Monitoring benzimidazole resistance in Phyllosticta citricarpa using a molecular assay targeting mutations in codons 198 and 200 of the beta-tubulin gene

Citrus black spot (CBS), caused by Phyllosticta citricarpa, is an economically important disease, which is effectively controlled by repeated fungicide applications to protect fruit from infection. Systemic fungicides such as benzimidazoles are widely used for controlling CBS in South Africa, but the molecular mechanisms of benzimidazole resistance in P. citricarpa had not been investigated. Analysis of the nucleotide sequence of the beta-tubulin gene in P. citricarpa revealed mutations inducing three amino acid replacements in benzimidazole-resistant isolates when compared to that of sensitive strains. Amino acid replacements in benzimidazole-resistant isolates included the change of glutamic acid to either alanine or lysine at codon 198 of the beta-tubulin gene and the change from phenylalanine to tyrosine at codon 200. All three mutations were previously implicated in benzimidazole resistance in several fungal pathogens. A polymerase chain reaction (PCR) assay was designed to amplify a portion of the beta-tubulin gene, which is subsequently sequenced to identify benzimidazole resistance in P. citricarpa. This PCR and sequence assay was found to be a more rapid and reliable method for detecting resistance compared to the fungicide-amended plate tests and is valuable for monitoring the occurrence of benzimidazole-resistant P. citricarpa and for assessment of the need for alternative CBS management practices.

First report of root rot and damping off disease in soybean (Glycine max) caused by Pythium deliense in India

Seedling rot symptoms were observed at Research Farm of ICAR-Indian Institute of Soybean Research, Indore, India. The infected seedlings had water-soaked lesions on the cotyledons and hypocotyls that gradually developed into brown lesions and further progressed to soft rot. These seedlings could be easily pulled-off from the soil. The diseased seedling samples were rinsed thoroughly in flowing tap water and eventually in double-distilled water and were subjected to surface sterilization with NaOCl(1%). The samples were further washed thrice with sterilized double distilled water. The root fragments were properly sterilized and placed on V8 juice agar as well as potato dextrose agar (PDA) media plates. These plates were incubated at 27± 2°C for 48 hours. After incubation, white fluffy mycelial growth was observed on both the media. The fungus was observed to produce brown round vesicles with mycelial attachment when observed under a compound microscope magnification of 20X. Subcultures of these fungal isolates were placed on PDA media and incubated for 7 days at (27±2°C). The pure fungal culture along with PDA media was cut into small pieces and mixed with a sterilized soil mix (70% soil and 20% sand and 10 % vermicompost) at the rate of one petri dish per pot (plastic pots of 10 cm depth) and covered properly with tin foil. These pots were subjected to substrate colonization for 10 days at room temperature and the substrates were shaken occasionally to improve infection efficiency of pathogen by enhacing inocula production. Seeds of soybean variety, Gaurav were sown in three replicates, each with 10 seeds in the inoculated pots. The control was established by sowing seeds in the soil mix, amended previously with plain PDA. The pots were maintained at 25 to 30 ºC with 45 to 50 % of soil moisture content under glasshouse conditions. In the inoculated pots, the fungus killed soybean seeds before and after germination. Some of the plants that emerged developed lesions were initially yellow and gradually turned to necrotic later. These lesions were found on the roots of the plant and at the base of the hypocotyl region. The soybean seeds planted in un-inoculated soil emerged but did not develop any necrotic lesions. When the causal organism was re-isolated from the diseased plant part it was found to be morphologically and culturally similar to theoriginal culture. The isolated pathogen was thus classified as Pythium deliense based on morphological and cultural characters as well as the pathogenicity test. (Plaats-Niterink 1981). For further confirmation of pathogen’s identity, complete genomic DNA of the fungus was extracted using the HiPurA Fungal DNA Purification Kit (HiMedia, India). The nuclear rDNA region of the internal transcribed spacer and 5.8S rDNA was amplified by universal primers ITS 1 (5’ TCCGTAGGTGAACCTGCGG 3’) and ITS 4 (5’ TCCTCCGCTTATTGATATGC 3’) as mentioned by White et al. (1990). Amplification was performed in a 12.5 μL reaction volume containing 1.5 μL of 10X PCR buffer, 3 μL of 25 mM MgCl2, 1.2 μL of 2.5 mM deoxyribonucleotide triphosphates (dNTPs), 0.7 μL of 10 pM each primer (ITS 1 and ITS 4), and 1 μL of DNA template, 0.3 μL of 1 units of Taq DNA polymerase. The thermal cycle consisted of 4-minute initial denaturation at 94°C, followed by 35 cycles of 1-minute denaturation at 95°C, 30-second primer annealing at 57 The PCR products were sequenced and submitted to NCBI (GenBank Acc. MT2665888). The BLAST study of the fungal isolate showed 100% similarity with reference sequences of Pythium deliense (MT126658.1) in the GenBank. The isolate was identified as Pythium deliense on the basis of molecular analysis, corroborating the above morphological identification. Further, the beta-tubulin gene (Bt) was amplified with primers BtF (5’GCTGGCCTTGATGTTGTTCG3’) and BtR (5’CGTGA AGAGTACCCAGAC CG3’). Similarly, the cytochrome oxidase gene was amplified with primers COXF (5’GGTGCTTTTTCAGGTGTAGTTGG3’) and COXR (5’GCTCCTGCTAATACTGGTAATG T3’). The PCR products were sequenced and submitted to GenBank with accession numbers MW196444 and MW196445 respectively. In BLAST analysis, the beta-tubulin gene exhibited 100 percent sequence homology with Pythium deliense (MK752986.1) and cytochrome oxidase gene also showed 100 % sequence homology with Pythium deliense (HQ708566.1). Pythium deliense has been recorded worldwide causing disease in many agricultural crops including soybean but to our knowledge, this is the first study in India of the genus Pythium and Pythium deliense causing root rot and damping off of soybean.

