scholarly journals ‘Candidatus Phytoplasma palmicola’, associated with a lethal yellowing-type disease of coconut (Cocos nucifera L.) in Mozambique

2014 ◽  
Vol 64 (Pt_6) ◽  
pp. 1890-1899 ◽  
Author(s):  
Nigel A. Harrison ◽  
Robert E. Davis ◽  
Carlos Oropeza ◽  
Ericka E. Helmick ◽  
María Narváez ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Cocos Nucifera ◽  
Rrna Gene ◽  
Similarity Coefficients ◽  
Gene Sequences ◽  
16S Rrna Gene Sequences ◽  
Content Type ◽  
Lethal Yellowing ◽  
The 16S Rrna Gene

In this study, the taxonomic position and group classification of the phytoplasma associated with a lethal yellowing-type disease (LYD) of coconut (Cocos nucifera L.) in Mozambique were addressed. Pairwise similarity values based on alignment of nearly full-length 16S rRNA gene sequences (1530 bp) revealed that the Mozambique coconut phytoplasma (LYDM) shared 100 % identity with a comparable sequence derived from a phytoplasma strain (LDN) responsible for Awka wilt disease of coconut in Nigeria, and shared 99.0–99.6 % identity with 16S rRNA gene sequences from strains associated with Cape St Paul wilt (CSPW) disease of coconut in Ghana and Côte d’Ivoire. Similarity scores further determined that the 16S rRNA gene of the LYDM phytoplasma shared <97.5 % sequence identity with all previously described members of ‘Candidatus Phytoplasma ’. The presence of unique regions in the 16S rRNA gene sequence distinguished the LYDM phytoplasma from all currently described members of ‘Candidatus Phytoplasma ’, justifying its recognition as the reference strain of a novel taxon, ‘Candidatus Phytoplasma palmicola’. Virtual RFLP profiles of the F2n/R2 portion (1251 bp) of the 16S rRNA gene and pattern similarity coefficients delineated coconut LYDM phytoplasma strains from Mozambique as novel members of established group 16SrXXII, subgroup A (16SrXXII-A). Similarity coefficients of 0.97 were obtained for comparisons between subgroup 16SrXXII-A strains and CSPW phytoplasmas from Ghana and Côte d’Ivoire. On this basis, the CSPW phytoplasma strains were designated members of a novel subgroup, 16SrXXII-B.

scholarly journals Molecular Characterization of anEndozoicomonas-Like Organism Causing Infection in the King Scallop (Pecten maximusL.)

2017 ◽  
Vol 84 (3) ◽  
Author(s):  
Irene Cano ◽  
Ronny van Aerle ◽  
Stuart Ross ◽  
David W. Verner-Jeffreys ◽  
Richard K. Paley ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Molecular Characterization ◽  
Mass Mortality ◽  
Rrna Gene ◽  
Gene Sequences ◽  
16S Rrna Gene Sequences ◽  
Content Type ◽  
The 16S Rrna Gene

ABSTRACTOne of the fastest growing fisheries in the UK is the king scallop (Pecten maximusL.), also currently rated as the second most valuable fishery. Mass mortality events in scallops have been reported worldwide, often with the causative agent(s) remaining uncharacterized. In May 2013 and 2014, two mass mortality events affecting king scallops were recorded in the Lyme Bay marine protected area (MPA) in Southwest England. Histopathological examination showed gill epithelial tissues infected with intracellular microcolonies (IMCs) of bacteria resemblingRickettsia-like organisms (RLOs), often with bacteria released in vascular spaces. Large colonies were associated with cellular and tissue disruption of the gills. Ultrastructural examination confirmed the intracellular location of these organisms in affected epithelial cells. The 16S rRNA gene sequences of the putative IMCs obtained from infected king scallop gill samples, collected from both mortality events, were identical and had a 99.4% identity to 16S rRNA gene sequences obtained from “CandidatusEndonucleobacter bathymodioli” and 95% withEndozoicomonasspecies.In situhybridization assays using 16S rRNA gene probes confirmed the presence of the sequenced IMC gene in the gill tissues. Additional DNA sequences of the bacterium were obtained using high-throughput (Illumina) sequencing, and bioinformatic analysis identified over 1,000 genes with high similarity to protein sequences fromEndozoicomonasspp. (ranging from 77 to 87% identity). Specific PCR assays were developed and applied to screen for the presence of IMC 16S rRNA gene sequences in king scallop gill tissues collected at the Lyme Bay MPA during 2015 and 2016. There was 100% prevalence of the IMCs in these gill tissues, and the 16S rRNA gene sequences identified were identical to the sequence found during the previous mortality event.IMPORTANCEMolluscan mass mortalities associated with IMCs have been reported worldwide for many years; however, apart from histological and ultrastructural characterization, characterization of the etiological agents is limited. In the present work, we provide detailed molecular characterization of anEndozoicomonas-like organism (ELO) associated with an important commercial scallop species.

