BKm minisatellite sequences are not sex associated but reveal DNA fingerprint polymorphisms in rainbow trout

Genome ◽  
1989 ◽  
Vol 32 (5) ◽  
pp. 865-868 ◽  
Author(s):  
Marilyn A. Lloyd ◽  
Mary J. Fields ◽  
Gary H. Thorgaard
Keyword(s):  
Rainbow Trout ◽  
Genomic Dna ◽  
Repetitive Sequences ◽  
Restriction Enzymes ◽  
Dna Fingerprint ◽  
Salmo Gairdneri ◽  
Agarose Gels ◽  
Outbred Strain ◽  
Males And Females ◽  
Female Snake

GATA-GACA repetitive sequences first isolated from a female snake (termed BKm sequences) and associated with sex chromosomes in some species were hybridized to DNA from rainbow trout (Salmo gairdneri). Genomic DNA was studied from three groups of rainbow trout: (i) randomly selected males and females from an outbred group, (ii) androgenetic individuals from an inbred strain, and (iii) parents and offspring of an outbred strain. Three restriction enzymes (EcoRI, HaeIII, or HinfI) were used to digest the genomic DNA. The DNA was electrophoresed in agarose gels, transferred to nylon membranes, and the GATA-GACA repetitive sequence probe was hybridized to this DNA. There was no evidence of sex-associated patterns of hybridization with the enzymes used. However, the sequences reveal DNA fingerprint polymorphisms which appear to be inherited in a stable manner.Key words: BKm, GATA-GACA repetitive sequences, DNA fingerprint, rainbow trout, Salmo gairdneri.

Intra- and inter-specific mitochondrial DNA sequence divergence in Salmo: rainbow, steelhead, and cutthroat trouts

1985 ◽  
Vol 63 (9) ◽  
pp. 2088-2094 ◽  
Author(s):  
Gary M. Wilson ◽  
W. Kelley Thomas ◽  
Andrew T. Beckenbach
Keyword(s):  
Mitochondrial Dna ◽  
Rainbow Trout ◽  
Life Histories ◽  
Sequence Divergence ◽  
Cutthroat Trout ◽  
Restriction Enzymes ◽  
Restriction Endonuclease Analysis ◽  
Salmo Gairdneri ◽  
Intraspecific Divergence ◽  
Clonal Lines

Two forms of Salmo gairdneh with different life histories (steelhead and rainbow trout) were compared using restriction endonuclease analysis of mitochondrial DNA. A total of 19 individuals from four populations were studied for each of the two forms, using 14 restriction enzymes. In addition, five cutthroat trout samples were included as an interspecific comparison. These enzymes revealed a total of 81 cut sites, representing a sample of more than 400 nucleotides per fish. Of these sites, 25 were phylogenetically informative, dividing the 43 fish into 10 clonal lines, 8 Salmo gairdneri and 2 Salmo clarki. Results indicated detectable divergence between all geographic populations of steelhead and rainbow trout except Pennask rainbow trout, Coquihalla steelhead, and Wampus Creek rainbow trout. Other steelhead populations analysed showed a closer phylogenetic relationship to each other than to rainbow trout populations analysed. Intraspecific divergence was in most cases 1% or less, with a 1.5% maximum. Interspecific divergence between S. gairdneri and S. clarki was between 2% and 3.5%.

Some Chemical Signals in the Spawning Behavior of Rainbow Trout (Salmo gairdneri)

1973 ◽  
Vol 30 (7) ◽  
pp. 995-997 ◽  
Author(s):  
C. Newcombe ◽  
G. Hartman
Keyword(s):  
Rainbow Trout ◽  
Chemical Signals ◽  
Salmo Gairdneri ◽  
Auditory Stimuli ◽  
Spawning Behavior ◽  
Olfactory Information ◽  
Males And Females ◽  
Chemical Stimuli

In a two-choice maze ripe rainbow trout (Salmo gairdneri) of both sexes showed positive responses to chemical (probably olfactory) information. The possibility that visual or auditory stimuli influenced choice of channel in the maze was ruled out. Both males and females were strongly attracted to water taken from behind fish that were spawning and weakly attracted to the holding water of ripe fish that were not spawning. Brief speculation is offered about the role of chemical stimuli in the behavior of prespawning and spawning trout.