Assessment of the suitability of marker fragments DNA sequences of the internal transcribed spacer region (ITS), beta-tubulin gene (TUB) and elongation factor (EF1) genes for diagnostics of Fusarium tricinctum species complex in Russian in grain products

By results of laboratory researches from plant samples of grain crops species Fusarium avenaceum, Fusarium tricinctum and Fusarium acuminatum related to Fusarium tricinctum species complex were isolated and identified, based on cultural and morphological characteristics, molecular-genetic analysis of 3 DNA fragments was performed: internal transcribed spacer (ITS) site, beta-tubulin gene site (TUB), elongation factor gene site (EF1) showed insignificant intraspecific and interspecific variability at ITS and EF1 sites, which may negatively affect the reliability of target species identification, TUB site was more effective for distinguishing and identifying the studied species, due to significant intraspecific and interspecific variability

Potential possibility of using the DNA regions of the internal transcribed spacer ITS and the beta-tubulin gene TUB in the diagnosis of the pathogen Mycosphaerella linicola Naumov

During the study, the suitability of the ITS and TUB DNA regions was shown for identifying the target species at the genetic level. However, these DNA regions do not reveal significant differences between the sequences of the target species from different geographic regions. However, when constructing dendrograms of similarities and differences, the sequential differentiation between isolates at the population level was found, which may further affect the results of identification of the target species.

Drug-Resistant Aspergillus flavus Is Highly Prevalent in the Environment of Vietnam: A New Challenge for the Management of Aspergillosis?

The burden of aspergillosis, especially Chronic Pulmonary Aspergillosis, is increasingly recognized, and the increasing presence of azole-resistant environmental Aspergillus fumigatus has been highlighted as a health risk. However, a sizable minority of aspergillosis is caused by Aspergillus flavus, which is assumed to be sensitive to azoles but is infrequently included in surveillance. We conducted environmental sampling at 150 locations in a rural province of southern Vietnam. A. flavus isolates were identified morphologically, their identity was confirmed by sequencing of the beta-tubulin gene, and then they were tested for susceptibility to azoles and amphotericin B according to EUCAST methodologies. We found that over 85% of A. flavus isolates were resistant to at least one azole, and half of them were resistant to itraconazole. This unexpectedly high prevalence of resistance demands further investigation to determine whether it is linked to agricultural azole use, as has been described for A. fumigatus. Clinical correlation is required, so that guidelines can be adjusted to take this information into account.

Quantitative benzimidazole resistance and fitness effects of parasitic nematode beta-tubulin alleles

Infections by parasitic nematodes inflict a huge burden on the health of humans and livestock throughout the world. Anthelmintic drugs are the first line of defense against these infections. Unfortunately, resistance to these drugs is rampant and continues to spread. To improve treatment strategies, we must understand the genetics and molecular mechanisms that underlie resistance. Studies of the fungus Aspergillus nidulans and the free-living nematode Caenorhabditis elegans discovered that a beta-tubulin gene is mutated in benzimidazole (BZ) resistant strains. In parasitic nematode populations, three canonical beta-tubulin alleles, F200Y, E198A, and F167Y, have long been correlated with resistance. Additionally, improvements in sequencing technologies have identified new alleles - E198V, E198L, E198K, E198I, and E198Stop - also correlated with BZ resistance. However, none of these alleles have been proven to cause resistance. To empirically demonstrate this point, we independently introduced the three canonical alleles as well as two of the newly identified alleles, E198V and E198L, into the BZ susceptible C. elegans N2 genetic background. These genome-edited strains were exposed to both albendazole and fenbendazole to quantitatively measure animal responses to BZs. We used a range of doses for each BZ compound to define response curves and found that all five of the alleles conferred resistance to BZ compounds equal to a loss of the entire beta-tubulin gene. These results prove that the parasite beta-tubulin alleles cause resistance. The E198V allele is found at low frequencies in natural parasite populations, suggesting that it could affect fitness. We performed competitive fitness assays and demonstrated that the E198V allele reduces animal health, supporting the hypothesis that this allele is less fit in field populations. Overall, we present a powerful platform to quantitatively assess anthelmintic resistance and effects of specific resistance alleles on organismal fitness in the presence or absence of the drug.HighlightsAll three canonical parasitic nematode beta-tubulin alleles (F167Y, E198A, F200Y) and two newly identified alleles (E198V, E198L) confer equal levels of benzimidazole resistance in a defined genetic background using single-generation, high-replication drug response assays.Beta-tubulin variants are strongly selected in albendazole conditions in multigenerational competitive fitness assays, but these alleles confer different levels of benzimidazole resistance over time.Only the E198V allele confers a fitness cost in control (non-benzimidazole) conditions as compared to all other tested beta-tubulin alleles, suggesting that this intermediate allele might only be found in field populations at low frequency because it causes reduced fitness.Graphical Abstract