scholarly journals First report of strains related to the phytoplasma associated with Tanzanian Lethal Decline on Cocos nucifera on the western coast of Madagascar

Plant Disease ◽  
2021 ◽  
Author(s):  
Fabian Pilet ◽  
Emilson Rakotoarisoa ◽  
M. R. Rakotomalala ◽  
Sabine Sisteron ◽  
Harisoa Nirina Razakamanana ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Cocos Nucifera ◽  
Reference Sequence ◽  
Rrna Gene ◽  
Western Coast ◽  
Gene Sequences ◽  
16S Rrna Gene Sequences ◽  
Seca Gene ◽  
Lethal Yellowing

Madagascar is a high diversity hotspot in the world, and palms are highly represented with nearly 200 endemic species (Rakotoarinivo et al., 2014). Coconut tree (Cocos nucifera) could have been introduced in Madagascar by Austronesians around AD 400 or 700 (Beaujard, 2011). Sporadic coconut trees showing very severe wilt were observed in 2016 in three localities of the western and northern coast of the island: Katsepy (Sample MG16-001), Antsohyhi (MG16-004 and MG16-005) and Ambaritsatrana (MG16-010). Symptoms correspond on a severe ascendant wilt of the leaves, associated with necrosis of the inflorescences and absence of nuts and death of all trees was confirmed eventually. We investigated the implication of phytoplasma because of the apparent similarity in the symptomatology with Coconut Lethal Yellowing Disease and Coconut Lethal Decline occurring in East Africa (Mpunami et al., 1999), and because the western coast of Madagascar faces the Mozambican channel only 400 km apart from areas along the East African coast where those two diseases occur. Symptomatic (n=4) and asymptomatic (n=6) coconut trees were sampled by stem drilling. DNA was extracted from sawdust samples using a modified CTAB protocol (Mpunami et al., 1999). A direct polymerase chain reaction (PCR) targeting the 16S rRNA gene plus Internal transcribed spacer with the P1-1T (AAGAGTTTGATCCTGGCTCAGGAT)/P7 primers (Schneider et al., 1998) amplified a product of about 1.8 kb for MG16-001 and MG16-005 samples only, while the four DNA extracts from symptomatic trees showed a 1.2 kb amplicon by nested PCR using R16F2n/R16R2 primer pairs in the second round (Lee et al., 1998). Amplification of the secA gene using the primer pair secAFor1/secARev3 (Hodgetts et al., 2008) was performed in a single round and gave a product of 850 bp exclusively for the symptomatic tree DNAs. All amplicons were double strand sequenced (Genewiz, UK). Corresponding high quality sequences were deposited in GenBank and submitted to Blastn on NCBI. The partial 16S rRNA gene sequences (accessions MN264629 to MN264632) obtained using R16F2n/R16R2 primers presented the highest similarity (from 99.47 to 99.56%) to the reference sequence for the phytoplasma associated with the Tanzanian Lethal Decline (GenBank accession X80117). This genetic proximity of the Malagasy strains was confirmed by the partial secA gene sequences (accessions MN267853 to MN267856) presenting the highest similarity (from 89.92 to 90.70%) to the Tanzanian Lethal Decline phytoplasma secA gene partial sequence (Genbank accession KJ462071). Full-length 16S rRNA gene sequences of MG16-001 and MG16-005 strains (accessions MN388765 and MN388766) were submitted to iPhyClassifier virtual RFLP tool (Zhao et al., 2009). The iPhyClassifier tool confirmed that Malagasy strains are related to the reference strain X80117 but belong to a different 16Sr subgroup (similarity coefficient from 0.90 to 0.93, Dev. 1). Both Malagassy strains and LDT phytoplasma should be assigned to a new 16Sr group since X80117 is itself erroneously assigned to 16SrIV group while the closest reference sequence AF509322, 16SrXXIV-A, shared only a similarity of 0.83 (Dev. 1). Occurrence of a phytoplasma associated with a lethal yellowing type syndrome in Madagascar could represent a dangerous threat to coconut crops that play an important socio-economic role in the coastal areas, but also to the many endemic palm species already on high extinction risk.

