costa Rica was used as positive control. DNA was extracted using Plant DNAzol Reagent (GIBCO BRL). PCR was conducted using degenerate primers AV494/AC1048 that amplify the core coat protein region of most begomoviruses (2). PCR yielded a DNA fragment of approximately 550 bp, suggesting that a begomovirus was associated with the disease. The amplified DNA of one field isolate was cloned and the nucleotide (nt) sequence determined. Sequence comparisons with other begomoviruses in the GenBank Database indicated that the Louisiana isolate shared 100% nt identity with TYLCV-IS (GenBank Accession X76319). Successful transmission (100%) to Bonny Best tomato were obtained with four groups of 10 whiteflies each (B. tabaci biotype B) that fed on TYLCV-IS infected tomato plants. Acquisition and transmission feedings were for 2 days. In all cases, the virus was diagnosed by the ability to reproduce typical TYLCV-like symptoms in tomato and PCR. The virus was also successfully graft-transmitted to tomato cv. Bonny Best, Nicotiana benthamiana, and tomatillo (Physalis ixocarpa) using scions from tomato plants infected with a whitefly transmitted virus isolate. This is the first report of TYLCV-IS in Louisiana. References: (1) J. E. Polston et al. Plant Dis. 83:984–988, 1999. (2) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288–1293, 1996.

scholarly journals First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Plant Disease ◽  
2019 ◽  
Vol 103 (6) ◽  
pp. 1437-1437 ◽  
Author(s):  
M. Granier ◽  
L. Tomassoli ◽  
A. Manglli ◽  
M. Nannini ◽  
M. Peterschmitt ◽  
...  
Keyword(s):  
Resistance Gene ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Virus Recombinant ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals First Report of Tomato yellow leaf curl virus on Tomato Crops in Greece

Plant Disease ◽  
2001 ◽  
Vol 85 (6) ◽  
pp. 678-678 ◽  
Author(s):  
A. D. Avgelis ◽  
N. Roditakis ◽  
C. I. Dovas ◽  
N. I. Katis ◽  
C. Varveri ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Rflp Analysis ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Comparisons ◽  
Tomato Plants ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl

In late summer 2000, tomato (Lycopersicon esculentum Mill.) grown in greenhouses in Ierapetra, Tympaki, and Chania (Crete) showed leaf curling, reduced leaf size, yellowing, shortened internodes, and a bushy appearance. More than 30 ha of tomato greenhouses were affected and the disease incidence ranged from 15 to 60% with estimated crop losses of over $500,000. Similar symptoms were observed in tomato samples from Marathon (Attiki) and Southern Peloponnese. All greenhouses with infected plants were infested with high populations of Bemisia tabaci (Gennadius), which were also observed outside the greenhouses on several weeds. Tomato symptoms were similar to those caused by Tomato yellow leaf curl virus (TYLCV). The assumed virus could not be transmitted mechanically but successful transmission was obtained by grafting onto healthy tomato plants. Over 100 samples of symptomatic tomato plants collected from Crete and southern Peloponnese gave positive reactions when tested by ELISA using monoclonal antibodies to TYLCV-European (Adgen Ltd). The serological results were confirmed by PCR using two pairs of primers, universal degenerate (1) and MA 13 and MA 17 (2), amplifying different parts of the virus genome. The restriction fragment length polymorphism (RFLP) analysis (AluI, HaeIII, and TaqI) of the 541 bp amplicon obtained with the degenerate primers showed patterns similar to TYLCV-Is (Israeli species). The second pair of primers gave the expected 348 bp product, which was sequenced. Sequence comparisons revealed 99% identity with TYLCV-Is (EMBL no. X15656, X76319). The resulting sequence was at least 97.7% identical to sequences of TYLCV isolates from the Dominician Republic (EMBL no. AF024715), Cuba (EMBL no. AJ223505), Portugal (EMBL no. AF105975), Iran (EMBL no. AJ13271), and Spain (EMBL no. AF071228). The disease appeared for the first time in 1992 in Tymbaki, but was limited to very few plants in one glasshouse. However, the cause was not determined. To our knowledge, this is the first report of TYLCV of the Begomovirus genus in Greece. References: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (2) J. Navas-Castillo et al. J. Virol. Methods 75:195, 1998.

