First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Download Full-text

The nucleotide sequence of a recombinant tomato yellow leaf curl virus strain frequently detected in Sicily isolated from tomato plants carrying the Ty-1 resistance gene

Archives of Virology ◽

10.1007/s00705-017-3674-9 ◽

2017 ◽

Vol 163 (3) ◽

pp. 795-797 ◽

Cited By ~ 10

Author(s):

Stefano Panno ◽

Andrea Giovanni Caruso ◽

Salvatore Davino

Keyword(s):

Nucleotide Sequence ◽

Resistance Gene ◽

Virus Strain ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

Leaf Curl Virus ◽

Leaf Curl

Download Full-text

First Report of Tomato yellow leaf curl virus on Tomato Crops in Greece

Plant Disease ◽

10.1094/pdis.2001.85.6.678c ◽

2001 ◽

Vol 85 (6) ◽

pp. 678-678 ◽

Cited By ~ 13

Author(s):

A. D. Avgelis ◽

N. Roditakis ◽

C. I. Dovas ◽

N. I. Katis ◽

C. Varveri ◽

...

Keyword(s):

Disease Incidence ◽

Rflp Analysis ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Degenerate Primers ◽

Sequence Comparisons ◽

Tomato Plants ◽

First Report ◽

Leaf Curl Virus ◽

Leaf Curl

In late summer 2000, tomato (Lycopersicon esculentum Mill.) grown in greenhouses in Ierapetra, Tympaki, and Chania (Crete) showed leaf curling, reduced leaf size, yellowing, shortened internodes, and a bushy appearance. More than 30 ha of tomato greenhouses were affected and the disease incidence ranged from 15 to 60% with estimated crop losses of over $500,000. Similar symptoms were observed in tomato samples from Marathon (Attiki) and Southern Peloponnese. All greenhouses with infected plants were infested with high populations of Bemisia tabaci (Gennadius), which were also observed outside the greenhouses on several weeds. Tomato symptoms were similar to those caused by Tomato yellow leaf curl virus (TYLCV). The assumed virus could not be transmitted mechanically but successful transmission was obtained by grafting onto healthy tomato plants. Over 100 samples of symptomatic tomato plants collected from Crete and southern Peloponnese gave positive reactions when tested by ELISA using monoclonal antibodies to TYLCV-European (Adgen Ltd). The serological results were confirmed by PCR using two pairs of primers, universal degenerate (1) and MA 13 and MA 17 (2), amplifying different parts of the virus genome. The restriction fragment length polymorphism (RFLP) analysis (AluI, HaeIII, and TaqI) of the 541 bp amplicon obtained with the degenerate primers showed patterns similar to TYLCV-Is (Israeli species). The second pair of primers gave the expected 348 bp product, which was sequenced. Sequence comparisons revealed 99% identity with TYLCV-Is (EMBL no. X15656, X76319). The resulting sequence was at least 97.7% identical to sequences of TYLCV isolates from the Dominician Republic (EMBL no. AF024715), Cuba (EMBL no. AJ223505), Portugal (EMBL no. AF105975), Iran (EMBL no. AJ13271), and Spain (EMBL no. AF071228). The disease appeared for the first time in 1992 in Tymbaki, but was limited to very few plants in one glasshouse. However, the cause was not determined. To our knowledge, this is the first report of TYLCV of the Begomovirus genus in Greece. References: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (2) J. Navas-Castillo et al. J. Virol. Methods 75:195, 1998.

Download Full-text

First Report of Tomato yellow leaf curl virus in Louisiana

Plant Disease ◽

10.1094/pdis.2001.85.2.230d ◽

2001 ◽

Vol 85 (2) ◽

pp. 230-230 ◽

Cited By ~ 11

Author(s):

R. A. Valverde ◽

P. Lotrakul ◽

A. D. Landry ◽

J. E. Boudreaux

Keyword(s):