Cellulomonas soli sp. nov. and Cellulomonas oligotrophica sp. nov., isolated from soil

2013 ◽  
Vol 63 (Pt_1) ◽  
pp. 60-65 ◽  
Author(s):  
Kouta Hatayama ◽  
Kouji Esaki ◽  
Teruhiko Ide
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Type Strain ◽  
Rrna Gene ◽  
Gene Sequences ◽  
16S Rrna Gene Sequences ◽  
Content Type ◽  
Link Type ◽  
Gene Similarity ◽  
The 16S Rrna Gene

Two novel bacterial strains, designated Kc1T and Kc5T, were isolated from soil in Japan. Cells of the novel strains were Gram-reaction-positive, aerobic or facultatively anaerobic, motile rods. Phylogenetic analyses based on 16S rRNA gene sequences indicated that both strains belonged to the genus Cellulomonas . The 16S rRNA gene sequences of strains Kc1T and Kc5T showed closest similarity to that of Cellulomonas terrae DB5T (98.1 % and 98.4 % similarity, respectively), and the 16S rRNA gene similarity between the two novel strains was 97.8 %. In both strains, the major menaquinone was MK-9(H4), the predominant polar lipids were diphosphatidylglycerol and phosphatidylinositol mannosides, and the peptidoglycan contained ornithine and glutamic acid. Cell-wall sugars were identified as rhamnose, galactose and mannose in strain Kc1T and rhamnose and glucose in strain Kc5T. The DNA G+C contents of strains Kc1T and Kc5T were 73.6 mol% and 75.8 mol%, respectively. Based on the chemotaxonomic and physiological data and the results of DNA–DNA hybridizations, the two strains represent two novel species within the genus Cellulomonas , for which the names Cellulomonas soli sp. nov. (type strain Kc1T  = DSM 24484T  = JCM 17535T) and Cellulomonas oligotrophica sp. nov. (type strain Kc5T = DSM 24482T = JCM 17534T) are proposed.

Methylomarinum vadi gen. nov., sp. nov., a methanotroph isolated from two distinct marine environments

2013 ◽  
Vol 63 (Pt_3) ◽  
pp. 1073-1082 ◽  
Author(s):  
Hisako Hirayama ◽  
Hiroyuki Fuse ◽  
Mariko Abe ◽  
Masayuki Miyazaki ◽  
Takamichi Nakamura ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Rrna Gene ◽  
Type I ◽  
Marine Environments ◽  
Gene Sequences ◽  
16S Rrna Gene Sequences ◽  
Content Type ◽  
Link Type ◽  
The 16S Rrna Gene

