Non-transmissibility of Pepper whitefly borne vein yellows virus (PeWBVYV) by the Mediterranean species of Bemisia tabaci and identification of a candidate insect receptor protein for poleroviruses

AbstractRecent reports of transmission of poleroviruses by whiteflies is indicative of evolution of new virus-vector relationships. Pepper whitefly-borne vein yellows virus (PeWBVYV), was the first report of a polerovirus infecting pepper in Israel which was transmitted by whiteflies (MEAM1) and not aphids. This study reports the inability of the Mediterranean species (MED, Q biotype) of B. tabaci to transmit PeWBVYV. However we show that non-transmission of PeWBVYV by MED is not due to the lack of interaction with the GroEL protein of the Hamiltonella symbiont. Although not transmitted by MED, PeWBVYV was detected in its hemolymph, indicating its translocation across the MED midgut barrier. The aphid transmitted Pepper vein yellows virus 2 (PeVYV-2) was also detected in the hemolymph of MEAM1 whiteflies but PeWBVYV could not be detected in the aphid hemolymph. Interestingly, relative amounts of PeWBVYV in the hemolymph of the, MED was much lower than in hemolymph of MEAM1 whiteflies. We also identified a candidate receptor protein, complement component 1Q sub-complement binding protein (C1QBP) which interacts with the capsid proteins of PeWBVYV and PeVYV-2 but not with the whitefly transmitted Tomato yellow leaf curl virus by a yeast two-hybrid approach using the minor capsid protein (RTD) as bait to screen for interacting proteins against the whitefly cDNA library. C1QBP, is a known receptor of bacterial and viral pathogens but this is the first report of its interaction with a plant virus.

Download Full-text

First Report of Pepper Vein Yellows Virus and Pepper Yellow Leaf Curl Virus Infecting Chilli Pepper (Capsicum annuum) in Malaysia

Plant Disease ◽

10.1094/pdis-10-19-2152-pdn ◽

2020 ◽

Vol 104 (7) ◽

pp. 2037-2037

Author(s):

A. R. Sau ◽

N. M. F. Nazmie ◽

M. S. M. Yusop ◽

M. A. Akbar ◽

M. F. M Saad ◽

...

Keyword(s):

Capsicum Annuum ◽

Yellow Leaf ◽

Chilli Pepper ◽

First Report ◽

Leaf Curl Virus ◽

Pepper Vein Yellows Virus ◽

Leaf Curl

Download Full-text

The southern Palearctic genus Enneastigma Stein (Diptera: Anthomyiidae): Taxonomy of Mediterranean species, phylogeny and ancestral areas analysis

Insect Systematics & Evolution ◽

10.1163/187631294x00144 ◽

1994 ◽

Vol 25 (4) ◽

pp. 361-375 ◽

Cited By ~ 6

Author(s):

Verner Michelsen

Keyword(s):

Cladistic Analysis ◽

Alternative Methods ◽

Mediterranean Species ◽

Species Phylogeny ◽

Males And Females ◽

The Mediterranean ◽

Small Genus

AbstractEnneastigma is a small genus of myopinine anthomyiids which comprises five species in the Mediterranean subregion (E. compressum Stein, E. rarum sp. n., E. rufitibia sp. n., E. triplex Loew, E. triseriatum Stein) and two species in SE Palearctic part of China (E. pilosiventrosum Fan & Chen, E. shanghaiensis Fan & Chen). All species appear to be univoltine and only active during the cooler parts of the season. The larvae may all be coprophagous. The Mediterranean species are revised with keys to males and females and illustrated descriptions of males, females and eggs. One lectotype is designated. A cladistic analysis was conducted which also included the Chinese species. This resulted in a single, most parsimonious phylogeny. The resulting area cladogram was used to assess the alternative methods for estimating ancestral areas as proposed recently by K. Bremer and F. Ronquist. It is concluded that the best results are obtained by using a refined Ronquist analysis.

