scholarly journals Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

2000 ◽  
Vol 35 (10) ◽  
pp. 2007-2015
Author(s):  
CARLOS EDUARDO ANUNCIAÇÃO ◽  
SPARTACO ASTOLFI-FILHO
Keyword(s):  
Human Genome ◽  
Dna Fingerprinting ◽  
Dna Sequences ◽  
Genomic Dna ◽  
Genomic Library ◽  
Consensus Sequence ◽  
Repetitive Sequences ◽  
Restriction Enzymes ◽  
Paternity Test ◽  
Paternity Tests

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

A subtelomeric satellite DNA family isolated from the genome of the dioecious plant Silene latifolia

Genome ◽  
1999 ◽  
Vol 42 (3) ◽  
pp. 442-446 ◽  
Author(s):  
M A Garrido-Ramos ◽  
R de la Herrán ◽  
M Ruiz Rejón ◽  
C Ruiz Rejón
Keyword(s):  
Sex Chromosomes ◽  
Dna Sequences ◽  
Satellite Dna ◽  
Consensus Sequence ◽  
Repetitive Sequences ◽  
Restriction Enzymes ◽  
Repeat Sequence ◽  
Silene Latifolia ◽  
Telomere Repeat ◽  
Significant Length

In an ongoing effort to trace the evolution of the sex chromosomes of Silene latifolia, we have searched for the existence of repetitive sequences specific to these chromosomes in the genome of this species by direct isolation from low-melting agarose gels of satellite DNA bands generated by digestion with restriction enzymes. Five monomeric units belonging to a highly repetitive family isolated from Silene latifolia, the SacI family, have been cloned and characterized. The consensus sequence of the repetitive units is 313 bp in length (however, high variability exists for monomer length variants) and 52.9% in AT. Repeating units are tandemly arranged at the subtelomeric regions of the chromosomes in this species. The sequence does not possess direct or inverted sequences of significant length, but short direct repeats are scattered throughout the monomer sequence. Several short sequence motives resemble degenerate monomers of the telomere repeat sequence of plants (TTTAGGG), confirming a tight association between this subtelomeric satellite DNA and the telomere repeats. Our approach in this work confirms that SacI satellite DNA sequences are among the most abundant in the genome of S. latifolia and, on the other hand, that satellite DNA sequences specific of sex chromosomes are absent in this species. This agrees with a sex determination system less cytogenetically diverged from a bisexual state than the system present in other plant species, such as R. acetosa, or at least a lesser degree of differentiation between the sex chromosomes of S. latifolia and the autosomes.Key words: satellite DNA, sex chromosomes, Silene latifolia, subtelomeric sequences.

Molecular and cytogenetic analysis of repetitive DNA in pea (Pisum sativum L.)

Genome ◽  
2001 ◽  
Vol 44 (4) ◽  
pp. 716-728 ◽  
Author(s):  
Pavel Neumann ◽  
Marcela Nouzová ◽  
Jirí Macas
Keyword(s):  
Pisum Sativum ◽  
Repetitive Dna ◽  
Dna Sequences ◽  
Genomic Dna ◽  
Tandem Repeats ◽  
Genomic Library ◽  
Chromosome Morphology ◽  
Plant Genome ◽  
Genomic Repeats ◽  
Dispersed Repeats

A set of pea DNA sequences representing the most abundant genomic repeats was obtained by combining several approaches. Dispersed repeats were isolated by screening a short-insert genomic library using genomic DNA as a probe. Thirty-two clones ranging from 149 to 2961 bp in size and from 1000 to 39 000/1C in their copy number were sequenced and further characterized. Fourteen clones were identified as retrotransposon-like sequences, based on their homologies to known elements. Fluorescence in situ hybridization using clones of reverse transcriptase and integrase coding sequences as probes revealed that corresponding retroelements were scattered along all pea chromosomes. Two novel families of tandem repeats, named PisTR-A and PisTR-B, were isolated by screening a genomic DNA library with Cot-1 DNA and by employing genomic self-priming PCR, respectively. PisTR-A repeats are 211–212 bp long, their abundance is 2 × 104 copies/1C, and they are partially clustered in a secondary constriction of one chromosome pair with the rest of their copies dispersed on all chromosomes. PisTR-B sequences are of similar abundance (104 copies/1C) but differ from the "A" family in their monomer length (50 bp), high A/T content, and chromosomal localization in a limited number of discrete bands. These bands are located mainly in (sub)telomeric and pericentromeric regions, and their patterns, together with chromosome morphology, allow discrimination of all chromosome types within the pea karyotype. Whereas both tandem repeat families are mostly specific to the genus Pisum, many of the dispersed repeats were detected in other legume species, mainly those in the genus Vicia.Key words: repetitive DNA, plant genome, retroelements, satellite DNA, Pisum sativum.