scholarly journals First Report of Tomato Yellow Leaf Curl Virus-Is in Spain: Coexistence of Two Different Geminiviruses in the Same Epidemic Outbreak

Plant Disease ◽  
1997 ◽  
Vol 81 (12) ◽  
pp. 1461-1461 ◽  
Author(s):  
J. Navas-Castillo ◽  
S. Sánchez-Campos ◽  
J. A. Díaz ◽  
E. Sáez-Alonso ◽  
E. Moriones
Keyword(s):  
Direct Sequencing ◽  
Nucleotide Sequences ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
First Report ◽  
Western Mediterranean Basin ◽  
Two Samples ◽  
Pcr Products ◽  
Leaf Curl Virus ◽  
Leaf Curl

Epidemics of tomato yellow leaf curl have occurred annually in greenhouse- and field-grown tomato (Lycopersicon esculentum Mill.) crops in southern Spain since 1992 (2). The nucleotide sequences of two tomato yellow leaf curl virus (TYLCV) isolates from this region, TYLCV-M (GenBank accession no. Z25751) and TYLCV-Alm (L27708), have been determined and these isolates are closely related to isolates reported from Italy (X61153 and Z28390), suggesting the existence of a geographical cluster of closely related TYLCV isolates in the Western Mediterranean Basin (2). In June 1997, new and unusually severe symptoms of stunting, yellowing, and curling of leaflet margins, with a marked reduction in leaf size, were observed in some plants of a greenhouse-grown tomato crop in Almeria (southeastern Spain). Tomato plants showing milder symptoms similar to those previously described for TYLCV infection in that region (2) were also present in the same greenhouse. Total nucleic acids extracts from plants exhibiting both types of symptoms were analyzed by dot blot hybridization with a probe prepared by random priming on a 1,674-bp SalI fragment of the pSP95 clone of TYLCV-M (3). A strong reaction was obtained with the samples that showed mild symptoms, whereas a weak reaction was observed with the severely affected plants. Specific pairs of primers were prepared to amplify the complete pre-coat (V1) (MA10: 5′-ATGTGGGATCCTTTATTAAATG-3′; MA11: 5′-TCAGGGCTTCTGTACATTC-3′) and C2 (MA12: 5′-TAAAGACTCTTAAAAAATGACC-3′; MA13: 5′-AATGCAATCTTCGTCACC-3′) genes based on TYLCV-M sequence. With polymerase chain reaction (PCR), the expected fragments were amplified from extracts of both types of plants. The PCR products were submitted to single-strand conformation polymorphism (SSCP) analysis. Clearly distinguishable SSCP patterns were obtained: one for the plants with mild symptoms, identical to that of known TYLCV-M infected plants, and another for the plants with more severe symptoms. Further analyses done on tomato samples collected from the same area showed that both SSCP patterns were present simultaneously in several severely affected plants. The nucleotide sequences of the V1 and C2 PCR products from two samples differing in their SSCP pattern were obtained by direct sequencing, and compared with available TYLCV sequences. The sequences corresponding to the sample with mild symptoms were 100% identical to those previously reported for TYLCV-M. In contrast, the sequences from the sample that showed severe symptoms (GenBank accesion no. AF022219 for V1, and AF022220 for C2) were only 80 and 76% identical to TYLCV-M V1 and C2 genes, respectively, but were 99% identical to the sequence reported for an isolate of TYLCV-Is from Israel (X15656). Epidemics in tomato caused by TYLCV-Is have been recently reported from Portugal (1). Our results demonstrate that the unusually severe symptoms observed are associated with an isolate of TYLCV-Is that coexists in the field with the milder TYLCV previously reported from this area. This is the first report of the occurence of TYLCV-Is in Spain. References: (1) D. Louro et al. Plant Dis. 80:1079, 1996. (2) E. Noris et al. Arch. Virol. 135:165, 1994.

