scholarly journals Acquisition of a Polybasic Hemagglutinin Cleavage Site by a Low-Pathogenic Avian Influenza Virus Is Not Sufficient for Immediate Transformation into a Highly Pathogenic Strain

2009 ◽  
Vol 83 (11) ◽  
pp. 5864-5868 ◽  
Author(s):  
Olga Stech ◽  
Jutta Veits ◽  
Siegfried Weber ◽  
Daniela Deckers ◽  
Diana Schröer ◽  
...  
Keyword(s):  
Influenza Virus ◽  
Avian Influenza ◽  
Avian Influenza Virus ◽  
Cleavage Site ◽  
Influenza Viruses ◽  
Avirulent Strain ◽  
Wild Type ◽  
Highly Pathogenic ◽  
Pathogenic Avian Influenza ◽  
H7 Subtype

ABSTRACT Highly pathogenic avian influenza viruses (HPAIV) differ from all other strains by a polybasic cleavage site in their hemagglutinin. All these HPAIV share the H5 or H7 subtype. In order to investigate whether the acquisition of a polybasic cleavage site by an avirulent avian influenza virus strain with a hemagglutinin other than H5 or H7 is sufficient for immediate transformation into an HPAIV, we adapted the hemagglutinin cleavage site of A/Duck/Ukraine/1/1963 (H3N8) to that of the HPAIV A/Chicken/Italy/8/98 (H5N2), A/Chicken/HongKong/220/97 (H5N1), or A/Chicken/Germany/R28/03 (H7N7) and generated the recombinant wild-type and cleavage site mutants. In contrast to the wild type, multicycle replication of these mutants in tissue culture was demonstrated by positive plaque assays and viral multiplication in the absence of exogenous trypsin. Therefore, in vitro all cleavage site mutants resemble an HPAIV. However, in chicken they did not exhibit high pathogenicity, although they could be reisolated from cloacal swabs to some extent, indicating enhanced replication in vivo. These results demonstrate that beyond the polybasic hemagglutinin cleavage site, the virulence of HPAIV in chicken is based on additional pathogenicity determinants within the hemagglutinin itself or in the other viral proteins. Taken together, these observations support the notion that acquisition of a polybasic hemagglutinin cleavage site by an avirulent strain with a non-H5/H7 subtype is only one among several alterations necessary for evolution into an HPAIV.

scholarly journals A review of H5Nx avian influenza viruses

2019 ◽  
Vol 7 ◽  
pp. 251513551882162 ◽  
Author(s):  
Ivette A. Nuñez ◽  
Ted M. Ross
Keyword(s):  
Influenza Virus ◽  
Avian Influenza ◽  
Avian Influenza Virus ◽  
Highly Pathogenic Avian Influenza ◽  
Influenza Viruses ◽  
Avian Influenza Viruses ◽  
Highly Pathogenic ◽  
Bird Populations ◽  
Pathogenic Avian Influenza ◽  
Pathogenic Avian Influenza Virus

Highly pathogenic avian influenza viruses (HPAIVs), originating from the A/goose/Guangdong/1/1996 H5 subtype, naturally circulate in wild-bird populations, particularly waterfowl, and often spill over to infect domestic poultry. Occasionally, humans are infected with HPAVI H5N1 resulting in high mortality, but no sustained human-to-human transmission. In this review, the replication cycle, pathogenicity, evolution, spread, and transmission of HPAIVs of H5Nx subtypes, along with the host immune responses to Highly Pathogenic Avian Influenza Virus (HPAIV) infection and potential vaccination, are discussed. In addition, the potential mechanisms for Highly Pathogenic Avian Influenza Virus (HPAIV) H5 Reassorted Viruses H5N1, H5N2, H5N6, H5N8 (H5Nx) viruses to transmit, infect, and adapt to the human host are reviewed.

scholarly journals Overview of the Epizootiological Situation on Highly Pathogenic Avian Influenza Virus in Russia in 2019