Isolation and characterization of six different chicken actin genes

1984 ◽  
Vol 4 (11) ◽  
pp. 2498-2508
Author(s):  
K S Chang ◽  
W E Zimmer ◽  
D J Bergsma ◽  
J B Dodgson ◽  
R J Schwartz
Keyword(s):  
Dna Sequences ◽  
Genomic Dna ◽  
Genomic Library ◽  
Smooth Muscle Actin ◽  
Actin Gene ◽  
Muscle Actin ◽  
Repeated Dna ◽  
Alpha Smooth Muscle Actin ◽  
Actin Genes ◽  
Actin Isoform

Genes representing six different actin isoforms were isolated from a chicken genomic library. Cloned actin cDNAs as well as tissue-specific mRNAs enriched in different actin species were used as hybridization probes to group individual actin genomic clones by their relative thermal stability. Restriction maps showed that these actin genes were derived from separate and nonoverlapping regions of genomic DNA. Of the six isolated genes, five included sequences from both the 5' and 3' ends of the actin-coding area. Amino acid sequence analysis from both the NH2- and COOH-terminal regions provided for the unequivocal identification of these genes. The striated isoforms were represented by the isolated alpha-skeletal, alpha-cardiac, and alpha-smooth muscle actin genes. The nonmuscle isoforms included the beta-cytoplasmic actin gene and an actin gene fragment which lacked the 5' coding and flanking sequence; presumably, this region of DNA was removed from this gene during construction of the genomic library. Unexpectedly, a third nonmuscle chicken actin gene was found which resembled the amphibian type 5 actin isoform (J. Vandekerckhove, W. W. Franke, and K. Weber, J. Mol. Biol., 152:413-426). This nonmuscle actin type has not been previously detected in warm-blooded vertebrates. We showed that interspersed, repeated DNA sequences closely flanked the alpha-skeletal, alpha-cardiac, beta-, and type 5-like actin genes. The repeated DNA sequences which surround the alpha-skeletal actin-coding regions were not related to repetitious DNA located on the other actin genes. Analysis of genomic DNA blots showed that the chicken actin multigene family was represented by 8 to 10 separate coding loci. The six isolated actin genes corresponded to 7 of 11 genomic EcoRI fragments. Only the alpha-smooth muscle actin gene was shown to be split by an EcoRI site. Thus, in the chicken genome each actin isoform appeared to be encoded by a single gene.

Cloning and characterization of repetitive DNA sequences from genomes of Oryza minuta and Oryza australiensis

Genome ◽  
1991 ◽  
Vol 34 (5) ◽  
pp. 790-798 ◽  
Author(s):  
H. Aswidinnoor ◽  
R. J. Nelson ◽  
J. F. Dallas ◽  
C. L. McIntyre ◽  
H. Leung ◽  
...  
Keyword(s):  
Repetitive Dna ◽  
Dna Sequences ◽  
Genomic Dna ◽  
Repetitive Sequences ◽  
Rice Genome ◽  
Repetitive Dna Sequences ◽  
Cross Hybridization ◽  
Oryza Minuta ◽  
Wild Rice Species ◽  
Oryza Australiensis

The value of genome-specific repetitive DNA sequences for use as molecular markers in studying genome differentiation was investigated. Five repetitive DNA sequences from wild species of rice were cloned. Four of the clones, pOm1, pOm4, pOmA536, and pOmPB10, were isolated from Oryza minuta accession 101141 (BBCC genomes), and one clone, pOa237, was isolated from Oryza australiensis accession 100882 (EE genome). Southern blot hybridization to different rice genomes showed strong hybridization of all five clones to O. minuta genomic DNA and no cross hybridization to genomic DNA from Oryza sativa (AA genome). The pOm1 and pOmA536 sequences showed cross hybridization only to all of the wild rice species containing the C genome. However, the pOm4, pOmPB10, and pOa237 sequences showed cross hybridization to O. australiensis genomic DNA in addition to showing hybridization to the O. minuta genomic DNA.Key words: rice, genome-specific repetitive sequences, Oryza.

scholarly journals RESTRICTION FRAGMENT LENGTH POLYMORPHISM IN GENETICALLY RELATED ROSE CULTIVARS

HortScience ◽  
1992 ◽  
Vol 27 (6) ◽  
pp. 574d-574
Author(s):  
Sriyani Rajapakse ◽  
Albert Abbott ◽  
John Kelly ◽  
Robert Ballard
Keyword(s):  
Escherichia Coli ◽  
Restriction Fragment Length Polymorphism ◽  
Dna Fingerprinting ◽  
Genomic Dna ◽  
Genetic Relatedness ◽  
Fragment Length Polymorphism ◽  
Restriction Enzymes ◽  
Rflp Markers ◽  
High Degree ◽  
Restriction Fragment Length