First Report of Tomato Yellow Leaf Curl Virus in Greenhouse Tomatoes in Kentucky

2008 ◽  
Vol 9 (1) ◽  
pp. 12 ◽  
Author(s):  
P. B. de Sá ◽  
K. W. Seebold ◽  
P. Vincelli
Keyword(s):  
Pathogen Detection ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
The State ◽  
Yellow Leaf ◽  
Greenhouse Production ◽  
Tomato Plants ◽  
Detection Approach ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), genus Begomovirus in the family Geminiviridae, was identified for the first time in the United States in Florida in 1997 and since then has been reported in other states on tomato in greenhouse and in field production environments. During 2005 symptoms typical of geminivirus infection were observed on tomato plants grown in a greenhouse production system in Jefferson Co., KY. A nucleic acid-based pathogen detection approach was used and TYLCV infection was confirmed in tomato plants collected from the greenhouse and in symptomless Acalypha ostryifolia growing outside the greenhouse. To our knowledge, A. ostryifolia has not been previously described as a host of this virus. This find raises concerns regarding the introduction of TYLCV to the state in infected transplants or in viruliferous whiteflies transported on infested plants, and its potential impact on economically important crops in the state. Accepted for publication 17 June 2008. Published 19 August 2008.

scholarly journals Detection of Satellite DNA Beta in Tomato Plants with Tomato Yellow Leaf Curl Disease in Jordan

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1017-1017 ◽  
Author(s):  
G. Anfoka ◽  
F. Haj Ahmad ◽  
M. Altaleb ◽  
M. Al Shhab
Keyword(s):  
Mixed Infection ◽  
Tomato Yellow Leaf ◽  
Single Infection ◽  
Yellow Leaf ◽  
Tomato Production ◽  
Tomato Plants ◽  
Pcr Products ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

In Jordan, as well as many countries in the region, tomato production is threatened by begomoviruses belonging to the tomato yellow leaf curl virus complex (1). In 2013, an experiment was conducted at Homret Al-Sahen, Jordan (GPS coordinates 32°05′06″ N, 35°38′52″ E), to evaluate different tomato breeding lines for resistance against viruses causing tomato yellow leaf curl disease (TYLCD). Disease symptoms, typical of those caused by TYLCV complex, were observed in many susceptible lines. However, some lines exhibited unusual symptoms including severe leaf curling and stunting. To identify the causal agent of these symptoms, total nucleic acids were extracted from 21 symptomatic plants and used as templates in PCR analysis using nine primers, previously described to detect Tomato yellow leaf curl virus, Tomato yellow leaf curl Sardinia virus, and two recombinants between TYLCV and TYLCSV (3). In addition, the universal primer pair β01/β02 (2) was used to investigate the association of satDNA β with the disease. The PCR products characteristic of TYLCV (664 bp) could be amplified from five plants indicating single infection, while double infection with TYLCV and satDNA β (1,320 bp) was detected in seven plants. Mixed infection with TYLCV, TYLCSV (628 bp), and satDNA β was detected in another seven symptomatic plants and only one plant was infected with TYLCV and TYLCSV. A single plant had mixed infection with TYLCV, TYLCSV, and RecA (a recombinant between TYLCV/TYLCSV) (538 bp) (3). Amplicons obtained from two plants using β01/β02 primers were directly sequenced as 1,320-bp PCR products. Both sequences were found identical and, therefore, this sequence was deposited in the GenBank under the accession number KJ396939. Phylogenetic analysis revealed that this satDNA β sequence had the highest nucleotide (95%) identity with Okra leaf curl virus (OkLCV) satDNA 3 (AF397217) and OkLCV satDNA 10 (AF397215). The contribution of the satDNA β in the modulation of the TYLCD symptoms will be further investigated. Few years ago, another satDNA (Tomβ01-Om) was reported in Oman to be associated with TYLCD (4). However, to the best of our knowledge, this is the first report on the detection of satDNA β in tomato plants infected with viruses causing TYLCD in Jordan. The increasing diversity of begomoviruses causing TYLCD in the region is of great concern due to the possible emergence of more virulent viruses and subsequent increased losses to tomato production. References: (1) G. Anfoka et al. J. Plant Pathol. 90:311, 2008. (2) R. W. Briddon and J. Stanley. Virology 344:198, 2006. (3) S. Davino et al. Virus Res. 143:15, 2009. (4) A. J. Khan et al. Virus Gene 36:169, 2008.