Gene segregation in induced tetraploid rainbow trout: genetic evidence of preferential pairing of homologous chromosomes

Genome ◽  
1988 ◽  
Vol 30 (4) ◽  
pp. 547-553 ◽  
Author(s):  
A. Diter ◽  
R. Guyomard ◽  
D. Chourrout
Keyword(s):  
Rainbow Trout ◽  
Genetic Evidence ◽  
Salmo Gairdneri ◽  
Preferential Pairing ◽  
Homologous Chromosomes ◽  
Tetrasomic Inheritance ◽  
Gene Segregation ◽  
Sib Families ◽  
Males And Females ◽  
Homoeologous Chromosomes

Gene segregation at six protein loci was analysed in progeny from tetraploid males and females obtained by suppression of first mitosis. The triploid full-sib families from five tetraploid males and the diploid gynogenetic lines from four tetraploid females were examined. The proportions of heterozygous gametes (0.83 on the average) were significantly higher than expected from tetrasomic inheritance (0.667) at all the loci studied. This was explained by preferential pairing of homologous chromosomes. The proportions of heterozygous gametes were significantly different between loci, but the variations were not correlated with the gene–centromere distances. Our results showed that, at least for one locus, the homozygous gametes mainly resulted from pairing of homoeologous chromosomes rather than from pairing of homologous chromosomes, quadrivalent formation, and chromatin exchanges between homoeologous chromosomes.Key words: Salmo gairdneri richardson, induced tetraploidy, gene segregation, electrophoresis.

scholarly journals Identification of Pistachio (Pistacia vera L.) Nuts with Microsatellite Markers

2003 ◽  
Vol 128 (6) ◽  
pp. 898-903 ◽  
Author(s):  
Riaz Ahmad ◽  
Louise Ferguson ◽  
Stephen M. Southwick
Keyword(s):  
Genomic Dna ◽  
Repetitive Sequences ◽  
Distinct Group ◽  
The United States ◽  
Dna Fingerprint ◽  
Enriched Library ◽  
Pistacia Vera ◽  
Flanking Sequence ◽  
Industry Standard ◽  
Upgma Cluster Analysis

A genomic DNA library enriched for dinucleotide (CT)n and (CA)n and trinucleotide (CTT)n microsatellite motifs has been developed from `Kerman' pistachio (Pistacia vera L.). The enrichment method based on magnetic or biotin capture of repetitive sequences from restricted genomic DNA revealed an abundance of simple sequence repeats (SSRs) in the pistachio genome which were used for marker development. After an enrichment protocol, about 64% of the clones contained (CT)n repeats while 59% contained (CA)n for CT and CA enriched libraries, respectively. In the (CT)n enriched library, compound sequences were 45% while for (CA)n it was 13.5%. In both dinucleotide enriched libraries, about 80% of the clones having microsatellites have a repeat length in the range of 10 to 30 units. A library enriched for trinucleotide (CTT)n contained <19% of the clones with (CTT)n repeats. Of the clones that contained microsatellites, 62% had sufficient flanking sequence for primer design. An initial set of 25 pairs of primers was designed, out of which 14 pairs amplified cleanly and produced an easily interpretable PCR product in the commercially important American, Iranian, Turkish, and Syrian pistachio cultivars. The efficient DNA extraction method developed for pistachio kernels and shells (roasted and nonroasted) yielded DNA of sufficient quality to use PCR to create DNA fingerprints. In total, 46 alleles were identified by 14 primer pairs and a dendrogram was constructed on the basis of that information. The SSR markers distinguished most of the tested cultivars from their unique DNA fingerprint. An UPGMA cluster analysis placed most of the Iranian samples in one group while the Syrian samples were the most diverse and did not constitute a single distinct group. The maximum number of cultivar specific markers were found in `Kerman'(4), the current industry standard in the United States, and the Syrian cultivar Jalab (5). The technique of using extracted DNA from pistachio kernal or shell coupled with the appropriate marker system developed here, can be used for analyses and measurement of trueness to type.

scholarly journals Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

2000 ◽  
Vol 35 (10) ◽  
pp. 2007-2015
Author(s):  
CARLOS EDUARDO ANUNCIAÇÃO ◽  
SPARTACO ASTOLFI-FILHO
Keyword(s):  
Human Genome ◽  
Dna Fingerprinting ◽  
Dna Sequences ◽  
Genomic Dna ◽  
Genomic Library ◽  
Consensus Sequence ◽  
Repetitive Sequences ◽  
Restriction Enzymes ◽  
Paternity Test ◽  
Paternity Tests

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Temperature Selection of Rainbow Trout (Salmo gairdneri) Fingerlings in Vertical and Horizontal Gradients

1971 ◽  
Vol 28 (11) ◽  
pp. 1801-1804 ◽  
Author(s):  
R. W. McCauley ◽  
W. L. Pond
Keyword(s):  
Rainbow Trout ◽  
Salmo Gairdneri ◽  
Temperature Preference ◽  
Temperature Selection ◽  
Horizontal Gradients ◽  
Significant Difference ◽  
Preferred Temperatures ◽  
Laboratory Investigations ◽  
Horizontal Temperature Gradients ◽  
Selection Of

Preferred temperatures of underyearling rainbow trout (Salmo gairdneri) were determined in both vertical and horizontal temperature gradients. No statistically significant difference was found between the preferred temperatures by the two different methods. This suggests that the nature of the gradient plays a lesser role than generally believed in laboratory investigations of temperature preference.

Sign in / Sign up

Export Citation Format

Share Document