2020 ◽  
pp. 31-37
Author(s):  
V. Yu. Marchenko ◽  
N. I. Goncharova ◽  
Thi Nhai Tran ◽  
Khac Sau Trinh ◽  
Ngoc Quyen Nguyen ◽  
...  
Keyword(s):  
Influenza Virus ◽  
Avian Influenza ◽  
Avian Influenza Virus ◽  
Highly Pathogenic Avian Influenza ◽  
Influenza Viruses ◽  
Highly Pathogenic ◽  
Saratov Region ◽  
Pathogenic Avian Influenza ◽  
Virus Surveillance ◽  
Pathogenic Avian Influenza Virus

This review describes the current situation on highly pathogenic avian influenza virus in 2019 and predicts the possible further spread of avian influenza in Russia. In 2019 outbreaks were reported among wild birds and poultry, as well as human infections with influenza viruses of the subtypes H5Nx, H7N9 and H9N2 in several countries. In 2019, only two outbreaks of highly pathogenic avian influenza H5N8 in Russia occurred. Both outbreaks were recorded in January at poultry farm in the Rostov Region. In addition, in May 2019 avian influenza virus of H14N7 subtype was isolated from a wild bird during the avian influenza virus surveillance in Tomsk Region. In June 2019, a strain of H13N2 subtype was isolated in the territory of Kamchatka Region, then, in August 2019, an influenza virus of H13N6 subtype was isolated in the Saratov Region. It was revealed that some strains of avian influenza virus isolated in Russia have a high degree of identity with strains circulating in South-East Asia. This was shown by the phylogenetic analysis of A/ H5Nx influenza viruses previously isolated in the Saratov Region and the Socialist Republic of Vietnam during the avian influenza virus surveillance. Thus, it was demonstrated again that the territory of Russia plays a key geographical role in the global spread of avian influenza virus.

scholarly journals The Emergence of H7N7 Highly Pathogenic Avian Influenza Virus from Low Pathogenicity Avian Influenza Virus Using an in ovo Embryo Culture Model

Viruses ◽  
2020 ◽  
Vol 12 (9) ◽  
pp. 920
Author(s):  
Amanda Seekings ◽  
Wendy Howard ◽  
Alejandro Nuñéz ◽  
Marek Slomka ◽  
Ashley Banyard ◽  
...  
Keyword(s):  
Influenza Virus ◽  
Amino Acid ◽  
Avian Influenza ◽  
Avian Influenza Virus ◽  
Cleavage Site ◽  
Highly Pathogenic Avian Influenza ◽  
Basic Amino Acid ◽  
Highly Pathogenic ◽  
Pathogenic Avian Influenza ◽  
Pathogenic Avian Influenza Virus

Outbreaks of highly pathogenic avian influenza virus (HPAIV) often result in the infection of millions of poultry, causing up to 100% mortality. HPAIV has been shown to emerge from low pathogenicity avian influenza virus (LPAIV) in field outbreaks. Direct evidence for the emergence of H7N7 HPAIV from a LPAIV precursor with a rare di-basic cleavage site (DBCS) was identified in the UK in 2008. The DBCS contained an additional basic amino acid compared to commonly circulating LPAIVs that harbor a single-basic amino acid at the cleavage site (SBCS). Using reverse genetics, outbreak HPAIVs were rescued with a DBCS (H7N7DB), as seen in the LPAIV precursor or an SBCS representative of common H7 LPAIVs (H7N7SB). Passage of H7N7DB in chicken embryo tissues showed spontaneous evolution to a HPAIV. In contrast, deep sequencing of extracts from embryo tissues in which H7N7SB was serially passaged showed retention of the LPAIV genotype. Thus, in chicken embryos, an H7N7 virus containing a DBCS appears naturally unstable, enabling rapid evolution to HPAIV. Evaluation in embryo tissue presents a useful approach to study AIV evolution and allows a laboratory-based dissection of molecular mechanisms behind the emergence of HPAIV.