scholarly journals First Report of Tomato yellow leaf curl virus in Mississippi

Plant Disease ◽  
2001 ◽  
Vol 85 (12) ◽  
pp. 1287-1287 ◽  
Author(s):  
D. M. Ingram ◽  
A. Henn
Keyword(s):  
Leaf Size ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Production Operation ◽  
Yellow Leaf ◽  
Pcr Assay ◽  
Tomato Production ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (family Geminiviridae) that causes severe chlorosis, stunting, and cupping of leaves in tomato (Lycopersicon esculentum) throughout the world. The disease was first reported in the United States in Florida in 1997 (2). In 2000, TYLCV was confirmed as the cause of severe chlorosis, stunting, and cupping of leaves in tomato in Louisiana (3). In January of 2001, mild symptoms consistent with TYLCV were observed in a greenhouse-tomato production operation in east-central Mississippi. Whiteflies (Bremisia tabaci) were present in the greenhouse during the previous month, but in relatively low numbers. Symptom severity slightly increased over time with chlorosis in the terminal, reduction in terminal leaf size, and upward cupping of leaves observed. Approximately 4% of plants in the greenhouse developed symptoms. Yield reductions are thought to be negligible since the tomato plants harbored most fruit for that growing season. Terminal growth was halted, and no additional flower production was observed. No symptoms were observed on mature fruit; however, fruit set after leaf symptoms developed remained stunted. A representative sample of symptomatic tissue was submitted to an independent lab (Agdia, Inc., Elkhart, IN), screened for whitefly-transmitted geminiviruses, and the results were positive. Additional symptomatic tomato tissue was submitted to the University Diagnostics Lab, University of Florida, Gainesville, and was observed for viral inclusion bodies. This test was positive for TYLCV based on morphology of virus particles located in the nucleus of tomato cells (1). Total DNA was extracted from the symptomatic plants for polymerase chain reaction (PCR) assay (2). Results from the PCR assay indicated the presence of TYLCV in symptomatic tomato tissue. The strain of the virus was not determined. To our knowledge, this is the first report of TYLCV in Mississippi. References: (1) B. Pico et al. Sci. Hortic. 67:151, 1996. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) R. A. Valderde et al. Plant Dis. 85:230, 2001.

scholarly journals Introduction of the Exotic Monopartite Tomato yellow leaf curl virus into West Coast Mexico

Plant Disease ◽  
2006 ◽  
Vol 90 (10) ◽  
pp. 1360-1360 ◽  
Author(s):  
J. K. Brown ◽  
A. M. Idris
Keyword(s):  
United States ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Caribbean Region ◽  
Yellow Leaf ◽  
Fresh Market ◽  
Tomato Production ◽  
Tomato Plants ◽  
Leaf Curl Virus ◽  
Leaf Curl