The United States ◽

Tomato Yellow Leaf ◽

Yield Reduction ◽

Yellow Leaf ◽

Degenerate Primers ◽

Tomato Plants ◽

First Report ◽

Biotype B ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (Geminiviridae) that causes a serious disease of tomato throughout the world. In 1997, the strain from Israel of TYLCV (TYLCV-IS) was found infecting tomatoes in Florida for the first time in the United States (1). During late spring of 2000, approximately 90% of the tomato plants (Lycopersicon esculentum) in a farm near New Orleans exhibited severe stunting, leaf cupping, and chlorosis. Symptoms were similar to those caused by TYLCV. Whiteflies (Bemisia tabaci biotype B) were present in the field but in relatively low numbers. The effect on yield reduction varied from negligible (late infections) to 100% (early infections). Six selected plants showing symptoms were assayed by polymerase chain reaction (PCR) using begomovirus-specific primers. Capsicum frutescens infected with an isolate of Texas pepper virus from Costa Rica was used as positive control. DNA was extracted using Plant DNAzol Reagent (GIBCO BRL). PCR was conducted using degenerate primers AV494/AC1048 that amplify the core coat protein region of most begomoviruses (2). PCR yielded a DNA fragment of approximately 550 bp, suggesting that a begomovirus was associated with the disease. The amplified DNA of one field isolate was cloned and the nucleotide (nt) sequence determined. Sequence comparisons with other begomoviruses in the GenBank Database indicated that the Louisiana isolate shared 100% nt identity with TYLCV-IS (GenBank Accession X76319). Successful transmission (100%) to Bonny Best tomato were obtained with four groups of 10 whiteflies each (B. tabaci biotype B) that fed on TYLCV-IS infected tomato plants. Acquisition and transmission feedings were for 2 days. In all cases, the virus was diagnosed by the ability to reproduce typical TYLCV-like symptoms in tomato and PCR. The virus was also successfully graft-transmitted to tomato cv. Bonny Best, Nicotiana benthamiana, and tomatillo (Physalis ixocarpa) using scions from tomato plants infected with a whitefly transmitted virus isolate. This is the first report of TYLCV-IS in Louisiana. References: (1) J. E. Polston et al. Plant Dis. 83:984–988, 1999. (2) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288–1293, 1996.

Download Full-text

First Report of Tomato yellow leaf curl virus Infecting Common Bean (Phaseolus vulgaris) in Greece

Plant Disease ◽

10.1094/pdis-91-4-0465c ◽

2007 ◽

Vol 91 (4) ◽

pp. 465-465 ◽

Cited By ~ 11

Author(s):

L. C. Papayiannis ◽

A. Paraskevopoulos ◽

N. I. Katis

Keyword(s):

Phaseolus Vulgaris ◽

Tomato Yellow Leaf ◽

Cultivated Plants ◽

Yellow Leaf ◽

Tomato Plants ◽

First Report ◽

Embl Accession ◽

Bean Plants ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl is one of the most devastating virus diseases of tomato (Lycopersicon esculentum Mill) crops worldwide. Several whitefly-transmitted viruses are associated with the disease and all are assigned to the genus Begomovirus, family Geminiviridae. In Greece, Tomato yellow leaf curl virus (TYLCV) was first reported to infect greenhouse and open-field tomatoes in 2000 (2). During 2006, a survey was conducted in the southwestern part of Peloponnese (mainland) within the areas of Kyparissia and Filiatra (Perfecture of Messinia) to identify the prevalence and natural hosts of the disease. During this survey, yellow mosaic, severe leaf curling, and leaf crumple symptoms were observed in greenhouse bean plants (Phaseolus vulgaris) that were cultivated together with tomatoes showing typical TYLCV symptoms. In all affected greenhouses, the incidence of the disease ranged from 1 to 5% in beans and 90 to 100% in tomato plants. Both bean and tomato plants were highly infested with Bemisia tabaci (Gennadius) populations and produced unmarketable fruits. Twenty-four symptomatic bean plants were collected from four greenhouses that tested positive by triple-antibody sandwich-ELISA using TYLCV-specific antibodies purchased from NEOGEN, EUROPE, Ltd. DNA was extracted from all infected bean plants, and a 580-bp fragment of the coat protein gene was amplified by PCR using the TY(+)/TY(-) primer pair (1). Amplified fragments were then analyzed by restriction fragment length polymorphism with Ava II cutter enzyme. Two DNA fragments of 277 and 302 bp in agarose gels were produced from all isolates and the restriction pattern corresponded to TYLCV. The amplified DNA from four infected bean plants was cloned and sequenced. All four sequences were 100% identical (EMBL Accession No. AM418398) and showed 99% nucleotide identity to a TYLCV isolate from Italy (EMBL Accession No. DQ144621). To our knowledge, this is the first report of TYLCV infection of P. vulgaris, which is an important commercial crop in Messinia, Greece. Within the last decade, TYLCV has emerged as an important pathogen for several cultivated plants in many regions and different TYLCV variants have been reported to infect P. vulgaris (3). Bean is often used as an intercrop between tomato crops, and thus, infected plants may serve as a potential reservoir for virus survival and spread (4). References: (1) G. P. Accotto et al. Eur. J. Plant Pathol. 106:179, 2000. (2) A. D. Avgelis et al. Plant Dis. 85:678, 2001. (3) J. Morris et al. EPPO Bull. 32:41, 2002. (4) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.