scholarly journals Age-Dependent Lethality in Ducks Caused by Highly Pathogenic H5N6 Avian Influenza Virus

Viruses ◽  
2020 ◽  
Vol 12 (6) ◽  
pp. 591
Author(s):  
Yunyueng Jang ◽  
Sang Heui Seo
Keyword(s):  
Influenza Virus ◽  
Avian Influenza ◽  
Avian Influenza Virus ◽  
Highly Pathogenic Avian Influenza ◽  
Cell Damage ◽  
Influenza Viruses ◽  
Avian Influenza Viruses ◽  
Highly Pathogenic ◽  
Pathogenic Avian Influenza ◽  
Age Dependent

Ducks show notably higher resistance to highly pathogenic avian influenza viruses as compared to chickens. Here, we studied the age-dependent susceptibility in ducks to the infections caused by highly pathogenic avian influenza viruses. We intranasally infected ducks aged 1, 2, 4, and 8 weeks with highly pathogenic H5N6 avian influenza viruses isolated in South Korea in 2016. All the 1-and 2-week-old ducks died after infection, 20% of 3-week-old ducks died, and from the ducks aged 4 and 8 weeks, all of them survived. We performed microarray analysis and quantitative real-time PCR using total RNA isolated from the lungs of infected 2- and 4-week-old ducks to determine the mechanism underlying the age-dependent susceptibility to highly pathogenic avian influenza virus. Limited genes were found to be differentially expressed between the lungs of 2- and 4-week-old ducks. Cell damage-related genes, such as CIDEA and ND2, and the immune response-related gene NR4A3 were notably induced in the lungs of infected 2-week-old ducks compared to those in the lungs of infected 4-week-old ducks.

scholarly journals A Unique Multibasic Proteolytic Cleavage Site and Three Mutations in the HA2 Domain Confer High Virulence of H7N1 Avian Influenza Virus in Chickens

2015 ◽  
Vol 90 (1) ◽  
pp. 400-411 ◽  
Author(s):  
El-Sayed M. Abdelwhab ◽  
Jutta Veits ◽  
Kerstin Tauscher ◽  
Mario Ziller ◽  
Jens P. Teifke ◽  
...  
Keyword(s):  
Influenza Virus ◽  
Avian Influenza ◽  
Avian Influenza Virus ◽  
Cleavage Site ◽  
Influenza Viruses ◽  
Highly Pathogenic ◽  
Systemic Spread ◽  
H7n1 Virus

ABSTRACT In 1999, after circulation for a few months in poultry in Italy, low-pathogenic (LP) avian influenza (AI) H7N1 virus mutated into a highly pathogenic (HP) form by acquisition of a unique multibasic cleavage site (mCS), PEIPKGSRVRR*GLF (asterisk indicates the cleavage site), in the hemagglutinin (HA) and additional alterations with hitherto unknown biological function. To elucidate these virulence-determining alterations, recombinant H7N1 viruses carrying specific mutations in the HA of LPAI A/chicken/Italy/473/1999 virus (Lp) and HPAI A/chicken/Italy/445/1999 virus (Hp) were generated. Hp with a monobasic CS or carrying the HA of Lp induced only mild or no disease in chickens, thus resembling Lp. Conversely, Lp with the HA of Hp was as virulent and transmissible as Hp. While Lp with a multibasic cleavage site (Lp_CS445) was less virulent than Hp, full virulence was exhibited when HA2 was replaced by that of Hp. In HA2, three amino acid differences consistently detected between LP and HP H7N1 viruses were successively introduced into Lp_CS445. Q450L in the HA2 stem domain increased virulence and transmission but was detrimental to replication in cell culture, probably due to low-pH activation of HA. A436T and/or K536R restored viral replication in vitro and in vivo . Viruses possessing A436T and K536R were observed early in the HPAI outbreak but were later superseded by viruses carrying all three mutations. Together, besides the mCS, stepwise mutations in HA2 increased the fitness of the Italian H7N1 virus in vivo . The shift toward higher virulence in the field was most likely gradual with rapid optimization. IMPORTANCE In 1999, after 9 months of circulation of low-pathogenic (LP) avian influenza virus (AIV), a devastating highly pathogenic (HP) H7N1 AIV emerged in poultry, marking the largest epidemic of AIV reported in a Western country. The HPAIV possessed a unique multibasic cleavage site (mCS) complying with the minimum motif for HPAIV. The main finding in this report is the identification of three mutations in the HA2 domain that are required for replication and stability, as well as for virulence, transmission, and tropism of H7N1 in chickens. In addition to the mCS, Q450L was required for full virulence and transmissibility of the virus. Nonetheless, it was detrimental to virus replication and required A436T and/or K536R to restore replication, systemic spread, and stability. These results are important for better understanding of the evolution of highly pathogenic avian influenza viruses from low-pathogenic precursors.