Leaf curl symptoms that are reminiscent of begomovirus (genus Begomovirus, family Geminiviridae) infection were observed widespread in the tomato crop during the early fall 2005 through the spring 2006 growing seasons in Sinaloa State, Mexico. Symptoms were widespread in three major valleys (Culiacan, Guasave, and Los Mochis) that are largely dedicated to fresh-market tomato production for the U.S. market from October to June. Symptoms included stunting of leaves, shortened internodes, distortion of leaf margins, and green vein banding. Fruit set was reduced significantly (as much as 90%) on the portion of the plant that developed above the point of symptom expression. Tomato fields were heavily infested with the B biotype of the whitefly Bemisia tabaci (Genn.) vector and no other insect vectors were noted in the fields. Total DNA was extracted from six symptomatic tomato plants (two from each valley) and used as template to amplify, clone, and sequence the core region of the begomovirus CP. BLAST analysis of begomovirus sequences available in the NCBI GenBank database indicated the closest match was the Old World monopartite begomovirus Tomato yellow leaf curl virus (TYLCV) from Israel (Accession No. X15656) at 97.8% shared nucleotide (nt) identity. The full-length genome was amplified for each of six isolates using TempliPhi (Amersham Biosciences, Piscataway, NJ) and cloned into the pGEM7 vector (Promega, Madison, WI). The complete DNA genome sequence was determined for eight clones by primer walking. Cloned TempliPhi products sequenced represented two to three isolates from each valley. Results indicated that the isolates (n = 8) were 98.9 to 100% identical (Accession No. DQ631892) to each other, and they shared 98% identity with TYLCV isolates reported from the Caribbean Region and Florida. This highly virulent begomovirus of tomato, originating in Israel, was first reported in Mexico from 1996 to 1997 when it was identified in tomato plants in the Yucatan Peninsula (1) (>1,500 miles from Sinaloa). The latter report followed the introduction of TYLCV in tomato seedlings from Florida into several eastern U.S. states (3,4) and then into Puerto Rico (2). The introduction of TYLCV into Sinaloa where tomato production is highly concentrated is significant because the region supplies the majority (as much as 93%) of fresh-market tomatoes to the western United States from October to June (>$750 million dollars). Of equal importance is the immediate proximity of the pandemic to California where more than 90% of the processing tomatoes in the United States are grown. References: (1) J. T. Ascencio-Ibáñez et al. Plant Dis. 83:1178, 1999. (2) J. Bird et al. Plant Dis. 85:1028, 2001. (3) M. T. Momol et al. Plant Dis 83:487, 1999. (4) J. E. Polston and P. K. Anderson, Plant Dis. 81:1358, 1997.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Cowpea in China

Plant Disease ◽  
2011 ◽  
Vol 95 (3) ◽  
pp. 362-362 ◽  
Author(s):  
F. M. Dai ◽  
R. Zeng ◽  
W. J. Chen ◽  
J. P. Lu
Keyword(s):  
Tomato Yellow Leaf ◽  
Insect Vector ◽  
Yellow Leaf ◽  
First Report ◽  
Cp Gene ◽  
Large Populations ◽  
Pcr Products ◽  
Viral Coat ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is a devastating pathogen of tomato that causes significant yield losses in many tropical and subtropical regions (1). In China, this virus was first found in 2006 on tomato in Shanghai (2). In October 2008, chlorotic yellow leaves of cowpea (Vigna sinensis) were observed in Qingpu, Shanghai, China with 15 to 20% incidence in plants in high tunnels. Large populations of whiteflies were observed in association with the diseased cowpea. The disease agent was transmitted to cowpea (and tomato) by whiteflies, which resulted in chlorotic yellow leaves on cowpea (yellow leaf curl symptoms on tomato) that were identical to those observed in the field. On the basis of the suspected insect vector, symptomology, and severe epidemics of tomato yellow leaf curl disease (TYLCD) in Shanghai in recent years, Tomato yellow leaf curl virus was suspected as the causal agent. Total DNA was extracted from four symptomatic cowpea samples. PCR was performed with specific primers V416 (5′-CAAGGCACAAACAAGCGACG-3′) and C1287 (5′-CTCAACTTCCGAATTTGGACGAC-3′) to amplify a 872-bp DNA fragment of the viral coat protein (CP) gene and an amplicon of the expected size was obtained in all four samples but not from healthy leaf samples. The PCR products were sequenced and the sequences were identical among samples. Primers TYLCV-F (5′-CAGGAGGCAGCCAAGTATGAG-3′) and TYLCV-R (5′-ACTAATGCCTGTTCYTTCATTCC-3′) (Y = C or T/U) were designed on the basis of the sequence (Accession No. HM804856) and reported (Accession No. FM163463) CP gene to amplify the full-length viral DNA of cowpea isolate (CN:SH:Cowpea:08). The sequence was determined to be 2,781 nucleotides long (Accession No. GU434143). A comparison of the sequence with those in GenBank shows that the cowpea isolate has the highest nucleotide sequence identity (99%) with TYLCV isolate XH2 from tomato in Xinghua, Jiangsu, China (Accession No. GU111505). To our knowledge, this is the first report of TYLCV infecting cowpea in China and also the first report in the world. References: (1) H. Czosnek and H. Laterrot. Arch. Virol. 142:1391, 1997. (2) J. B. Wu et al. Plant Dis. 90:1359, 2006.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean (Phaseolus vulgaris) in Greece

Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 465-465 ◽  
Author(s):  
L. C. Papayiannis ◽  
A. Paraskevopoulos ◽  
N. I. Katis
Keyword(s):  
Phaseolus Vulgaris ◽  
Tomato Yellow Leaf ◽  
Cultivated Plants ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Embl Accession ◽  
Bean Plants ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl is one of the most devastating virus diseases of tomato (Lycopersicon esculentum Mill) crops worldwide. Several whitefly-transmitted viruses are associated with the disease and all are assigned to the genus Begomovirus, family Geminiviridae. In Greece, Tomato yellow leaf curl virus (TYLCV) was first reported to infect greenhouse and open-field tomatoes in 2000 (2). During 2006, a survey was conducted in the southwestern part of Peloponnese (mainland) within the areas of Kyparissia and Filiatra (Perfecture of Messinia) to identify the prevalence and natural hosts of the disease. During this survey, yellow mosaic, severe leaf curling, and leaf crumple symptoms were observed in greenhouse bean plants (Phaseolus vulgaris) that were cultivated together with tomatoes showing typical TYLCV symptoms. In all affected greenhouses, the incidence of the disease ranged from 1 to 5% in beans and 90 to 100% in tomato plants. Both bean and tomato plants were highly infested with Bemisia tabaci (Gennadius) populations and produced unmarketable fruits. Twenty-four symptomatic bean plants were collected from four greenhouses that tested positive by triple-antibody sandwich-ELISA using TYLCV-specific antibodies purchased from NEOGEN, EUROPE, Ltd. DNA was extracted from all infected bean plants, and a 580-bp fragment of the coat protein gene was amplified by PCR using the TY(+)/TY(-) primer pair (1). Amplified fragments were then analyzed by restriction fragment length polymorphism with Ava II cutter enzyme. Two DNA fragments of 277 and 302 bp in agarose gels were produced from all isolates and the restriction pattern corresponded to TYLCV. The amplified DNA from four infected bean plants was cloned and sequenced. All four sequences were 100% identical (EMBL Accession No. AM418398) and showed 99% nucleotide identity to a TYLCV isolate from Italy (EMBL Accession No. DQ144621). To our knowledge, this is the first report of TYLCV infection of P. vulgaris, which is an important commercial crop in Messinia, Greece. Within the last decade, TYLCV has emerged as an important pathogen for several cultivated plants in many regions and different TYLCV variants have been reported to infect P. vulgaris (3). Bean is often used as an intercrop between tomato crops, and thus, infected plants may serve as a potential reservoir for virus survival and spread (4). References: (1) G. P. Accotto et al. Eur. J. Plant Pathol. 106:179, 2000. (2) A. D. Avgelis et al. Plant Dis. 85:678, 2001. (3) J. Morris et al. EPPO Bull. 32:41, 2002. (4) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.

Sign in / Sign up

Export Citation Format

Share Document