Download Full-text

Application of Whole Genome Resequencing in Mapping of a Tomato Yellow Leaf Curl Virus Resistance Gene

Scientific Reports ◽

10.1038/s41598-018-27925-w ◽

2018 ◽

Vol 8 (1) ◽

Cited By ~ 6

Author(s):

Yinlei Wang ◽

Jing Jiang ◽

Liping Zhao ◽

Rong Zhou ◽

Wengui Yu ◽

...

Keyword(s):

Resistance Gene ◽

Virus Resistance ◽

Tomato Yellow Leaf ◽

Whole Genome ◽

Yellow Leaf ◽

Genome Resequencing ◽

Whole Genome Resequencing ◽

Leaf Curl Virus ◽

Virus Resistance Gene ◽

Leaf Curl

Download Full-text

First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽

10.1094/pdis-03-12-0258-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1229-1229 ◽

Cited By ~ 3

Author(s):

Y. H. Ji ◽

Z. D. Cai ◽

X. W. Zhou ◽

Y. M. Liu ◽

R. Y. Xiong ◽

...

Keyword(s):

Common Bean ◽

Large Population ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Degenerate Primers ◽

Sequence Alignments ◽

First Report ◽

Sequence Identity ◽

Leaf Curl Virus ◽

Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Download Full-text

Whitefly-mediated transmission and subsequent acquisition of highly similar and naturally occurring Tomato yellow leaf curl virus variants

Phytopathology ◽

10.1094/phyto-06-21-0248-r ◽

2021 ◽

Author(s):

Wendy Marchant ◽

Saurabh Gautam ◽

Bhabesh Dutta ◽

Rajagopalbab Srinivasan

Keyword(s):

Amino Acids ◽

Mixed Infection ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Plant Interactions ◽

Tomato Plants ◽

Individual Host ◽

Field Samples ◽

Leaf Curl Virus ◽

Leaf Curl

Begomoviruses are whitefly-transmitted viruses that infect many agricultural crops. Numerous reports exist on individual host plants harboring two or more begomoviruses. Mixed infection allows recombination events to occur among begomoviruses. However, very few studies have examined mixed infection of different isolates/variants/strains of a Begomovirus species in hosts. In this study, the frequency of mixed infection of tomato yellow leaf curl virus (TYLCV) variants in field-grown tomato was evaluated. At least 60% of symptomatic field samples were infected with more than one TYLCV variant. These variants differed by a few nucleotides and amino acids resembling a quasispecies. Subsequently, in the greenhouse, single and mixed infection of two TYLCV variants (“variant #2” and “variant #4”) that shared 99.5% nucleotide identity and differed by a few amino acids was examined. Plant-virus variant-whitefly interactions including transmission of one and/or two variants, variants’ concentrations, competition between variants in inoculated tomato plants, and whitefly acquisition of one and/or two variants were assessed. Whiteflies transmitted both variants to tomato plants at similar frequencies; however, the accumulation of variant #4 was greater than variant#2 in tomato plants. Despite differences in variants’ accumulation in inoculated tomato plants, whiteflies acquired variant #2 and variant #4 at similar frequencies. Also, whiteflies acquired greater amounts of TYLCV from singly-infected plants than from mixed-infected plants. These results demonstrated that even highly similar TYLCV variants could differentially influence component (whitefly-variant-plant) interactions.

Download Full-text