scholarly journals Molecular Study on The Pathogenicity of Avian Influenza Virus

2015 ◽  
Vol 11 (2) ◽  
Author(s):  
Haryadi M. Wibowo ◽  
Heru Susetya ◽  
Tri Untari ◽  
Khrisdiana Putri ◽  
Charles Rangga Tabbu
Keyword(s):  
Influenza Virus ◽  
Avian Influenza ◽  
Avian Influenza Virus ◽  
Cleavage Site ◽  
Highly Pathogenic Avian Influenza ◽  
Basic Amino Acid ◽  
Molecular Study ◽  
Highly Pathogenic ◽  
Pathogenic Avian Influenza ◽  
Pathogenic Avian Influenza Virus

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.

scholarly journals A reassortant highly pathogenic avian influenza H5N6 virus originating from the wildbird-origin H5N6 and the poultry H9N2/H7N9 viruses in Xinjiang, China

2021 ◽  
Vol 77 (06) ◽  
pp. 6532-2021
Author(s):  
QIAN ZHANG ◽  
XINDI MEI ◽  
CHENG ZHANG ◽  
FEI DU ◽  
NANA CHANG ◽  
...  
Keyword(s):  
Influenza Virus ◽  
Avian Influenza ◽  
Avian Influenza Virus ◽  
Highly Pathogenic Avian Influenza ◽  
Wild Birds ◽  
Influenza Viruses ◽  
Highly Pathogenic ◽  
Pathogenic Avian Influenza ◽  
Sequence Identity ◽  
Pathogenic Avian Influenza Virus

The asian lineage of H5, H7, and H9 avian influenza viruses (AIVs) is the most prevalent in the world, and the co-existence of H5, H7, and H9 viruses provide an opportunity to generate some novel reassortants. Herein we report our isolation of two H5N6 virus strains (named XJ-H5N6) from domestic geese in live poultry markets (LPMs) in Urumqi during the winter of 2016-2017, and analysis of the viral genetic mutations, pathogenicity, reassortant, and origin. BLAST analysis revealed that the HA, NA, MP, NP, and NS of XJ-H5N6 had the highest sequence identity (98.5-99.5%) with those 5 genes from H5N6 highly pathogenic avian influenza virus (HPAIV) isolated from wild birds in Ningxia (NX-WB-H5N6); the viral PA and PB1 had the highest sequence identity (98.6% and 98.9%) with those 2 genes from HPAIV strain A/Environment/Chongqing/45373/2015 (H5N6) (CQ-EN-H5N6); while the viral PB2 had the highest sequence identity (99.0%) with this gene from low pathogenic avian influenza virus (LPAIV) strain A/environment/Jiangsu/01.20 TCCX004/2015 (H9N2). Except for the PB2, phylogenetic analysis showed that the other 7 viral genes were clustered together with NX-WB-H5N6 and CQ-EN-H5N6, while the viral PB2 was clustered together with the poultry H9N2/H7N9 viruses. The viral HA protein contained multiple basic amino acid residues (RRRKR/GL) at the cleavage site which represents HPAIV. Additionally, the viral multiple mutations could enhance the viral virulence and the capacity of cross-species transmission. Our data indicate that XJ-H5N6 has been generated by the reassortant of H5N6 HPAIV from wild birds in Ningxia and H9N2/H7N9 LPAIV in poultry. The results of this study may help us understand the viral adaptation and transmission patterns from wild birds to poultry.

