Design of plant-specific PCR primers for the ETS region with enhanced specificity for tribe Bromeae and their application to other grasses (Poaceae)

Botany ◽  
2014 ◽  
Vol 92 (10) ◽  
pp. 693-699 ◽  
Author(s):  
Alicia Alonso ◽  
Roger D. Bull ◽  
Carmen Acedo ◽  
Lynn J. Gillespie
Keyword(s):  
Repeat Unit ◽  
Pcr Primers ◽  
Nuclear Ribosomal Dna ◽  
Chain Reaction ◽  
Internal Transcribed Spacer Region ◽  
Specific Pcr ◽  
External Transcribed Spacer ◽  
Preliminary Study ◽  
Polymerase Chain ◽  
Ribosomal Repeat

Selective primers were developed for the amplification via polymerase chain reaction (PCR) of the external transcribed spacer (ETS) region in the nuclear ribosomal repeat unit. These primers were intended to be specific to the Poaceae tribe Bromeae but were found to function broadly across subfamily Pooideae. ETS primers previously developed for grasses were unable to amplify tribe Bromeae taxa because of ETS variability and several subrepeats. After detailed analysis, a region was chosen and four candidate primers were designed to amplify and sequence the ETS fragment. This fragment of approximately 800–900 bp is located in the 3′ region of the ETS of 18S–26S nuclear ribosomal DNA. A preliminary study with these primers was conducted in eight samples of Bromus. The best two primers showed strong amplification and successful sequencing for all samples tested. We also tested the specificity of these two primers in samples belonging to all large taxa of Bromeae, including all three genera and five subgenera and samples of eight tribes and 15 subtribes of the subfamily Pooideae, and both worked for most of the taxa tested. Our results demonstrate that the ETS region is more informative for resolving relationships at different taxonomic levels than internal transcribed spacer region. Also, these results indicate the utility of these new primers for studying the ETS region in the tribe Bromeae as well as across the subfamily Pooideae.

Molecular Differentiation of Two Strains of the Parasitoid Anisopteromalus calandrae (Hymenoptera: Pteromalidae) Using Specific PCR Primers

2004 ◽  
Vol 39 (1) ◽  
pp. 1-10 ◽  
Author(s):  
Yu Cheng Zhu ◽  
Alan K. Dowdy ◽  
James E. Baker
Keyword(s):  
Dna Markers ◽  
Natural Populations ◽  
Pcr Amplification ◽  
Pcr Primers ◽  
Dna Fragments ◽  
Chain Reaction ◽  
Specific Primers ◽  
Specific Pcr ◽  
Anisopteromalus Calandrae ◽  
Polymerase Chain

Two strains (Sav and Bam) of the parasitoid Anisopteromalus calandrae (Howard) (Hymenoptera: Pteromalidae) showed different sensitivity to organophosphate insecticides. By using polymerase chain reaction (PCR) and DNA sequencing, we demonstrated clear molecular difference between these two strains. DNA markers that are specific for the Bam strain were developed, and PCR-generated DNA fragments were cloned and sequenced. Two DNA fragments unique to the Bam strain contained 365 and 584 nucleotides. A pair of specific primers was designed from each fragment. PCR-amplification of the DNA from individual wasps generated fragments of the expected sizes only in the Bam strain. Studies conducted on F1 and F2 hybrids produced from crossing and backcrossing between resistant and susceptible strains indicated that these DNA markers are located on mitochondria and inherited exclusively maternally. Probes developed from these fragments may be used in assessing genetic information of natural populations and in studies on physiological or biochemical differences between the strains of this beneficial insect.

scholarly journals Design of a Polymerase Chain Reaction for Specific Detection of Corn Stunt Spiroplasma