Download Full-text

First report of caper (Capparis spinosa) serious infestation by Eurydema eckerleini in Cyclades Islands, Greece (Hemiptera: Heteroptera, Pentatomidae)

Fragmenta Entomologica ◽

10.4081/fe.2017.232 ◽

2017 ◽

Vol 49 (1) ◽

pp. 65

Author(s):

Konstantinos B. Simoglou ◽

Paride Dioli

Keyword(s):

Mediterranean Climate ◽

First Record ◽

Arid Environments ◽

Hilly Terrain ◽

First Report ◽

Drought Conditions ◽

Capparis Spinosa ◽

Heteroptera Pentatomidae ◽

The Mediterranean

The islands of Tinos and Syros in the Cyclades Archipelago, Greece, have a hilly terrain, a mild Mediterranean climate and vegetation adapted to drought conditions. Caper (Capparis spinosa L.) is highly adapted to arid environments and grows successfully during the Mediterranean summer. In August 2015, we detected serious infestations on wild caper by Eurydema eckerleini (Pentatomidae), which was formerly considered a species endemic to Crete and the Peloponnese, with an isolated report in Turkey. This is the first record of the presence of E. eckerleini in the Cyclades.

Download Full-text

Achene dimorphism and protracted release: a trait syndrome allowing continuous reshaping of the seed-dispersal kernel in the Mediterranean species Pallenis spinosa

Plant Ecology & Diversity ◽

10.1080/17550874.2018.1534145 ◽

2018 ◽

Vol 11 (4) ◽

pp. 429-439 ◽

Cited By ~ 2

Author(s):

Fernando Bastida ◽

Francisco J. Macías ◽

Isabel Butler ◽

José L. González-Andújar

Keyword(s):

Seed Dispersal ◽

Dispersal Kernel ◽

Mediterranean Species ◽

Seed Dispersal Kernel ◽

The Mediterranean

Download Full-text

Endemic freshwater planarians of Sardinia: Redescription ofDugesia hepta(Platyhelminthes, Tricladida) with a comparison of the Mediterranean species of the genus

Journal of Natural History ◽

10.1080/00222930500060025 ◽

2005 ◽

Vol 39 (22) ◽

pp. 1947-1960 ◽

Cited By ~ 7

Author(s):

G. A. Stocchino ◽

G. Corso ◽

R. Manconi ◽

S. Casu ◽

M. Pala

Keyword(s):

Mediterranean Species ◽

The Mediterranean

Download Full-text

First report of Edwardsiellosis in cage-cultured sharpsnout sea bream, Diplodus puntazzo from the Mediterranean

BMC Veterinary Research ◽

10.1186/s12917-015-0482-x ◽

2015 ◽

Vol 11 (1) ◽

Cited By ~ 14

Author(s):

Pantelis Katharios ◽

Constantina Kokkari ◽

Nancy Dourala ◽

Maria Smyrli

Keyword(s):

Sea Bream ◽

First Report ◽

Diplodus Puntazzo ◽

The Mediterranean

Download Full-text

First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽

10.1094/pdis-03-12-0258-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1229-1229 ◽

Cited By ~ 3

Author(s):

Y. H. Ji ◽

Z. D. Cai ◽

X. W. Zhou ◽

Y. M. Liu ◽

R. Y. Xiong ◽

...

Keyword(s):

Common Bean ◽

Large Population ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Degenerate Primers ◽

Sequence Alignments ◽

First Report ◽

Sequence Identity ◽

Leaf Curl Virus ◽

Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Download Full-text

First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽

10.1094/pd-90-0379c ◽

2006 ◽

Vol 90 (3) ◽

pp. 379-379 ◽

Cited By ~ 13

Author(s):

K. S. Ling ◽

A. M. Simmons ◽

R. L. Hassell ◽

A. P. Keinath ◽

J. E. Polston

Keyword(s):

South Carolina ◽

The United States ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

First Report ◽

Pcr Products ◽

Primer Sequence ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Download Full-text