scholarly journals Avian Influenza Virus (H5N1): a Threat to Human Health

2007 ◽  
Vol 20 (2) ◽  
pp. 243-267 ◽  
Author(s):  
J. S. Malik Peiris ◽  
Menno D. de Jong ◽  
Yi Guan
Keyword(s):  
Influenza Virus ◽  
Avian Influenza ◽  
Avian Influenza Virus ◽  
Human Health ◽  
Highly Pathogenic Avian Influenza ◽  
Health Impact ◽  
Influenza Viruses ◽  
Economic Consequences ◽  
Highly Pathogenic ◽  
Pathogenic Avian Influenza

SUMMARY Pandemic influenza virus has its origins in avian influenza viruses. The highly pathogenic avian influenza virus subtype H5N1 is already panzootic in poultry, with attendant economic consequences. It continues to cross species barriers to infect humans and other mammals, often with fatal outcomes. Therefore, H5N1 virus has rightly received attention as a potential pandemic threat. However, it is noted that the pandemics of 1957 and 1968 did not arise from highly pathogenic influenza viruses, and the next pandemic may well arise from a low-pathogenicity virus. The rationale for particular concern about an H5N1 pandemic is not its inevitability but its potential severity. An H5N1 pandemic is an event of low probability but one of high human health impact and poses a predicament for public health. Here, we review the ecology and evolution of highly pathogenic avian influenza H5N1 viruses, assess the pandemic risk, and address aspects of human H5N1 disease in relation to its epidemiology, clinical presentation, pathogenesis, diagnosis, and management.

scholarly journals Overview of the Epizootiological Situation on Highly Pathogenic Avian Influenza in Russia in 2020

2021 ◽  
pp. 33-40
Author(s):  
V. Yu. Marchenko ◽  
N. I. Goncharova ◽  
E. V. Gavrilova ◽  
R. A. Maksyutov ◽  
A. B. Ryzhikov
Keyword(s):  
Influenza Virus ◽  
Avian Influenza ◽  
Avian Influenza Virus ◽  
Large Scale ◽  
Highly Pathogenic Avian Influenza ◽  
Influenza Viruses ◽  
Highly Pathogenic ◽  
Pathogenic Avian Influenza ◽  
Pathogenic Avian Influenza Virus ◽  
Human Infections

This review describes the current situation on highly pathogenic avian influenza virus in 2020 and provides forecast of the possible further spread of avian influenza in Russia. In 2020, the circulation of a wide variety of highly pathogenic avian influenza virus subtypes which have epizootiological and epidemiological significance was recorded in the world. Outbreaks of highly pathogenic avian influenza were reported in over 30 countries. Apart from this, human infections with influenza viruses of the A/H5Nx and A/H9N2 subtypes were reported. There was a large-scale epizootic in Russia in 2020, which affected more than 10 regions. Outbreaks among wild birds and poultry were caused by the highly pathogenic influenza virus A/H5N8 of clade 2.3.4.4b. As a result of those outbreaks, more than 1.5 mil. poultry were killed or perished. It was revealed that strains of the influenza virus isolated in Russia have a high degree of identity with the strains circulating in Europe and Southeast Asia. Thus, it was shown again that the territory of Russia plays an important role in the global spread of avian influenza virus. 

Sign in / Sign up

Export Citation Format

Share Document