Two aerobic methane-oxidizing bacterial strains were isolated from distinct marine environments in Japan. Strains IT-4T and T2-1 were Gram-stain-negative, aerobic, motile, plump short rods or oval-shaped bacteria with a single polar flagellum and type I intracytoplasmic membranes. They were obligate methanotrophs that grew only on methane or methanol. Each strain possessed the particulate methane monooxygenase (pMMO). The ribulose monophosphate pathway was operative for carbon assimilation. The strains grew best at 37 °C, and did not grow at 45 °C. NaCl was required for growth within a concentration range of 1–8 % (w/v). The major phospholipid fatty acids were C16 : 0, C16 : 1ω7c, and C16 : 1ω5t. The major isoprenoid quinone was MQ-8. The DNA G+C content was 50.9–51.7 mol%. The 16S rRNA gene sequences of the strains showed 99.4 % similarity to each other, and DNA–DNA hybridization analysis indicated that the strains were representatives of the same species. The 16S rRNA gene sequences were highly similar to some marine environmental sequences (94.0–97.7 % similarity), but did not show similarities more than 94 % with sequences of members of other related genera, such as Methylomicrobium , Methylobacter , Methylomonas and Methylosarcina . Phylogenies based on 16S rRNA gene sequences and deduced partial PmoA sequences, and the physiological and chemotaxonomic characteristics revealed that strains IT-4T and T2-1 represent a novel species of a new genus in the family Methylococcaceae , for which the name Methylomarinum vadi gen. nov., sp. nov. is proposed. The type strain is IT-4T ( = JCM 13665T = DSM 18976T).

scholarly journals Geothermomicrobium terrae gen. nov., sp. nov., a novel member of the family Thermoactinomycetaceae

2014 ◽  
Vol 64 (Pt_9) ◽  
pp. 2998-3004 ◽  
Author(s):  
En-Min Zhou ◽  
Tian-Tian Yu ◽  
Lan Liu ◽  
Hong Ming ◽  
Yi-Rui Yin ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Polar Lipids ◽  
Rrna Gene ◽  
Gene Sequences ◽  
16S Rrna Gene Sequences ◽  
Content Type ◽  
Link Type ◽  
The Family ◽  
The 16S Rrna Gene

Strains YIM 77562T and YIM 77580, two novel Gram-staining-positive, filamentous bacterial isolates, were recovered from the Rehai geothermal field, Tengchong, Yunnan province, south-west China. Good growth was observed at 50–55 °C and pH 7.0. Aerial mycelium was absent on all media tested. Substrate mycelium was well-developed, long and moderately flexuous, and formed abundant, single, warty, ornamented endospores. Phylogenetic analysis of the 16S rRNA gene sequences of the two strains indicated that they belong to the family Thermoactinomycetaceae . Similarity levels between the 16S rRNA gene sequences of the two strains and those of type strains of members of the Thermoactinomycetaceae were 88.33–93.24 %; the highest sequence similarity was with Hazenella coriacea DSM 45707T. In both strains, the predominant menaquinone was MK-7, the diagnostic diamino acid was meso-diaminopimelic acid and the major cellular fatty acids were iso-C14 : 0, iso-C15 : 0 and iso-C16 : 0. The major polar lipids were diphosphatidylglycerol, phosphatidylmethylethanolamine, unidentified polar lipids and unidentified phospholipids. The genomic DNA G+C contents of strains YIM 77562T and YIM 77580 were 45.5 and 44.2 mol%, respectively. DNA–DNA relatedness data suggest that the two isolates represent a single species. Based on phylogenetic analyses and physiological and biochemical characteristics, it is proposed that the two strains represent a single novel species in a new genus, Geothermomicrobium terrae gen. nov., sp. nov. The type strain of Geothermomicrobium terrae is YIM 77562T ( = CCTCC AA 2011022T = JCM 18057T).