Plant Disease ◽  
2001 ◽  
Vol 85 (5) ◽  
pp. 475-480 ◽  
Author(s):  
Thereza S. L. Barros ◽  
Robert E. Davis ◽  
Renato O. Resende ◽  
Ellen L. Dally
Keyword(s):  
Polymerase Chain Reaction ◽  
Dna Amplification ◽  
Pcr Primers ◽  
Limiting Factor ◽  
Chain Reaction ◽  
Specific Pcr ◽  
Spiroplasma Kunkelii ◽  
Detection And Identification ◽  
Corn Stunt ◽  
Polymerase Chain

Corn stunt disease is a major limiting factor in production of corn (Zea mays) in the Americas. To develop a polymerase chain reaction (PCR) assay specific for detection of the causal agent, Spiroplasma kunkelii, PCR primers were designed on the basis of unique regions of the nucleotide sequence of the S. kunkelii spiralin gene. DNA was amplified in PCRs containing template DNAs derived from laboratory strains of S. kunkelii and from naturally diseased corn plants collected in the field. No DNA amplification was observed in PCRs containing template DNAs derived from other Spiroplasma species tested or from healthy corn or corn infected by maize bushy stunt phytoplasma. The availability of a sensitive and specific PCR for detection and identification of S. kunkelii should facilitate studies of the ecology of this pathogen, as well as its influence in the incidence, spread, and severity of corn stunting diseases.

Molecular and morphological discrimination betweenTylospora fibrillosaandTylospora asterophoramycorrhizae

1999 ◽  
Vol 77 (1) ◽  
pp. 11-21 ◽  
Author(s):  
Ursula Eberhardt ◽  
Lutz Walter ◽  
Ingrid Kottke
Keyword(s):  
Fragment Length Polymorphism ◽  
Pcr Primers ◽  
Morphological Identification ◽  
Chain Reaction ◽  
Specific Primers ◽  
Specific Pcr ◽  
Pcr Rflp ◽  
Polymerase Chain ◽  
Species Specific ◽  
First Time

Among the mycorrhizal types of spruce, Tylospora-type mycorrhizae are the most constant and abundant. Two species of the genus Tylospora occur in Europe, Tylospora fibrillosa and Tylospora asterophora. Mycorrhizae of T. asterophora are described in detail for the first time. Sequences of the internal transcribed spacer (ITS) of the ribosomal genes were obtained from T. fibrillosa and T. asterophora mycorrhizae, sporocarps, and cultured mycelium. Discrimination and identification of the two species by ITS polymerase chain reaction - restriction fragment length polymorphism (PCR-RFLP) are discussed in the light of inter- and intra-specific variability. Species-specific PCR primers were designed to distinguish both species. Molecular screening of Tylospora-type mycorrhizae from field material led to unambiguous results, whereas morphological identification is likely to fail because of great similarity even at the microscopic level.Key words: Tylospora asterophora, Tylospora fibrillosa, ectomycorrhizae, taxon specific primers (TSOPs), ITS sequences.

scholarly journals A Polymerase Chain Reaction Protocol for the Detection of Clavibacter xyli subsp. xyli, the Causal Bacterium of Sugarcane Ratoon Stunting Disease

Plant Disease ◽  
1998 ◽  
Vol 82 (3) ◽  
pp. 285-290 ◽  
Author(s):  
Y.-B. Pan ◽  
M. P. Grisham ◽  
D. M. Burner ◽  
K. E. Damann ◽  
Q. Wei
Keyword(s):  
Polymerase Chain Reaction ◽  
Genomic Dna ◽  
Its Region ◽  
Pcr Primers ◽  
Chain Reaction ◽  
Multiple Sequence ◽  
Ratoon Stunting Disease ◽  
Specific Pcr ◽  
Polymerase Chain ◽  
Sugarcane Ratoon

A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5′ CCGAAGTGAGCAGATTGACC) and Cxx2 (5′ ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.

