A Bacterial Wilt and Root Rot of Sweet Potato Caused by Erwinia chrysanthemi

Lucerne disease surveys made in southern Queensland have shown the presence of seven fungal root and crown diseases. The two most wide spread and serious diseases are Phytophthora root rot (Phytophthora megasperma) and Colletotrichum crown rot (Colletotrichum trifolii). The general disease survey did not reveal the presence of bacterial wilt (Corynebacterium insidiosum) in Queensland. Studies made on the survival of lucerne populations for 2.5 years at three sites in Queensland have shown that disease was the major cause of all detected plant deaths.

Download Full-text

Three Highly Sensitive and High-Throughput Serological Approaches for Detecting Dickeya dadantii in Sweet Potato

Plant Disease ◽

10.1094/pdis-07-20-1551-re ◽

2021 ◽

Vol 105 (4) ◽

pp. 832-839

Author(s):

Wanqin He ◽

Deqing Huang ◽

Jiayu Wu ◽

Xue Li ◽

Yajuan Qian ◽

...

Keyword(s):

Sweet Potato ◽

Cell Lines ◽

Immunosorbent Assay ◽

Root Rot ◽

Enzyme Linked Immunosorbent Assay ◽

Dickeya Dadantii ◽

Crude Extracts ◽

Tissue Print ◽

Hybridoma Cell Lines ◽

Dot Elisa

Sweet potato stem and root rot is an important bacterial disease and often causes serious economic losses to sweet potato. Development of rapid and sensitive detection methods is crucial for diagnosis and management of this disease in field. Here, we report the production of four hybridoma cell lines (25C4, 16C10, 9B1, and 9H10) using Dickeya dadantii strain FY1710 as an immunogen. Monoclonal antibodies (MAbs) produced by these four hybridoma cell lines were highly specific and sensitive for D. dadantii detection. Indirect enzyme-linked immunosorbent assay (indirect-ELISA) results showed that the four MAbs 25C4, 16C10, 9B1, and 9H10 could detect D. dadantii in suspensions diluted to 4.89 × 104, 4.89 × 104, 9.78 × 104, and 9.78 × 104 CFU/ml, respectively. Furthermore, all four MAbs can react strongly and specifically with all four D. dadantii strains used in this study, not with the other seven tested bacterial strains. Using these four MAbs, three different serological approaches, triple-antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA), dot-ELISA, and tissue-print-ELISA, were developed for detection of D. dadantii in crude extracts prepared from field-collected sweet potato plants. Among these three methods, TAS-ELISA and dot-ELISA were used to detect D. dadantii in suspensions diluted up to 1.23 × 104 and 1.17 × 106 CFU/ml, respectively, or in sweet potato crude extracts diluted up to 1:3,840 and 1:1,920 (wt/vol, grams per milliliter), respectively. Surprisingly, both TAS-ELISA and dot-ELISA serological approaches were more sensitive than the conventional PCR. Analyses using field-collected sweet potato samples showed that the newly developed TAS-ELISA, dot-ELISA, or tissue-print-ELISA were reliable in detecting D. dadantii in sweet potato tissues. Thus, the three serological approaches were highly valuable for diagnosis of stem and root rot in sweet potato production.

Download Full-text

Resistance of Sweet Potato to Bacterial Root and Stem Rot Caused by Erwinia chrysanthemi

Plant Disease ◽

10.1094/pd-73-0984 ◽

1989 ◽

Vol 73 (12) ◽

pp. 984 ◽

Cited By ~ 3

Author(s):

C. A. Clark

Keyword(s):

Sweet Potato ◽

Erwinia Chrysanthemi ◽

Stem Rot

Download Full-text

Screening of Bacillus strains in biocontrol of pathogen Dickeya dadantii causing stem and root rot disease of sweet potato

Biocontrol Science and Technology ◽

10.1080/09583157.2020.1798356 ◽

2020 ◽

Vol 30 (11) ◽

pp. 1180-1198 ◽

Cited By ~ 1

Author(s):

Afsana Hossain ◽

Md. Mahidul Islam Masum ◽

Xiuqin Wu ◽

Yasmine Abdallah ◽

Solabomi Olaitan Ogunyemi ◽

...

Keyword(s):

Sweet Potato ◽

Root Rot ◽

Dickeya Dadantii ◽

Root Rot Disease ◽

Rot Disease ◽

Bacillus Strains

Download Full-text

Fusarium root rot caused by Fusarium solani on sweet potato (Ipomoea batatas) in South Korea

Canadian Journal of Plant Pathology ◽

10.1080/07060661.2017.1394914 ◽

2017 ◽

Vol 40 (1) ◽

pp. 90-95 ◽

Cited By ~ 4

Author(s):

Jung-Wook Yang ◽

Sang-Sik Nam ◽

Hyeong-Un Lee ◽

Kyu-Hwan Choi ◽

Se-Gu Hwang ◽

...