Reclassification of Parvularcula flava as Aquisalinus luteolus nom. nov. and emended description of the genus Aquisalinus

2021 ◽  
Vol 71 (10) ◽  
Author(s):  
Jun-Jie Ying ◽  
Zhi-Cheng Wu ◽  
Yuan-Chun Fang ◽  
Lin Xu ◽  
Cong Sun
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Type Species ◽  
Comparative Genomic ◽  
Rrna Gene ◽  
Gene Sequences ◽  
16S Rrna Gene Sequences ◽  
Content Type ◽  
Link Type ◽  
Type Strains

Parvularcula flava was proposed as a novel member of genus Parvularcula in 2016. Some time earlier, Aquisalinus flavus has been proposed as a novel species of a novel genus named Aquisalinus . When comparing the 16S rRNA gene sequences of type strains P. flava NH6-79T and A. flavus D11M-2T, they showed 97.9 % sequence identity, much higher than the sequence identities 92.7–94.3 % between P. flava NH6-79T and type strains in the genus Parvularcula , indicating that the later proposed novel taxon Parvularcula flava need reclassification. The phylogenetic trees based on 16S rRNA gene sequences and genome sequences both showed that P. flava NH6-79T and A. flavus D11M-2T formed a separated branch away from strains in the genera Parvularcula , Marinicaulis and Amphiplicatus . The average amino acid identity and average nucleotide identity values of P. flava NH6-79T and A. flavus D11M-2T were 87.9 and 85.0 %, respectively, much higher than the values between P. flava NH6-79T and other closely related type strains (54.3 %–58.1 % and 68.6–70.4 %, respectively). P. flava NH6-79T and A. flavus D11M-2T also contained summed feature 8 (C18 : 1  ω6c and/or C18 : 1  ω7c) and C16 : 0 as major fatty acids, distinguishing them from other closely related taxa. Based on the results of the phylogenetic, comparative genomic and phenotypic analyses, Parvularcula flava should be reclassified as Aquisalinus luteolus nom. nov. and the description of genus Aquisalinus is emended.

scholarly journals Variovorax gossypii sp. nov., isolated from Gossypium hirsutum

2015 ◽  
Vol 65 (Pt_12) ◽  
pp. 4335-4340 ◽  
Author(s):  
Peter Kämpfer ◽  
Hans-Jürgen Busse ◽  
John A. McInroy ◽  
Stefanie P. Glaeser
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Gossypium Hirsutum ◽  
Dna Hybridization ◽  
Phylogenetic Trees ◽  
Rrna Gene ◽  
Gene Sequences ◽  
16S Rrna Gene Sequences ◽  
Polar Lipid Profile ◽  
The 16S Rrna Gene

A beige-pigmented bacterial strain (JM-310T), isolated from the healthy internal root tissue of 4-week-old cotton (Gossypium hirsutum, cultivar ‘DES-119’) in Tallassee (Macon county), Alabama, USA, was studied taxonomically. The isolate produced small rod-shaped cells, which showed a Gram-negative staining behaviour. A comparison of the 16S rRNA gene sequence of the isolate revealed 99.2, 98.8, 98.7, 98.7, 98.1 and 97.6 % similarity to the 16S rRNA gene sequences of the type strains of Variovorax paradoxus, Variovorax boronicumulans, Variovorax ginsengisoli, Variovorax soli, Variovorax defluvii and Variovorax dokdonensis, respectively. In phylogenetic trees based on 16S rRNA gene sequences, strain JM-301T was placed within the monophyletic cluster of Variovorax species. The fatty acid profile of strain JM-310T consisted mainly of the major fatty acids C16 : 0, C10 : 0 3-OH and summed feature 4 (iso-C15 : 0 2-OH/C16 : 1ω7c/t). The quinone system of strain JM-310T contained predominantly ubiquinone Q-8 and lesser amounts of Q-7 and Q-9. The major polyamine was putrescine and the diagnostic polyamine 2-hydroxyputrescine was detected as well. The polar lipid profile consisted of the major lipids phosphatidylethanolamine, phosphatidylglycerol, diphospatidylglycerol and several unidentified lipids. DNA–DNA hybridization experiments with V. paradoxus LMG 1797T, V. boronicumulans 1.22T, V. soli KACC 11579T and V. ginsengisoli 3165T gave levels of relatedness of < 70 %. These DNA–DNA hybridization results in addition to differential biochemical properties indicate clearly that strain JM-310T is a member of a novel species, for which the name Variovorax gossypii sp. nov. is proposed. The type strain is JM-310T ( = LMG 28869T = CIP 110912T = CCM 8614T).