Detecting Single Seeds of Small Broomrape (Orobanche minor) with a Polymerase Chain Reaction

2002 ◽  
Vol 3 (1) ◽  
pp. 1 ◽  
Author(s):  
Nancy K. Osterbauer ◽  
Lisa Rehms
Keyword(s):  
Polymerase Chain Reaction ◽  
Trifolium Pratense ◽  
Pcr Primers ◽  
Nuclear Ribosomal Dna ◽  
Chain Reaction ◽  
Trifolium Pratense L ◽  
Polymerase Chain ◽  
Single Seeds ◽  
Noxious Weed ◽  
Orobanche Minor

The seeds of the federally-listed noxious weed and parasitic plant small broomrape (Orobanche minor Smith) are extremely small, averaging 200 to 300 μm in size. Because of its miniscule seed size, contamination of fields and seed lots by small broomrape seeds is difficult to detect and confirm via conventional methods. Complementary polymerase chain reaction (PCR) primers based upon unique sequences in the internal transcribed spacer (ITS) regions of the nuclear ribosomal DNA (nrDNA) of small broomrape were developed. The PCR amplified small broomrape DNA and did not amplify DNA from other Orobanche species with similar host ranges found in Oregon. The primers also did not amplify the DNA of red and white clover (Trifolium pratense L. and T. repens L., respectively), two agricultural hosts for this parasite. The PCR-based assay was sensitive enough to detect a single small broomrape seed. Accepted for publication 14 October 2002. Published 18 October 2002.

scholarly journals Development of Polymerase Chain Reaction Primers Highly Specific for Xanthomonas albilineans, the Causal Bacterium of Sugarcane Leaf Scald Disease

Plant Disease ◽  
1999 ◽  
Vol 83 (3) ◽  
pp. 218-222 ◽  
Author(s):  
Y.-B. Pan ◽  
M. P. Grisham ◽  
D. M. Burner ◽  
B. L. Legendre ◽  
Q. Wei
Keyword(s):  
Polymerase Chain Reaction ◽  
Bacterial Species ◽  
Pcr Amplification ◽  
Pcr Primers ◽  
Chain Reaction ◽  
Multiple Sequence ◽  
Leaf Scald ◽  
Specific Pcr ◽  
Polymerase Chain ◽  
Xanthomonas Albilineans

New primers were developed that greatly improved the specificity of the polymerase chain reaction (PCR) protocol for Xanthomonas albilineans, the causal agent of sugarcane leaf scald disease. Length-polymorphic PCR products, amplified under the current PCR protocol from the 16S-23S ribosomal DNA intergenic transcribed spacers (ITS) of X. albilineans and three unidentified sugarcane saprophytic bacterial species, were cloned and sequenced. Fourteen other nonredundant ITS sequences retrieved from the database were highly homologous to the sequence of X. albilineans. Two X. albilineans-specific PCR primers, namely, PGBL1 (5′ CTT TGG GTC TGT AGC TCA GG) and PGBL2 (5′ GCC TCA AGG TCA TAT TCA GC), were designed based on a multiple sequence alignment among these 18 sequences. These two primers permitted specific PCR amplification of a 288-bp DNA product from all 71 diverse X. albilineans strains tested. No amplification product was observed from any other bacterial species tested, including the three unidentified sugarcane saprophytes. The new PCR protocol has been routinely used to detect the leaf scald pathogen from infected sugarcane tissues.

scholarly journals Nutritional deficiency in citrus with symptoms of citrus variegated chlorosis disease

2009 ◽  
Vol 69 (3) ◽  
pp. 859-864 ◽  
Author(s):  
ME. Silva-Stenico ◽  
FTH. Pacheco ◽  
ER. Pereira-Filho ◽  
JLM. Rodrigues ◽  
AN. Souza ◽  
...  
Keyword(s):  
Nutrient Content ◽  
Pcr Primers ◽  
Nutritional Deficiencies ◽  
Chain Reaction ◽  
Specific Pcr ◽  
Foliar Nutrient ◽  
Flow Through ◽  
Citrus Orchards ◽  
Polymerase Chain ◽  
High Concentrations