Keyword(s):

South Korea ◽

Sweet Potato ◽

Fusarium Solani ◽

Root Rot ◽

Ipomoea Batatas ◽

Fusarium Root Rot

Download Full-text

Evaluation of Phytophthora root rot- and bacterial wilt-resistant inbred lines and their crosses for use as rootstocks in pepper (Capsicum annuum L.)

Horticulture Environment and Biotechnology ◽

10.1007/s13580-016-0050-8 ◽

2016 ◽

Vol 57 (6) ◽

pp. 598-605 ◽

Cited By ~ 3

Author(s):

Alebel Mekuriaw Abebe ◽

Khin Pa Pa Wai ◽

Muhammad Irfan Siddique ◽

Hwang-Sung Mo ◽

Hee Ju Yoo ◽

...

Keyword(s):

Capsicum Annuum ◽

Bacterial Wilt ◽

Root Rot ◽

Inbred Lines ◽

Phytophthora Root Rot ◽

Capsicum Annuum L

Download Full-text

First Report of Fusarium solani Causing Fusarium Root Rot and Stem Canker on Storage Roots of Sweet Potato in China

Plant Disease ◽

10.1094/pdis-06-13-0651-pdn ◽

2014 ◽

Vol 98 (1) ◽

pp. 160-160 ◽

Cited By ~ 11

Author(s):

R.-Y. Wang ◽

B. Gao ◽

X.-H. Li ◽

J. Ma ◽

S.-L. Chen

Keyword(s):

Sweet Potato ◽

Fusarium Solani ◽

Root Rot ◽

Gene Sequence ◽

Fusarium Species ◽

Stem Canker ◽

Storage Roots ◽

Tubulin Gene ◽

Beta Tubulin ◽

Beta Tubulin Gene

China is the biggest sweet potato (Ipomoea batatas (L.) Lam) producer in the world and its total production is about 100 million tons per year. Surveys for diseases of sweet potato in storage were conducted from 2011 to 2013 in Hebei Province, China. The storage roots from cultivars such as Yizi 138 and Beijing 553 developed lesions on their surface during storage. Typical lesions consisted of alternating light and dark brown concentric rings that were darker than the root surface. The size of the lesions was 49 × 63 mm (11 to 75 × 36 to 80 mm, n = 20) on average. The lesion spot was slightly concave. Cutting the diseased roots revealed the lesions could extend into the center of the roots, often with cavities. It smelled bitter within the necrotic tissues and was dark brown or black. The disease incidence was about 10 to 20%. A Fusarium species was consistently isolated from the diseased roots (n = 20). Mycelial plugs from a pure culture of the pathogen on potato dextrose agar were placed on the surface of disinfected sweet potato roots incubated at 25°C with 80 to 90% relative humidity and uninoculated roots were used as control. The same symptom was observed after 14 days on all roots (n = 20) inoculated with the pathogen. The same Fusarium species was consistently reisolated from all lesions. The pathogen was cultured on carnation leaf agar (CLA) for 10 days at 25°C with a 12-h photoperiod. The fungus produced two types of spores on CLA: microconidia were thin-walled, hyaline, fusiform to ovoid, generally 1- or 2-celled, and 3.1 to 9.4 × 1.3 to 2.9 μm (n = 20); macroconidia were slightly curved with blunt and rounded apical cell and notched basal cells, mostly 4- to 8-celled, and 13.3 to 36.5 × 2.3 to 3.8 μm (n = 40). On the basis of morphological characteristics, the fungal isolates were identified as Fusarium solani (Mart.) Appel & Wollenw. emend. Snyd. & Hans. (1). The genomic DNA of the pathogen cultured in potato dextrose broth for 3 days at 25°C was extracted with the CTAB method. The ITS-rDNA sequence, a fragment of the translation elongation factor 1-alpha (EF-1α) gene sequence, and the beta tubulin gene sequence was amplified using the paired primers ITS1F/ITS4(CTTGGTCATTTAGAGGAAGTAA/TCCTCCGCTTATTGA TATGC), EF-1/EF-2 (ATGGGTAAGGARGACAAGAC/GGARGTACCAGTSATCATGTT) and Bt-1/Bt-2(AACATGCGTGAGATTGTAAGT/TCTGGATGTTGTTGGGAATCC), respectively. Those sequence showed 97% homology with ITS sequence of F. solani (GenBank Accession No. AF178407), 99% homology with EF-1α sequence of F. solani (JX945169, DQ247593, and DQ247354), and 98% homology with beta tubulin gene sequence of F. solani (AB553621), respectively. The new sequences of ITS-rDNA, EF-1α, and beta tubulin were deposited in GenBank (KF255997, KF255995, and KF255996). The pathogen was identified as F. solani based on its morphological and molecular characteristics. To our knowledge, this is the first report of F. solani-induced fusarium root rot and stem canker on sweet potato storage roots in China. A rootlet root rot attributed to F. solani in China was reported previously (2). References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual, Blackwell Publishing, Ames, IA, 2006. (2) Q. J. Liu et al. Acta Phytopathol. Sin. 12(3):21,1982.

Download Full-text