scholarly journals Sporosarcina newyorkensis sp. nov. from clinical specimens and raw cow’s milk

2012 ◽  
Vol 62 (2) ◽  
pp. 322-329 ◽  
Author(s):  
William J. Wolfgang ◽  
An Coorevits ◽  
Jocelyn A. Cole ◽  
Paul De Vos ◽  
Michelle C. Dickinson ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
New York State ◽  
23S Rrna ◽  
Rrna Gene ◽  
The Novel ◽  
Gene Sequences ◽  
16S Rrna Gene Sequences ◽  
Clinical Specimens ◽  
The 16S Rrna Gene

Twelve independent isolates of a Gram-positive, endospore-forming rod were recovered from clinical specimens in New York State, USA, and from raw milk in Flanders, Belgium. The 16S rRNA gene sequences for all isolates were identical. The closest species with a validly published name, based on 16S rRNA gene sequence, is Sporosarcina koreensis (97.13 % similarity). DNA–DNA hybridization studies demonstrate that the new isolates belong to a species distinct from their nearest phylogenetic neighbours. The partial sequences of the 23S rRNA gene for the novel strains and their nearest neighbours also provide support for the novel species designation. Maximum-likelihood phylogenetic analysis of the 16S rRNA gene sequences confirmed that the new isolates are in the genus Sporosarcina. The predominant menaquinone is MK-7, the peptidoglycan has the type A4α l-Lys–Gly–d-Glu, and the polar lipids consist of diphosphatidylglycerol, phosphatidylglycerol and phosphatidylethanolamine. The predominant fatty acids are iso-C14 : 0, iso-C15 : 0 and anteiso-C15 : 0. In addition, biochemical and morphological analyses support designation of the twelve isolates as representatives of a single new species within the genus Sporosarcina, for which the name Sporosarcina newyorkensis sp. nov. (type strain 6062T  = DSM 23544T  = CCUG 59649T  = LMG 26022T) is proposed.

Sphingobium fontiphilum sp. nov., isolated from a freshwater spring

2013 ◽  
Vol 63 (Pt_5) ◽  
pp. 1906-1911 ◽  
Author(s):  
Shih-Yi Sheu ◽  
Yu-Wen Shiau ◽  
Yan-Ting Wei ◽  
Wen-Ming Chen
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Type Species ◽  
Phylogenetic Analyses ◽  
Rrna Gene ◽  
Gene Sequences ◽  
16S Rrna Gene Sequences ◽  
Phenotypic Data ◽  
Content Type ◽  
Link Type

To investigate the biodiversity of bacteria in the spring water of the Chengcing Lake Park in Taiwan, a Gram-stain-negative, rod-shaped, non-motile, non-spore-forming and aerobic bacterial strain, designated strain Chen16-4T, was isolated and characterized in a taxonomic study using a polyphasic approach. Phylogenetic analyses based on 16S rRNA gene sequences showed that the closest relatives of strain Chen16-4T were Sphingobium amiense YTT, Sphingobium yanoikuyae GIFU 9882T and Sphingobium scionense WP01T, with sequence similarities of 97.6, 97.1 and 97.0 %, respectively. A phylogenetic tree obtained with 16S rRNA gene sequences indicated that strain Chen16-4T and these three closest relatives formed an independent phylogenetic clade within the genus Sphingobium . The polar lipid pattern, the presence of spermidine and ubiquinone Q-10, the predominance of C18 : 1ω7c in the cellular fatty acid profile and the DNA G+C content also supported affiliation of the isolate to the genus Sphingobium . The DNA–DNA relatedness of strain Chen16-4T with respect to recognized species of the genus Sphingobium was less than 70 %. On the basis of the genotypic, chemotaxonomic and phenotypic data, strain Chen16-4T represents a novel species in the genus Sphingobium , for which the name Sphingobium fontiphilum sp. nov. is proposed. The type strain is Chen16-4T ( = BCRC 80308T = LMG 26342T = KCTC 23559T).

Sign in / Sign up

Export Citation Format

Share Document