It is well known that citrus plants that have been infected by Xylella fastidiosa display nutritional deficiencies, probably caused by production of extracellular polymers by the bacteria that block normal nutrient flow through the xylem. The aim of this work was to study the mineral composition of specific foliar areas in different stages of infection in citrus. Thus, the concentrations of macro and micronutrients in leaves of citrus infected by X. fastidiosa were measured. Samples from four infected citrus orchards in the State of São Paulo, Brazil, were respectively collected from Santa Rita do Passa Quatro, Neves Paulista, Gavião Peixoto and Paraíso counties. The presence of X. fastidiosa in leaves was confirmed by polymerase chain reaction (PCR) using specific PCR primers. To understand the variation in leaf-nutrient content in citrus plants, we used foliar nutrient values from control (non-symptomatic) plants as a reference. Chemometric analysis showed that the deficiency of P and K in symptomatic trees for all orchards and high concentrations of Fe, Mn and Zn were observed in chlorotic areas, although other studies revealed deficiency of zinc in leaves. This is the first report showing that a correlation between chlorotic citrus leaf and higher concentrations of Fe, Mn and Zn are observed when infected and healthy plants were compared.

Detection ofErwinia amylovorain plant material using novel polymerase chain reaction (PCR) primers

2001 ◽  
Vol 29 (1) ◽  
pp. 35-43 ◽  
Author(s):  
R. K. Taylor ◽  
P. J. Guilford ◽  
R. G. Clark ◽  
C. N. Hale ◽  
R. L. S. Forster
Keyword(s):  
Polymerase Chain Reaction ◽  
Plant Material ◽  
Pcr Primers ◽  
Chain Reaction ◽  
Polymerase Chain

scholarly journals Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

2012 ◽  
Vol 32 (1) ◽  
pp. 201-208 ◽  
Author(s):  
Carla Bertechini Faria ◽  
Giovana Caputo Almeida-Ferreira ◽  
Karina Bertechine Gagliardi ◽  
Tatiane Cristina Albuquerque Alves ◽  
Dauri José Tessmann ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Fusarium Graminearum ◽  
Genomic Dna ◽  
Solid Medium ◽  
Food Contamination ◽  
Chain Reaction ◽  
Specific Pcr ◽  
Culture Characteristics ◽  
Mycotoxigenic Fungi ◽  
Polymerase Chain

The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR) has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

scholarly journals A New ‘Candidatus Liberibacter’ Species Associated with Diseases of Solanaceous Crops

Plant Disease ◽  
2009 ◽  
Vol 93 (3) ◽  
pp. 208-214 ◽  
Author(s):  
Lia W. Liefting ◽  
Paul W. Sutherland ◽  
Lisa I. Ward ◽  
Kerry L. Paice ◽  
Bevan S. Weir ◽  
...  
Keyword(s):  
16S Rrna ◽  
Pcr Primers ◽  
23S Rrna ◽  
Rrna Gene ◽  
High Identity ◽  
Specific Pcr ◽  
Transmission Electron ◽  
Candidatus Liberibacter ◽  
Polymerase Chain ◽  
Specific Pcr Primer

A new disease of glasshouse-grown tomato and pepper in New Zealand has resulted in plant decline and yield loss. Affected plants are characterized by spiky, chlorotic apical growth, curling or cupping of the leaves, and overall stunting. Transmission electron microscopy revealed the presence of phloem-limited bacterium-like organisms in symptomatic plants. The strategy used to identify the bacterium involved using specific prokaryote polymerase chain reaction (PCR) primers in combination with universal 16S rRNA primers. Sequence analysis of the 16S rRNA gene, the 16S/23S rRNA spacer region, and the rplKAJL-rpoBC operon revealed that the bacterium shared high identity with ‘Candidatus Liberibacter’ species. Phylogenetic analysis showed that the bacterium is distinct from the three citrus liberibacter species previously described and has been named ‘Candidatus Liberibacter solanacearum’. This is the first report of a liberibacter naturally infecting a host outside the Rutaceae family. A specific PCR primer pair was developed for its detection.

Sign in / Sign up

Export Citation Format

Share Document