The feasibility of using RFLP to distinguish genetically related Hybrid Tea rose cultivars for DNA `fingerprinting' was examined with a group of cultivars related to `Peace'. The following cultivars used in this study, `Chicago Peace', `Flaming Peace', `Climbing Peace' and `Lucky Piece', were derived from bud mutations (sports) of `Peace'. We also investigated two additional cultivars, `Perfume Delight' and `Garden Party', in which one of the parents for each was `Peace'. Genomic rose DNA probes, cloned in pUC8 plasmid of Escherichia coli, were hybridized with genomic DNA of these cultivars digested with different restriction enzymes. Although polymorphisms were observed among these related cultivars, only a few probe/enzyme combinations screened produced RFLPs due to the high degree of genetic relatedness of these cultivars. We have identified probes that can distinguish all of these related rose cultivars. This study demonstrates that RFLP markers can be used effectively in DNA `fingerprinting' of genetically related rose cultivars, eventhough the level of detectable polymorphism is quite low.

A species-specific oligonucleotide DNA probe for the identification of Meloidogyne incognita

Parasitology ◽  
1991 ◽  
Vol 103 (2) ◽  
pp. 315-319 ◽  
Author(s):  
M. R. Chacon ◽  
R. M. E. Parkhouse ◽  
M. P. Robinson ◽  
P. R. Burrows ◽  
T. Garate
Keyword(s):  
Dna Sequences ◽  
Diagnostic Tool ◽  
Meloidogyne Incognita ◽  
Genomic Dna ◽  
Genomic Library ◽  
Dna Probe ◽  
Equal Length ◽  
Race 1 ◽  
Species Specific

A genomic library of Meloidogyne incognita Race 1 has been prepared in the bacteriophage λgt10 and screened for specific DNA sequences by hybridization with radio-isotope labelled total genomic DNA from a number of Meloidogyne species. One clone isolated (MR1#15), although not totally species specific, clearly showed preferential hybridization to M. incognita. Following subcloning and sequencing of the 255 bp insert, four stretches of the sequence corresponding to oligonucleotides of approximately equal length (~60 bp) were synthesized and examined for specificity. One of them, MR1#15.2, showed the necessary specificity to be used as a diagnostic tool.

scholarly journals Isolation and characterization of six different chicken actin genes.

1984 ◽  
Vol 4 (11) ◽  
pp. 2498-2508 ◽  
Author(s):  
K S Chang ◽  
W E Zimmer ◽  
D J Bergsma ◽  
J B Dodgson ◽  
R J Schwartz
Keyword(s):  
Dna Sequences ◽  
Genomic Dna ◽  
Genomic Library ◽  
Smooth Muscle Actin ◽  
Actin Gene ◽  
Muscle Actin ◽  
Repeated Dna ◽  
Alpha Smooth Muscle Actin ◽  
Actin Genes ◽  
Actin Isoform

Genes representing six different actin isoforms were isolated from a chicken genomic library. Cloned actin cDNAs as well as tissue-specific mRNAs enriched in different actin species were used as hybridization probes to group individual actin genomic clones by their relative thermal stability. Restriction maps showed that these actin genes were derived from separate and nonoverlapping regions of genomic DNA. Of the six isolated genes, five included sequences from both the 5' and 3' ends of the actin-coding area. Amino acid sequence analysis from both the NH2- and COOH-terminal regions provided for the unequivocal identification of these genes. The striated isoforms were represented by the isolated alpha-skeletal, alpha-cardiac, and alpha-smooth muscle actin genes. The nonmuscle isoforms included the beta-cytoplasmic actin gene and an actin gene fragment which lacked the 5' coding and flanking sequence; presumably, this region of DNA was removed from this gene during construction of the genomic library. Unexpectedly, a third nonmuscle chicken actin gene was found which resembled the amphibian type 5 actin isoform (J. Vandekerckhove, W. W. Franke, and K. Weber, J. Mol. Biol., 152:413-426). This nonmuscle actin type has not been previously detected in warm-blooded vertebrates. We showed that interspersed, repeated DNA sequences closely flanked the alpha-skeletal, alpha-cardiac, beta-, and type 5-like actin genes. The repeated DNA sequences which surround the alpha-skeletal actin-coding regions were not related to repetitious DNA located on the other actin genes. Analysis of genomic DNA blots showed that the chicken actin multigene family was represented by 8 to 10 separate coding loci. The six isolated actin genes corresponded to 7 of 11 genomic EcoRI fragments. Only the alpha-smooth muscle actin gene was shown to be split by an EcoRI site. Thus, in the chicken genome each actin isoform appeared to be encoded by a single gene.

scholarly journals 5-Methylcytosine distribution and genome organization in triticale before and after treatment with 5-azacytidine

1999 ◽  
Vol 112 (23) ◽  
pp. 4397-4404 ◽  
Author(s):  
A. Castilho ◽  
N. Neves ◽  
M. Rufini-Castiglione ◽  
W. Viegas ◽  
J.S. Heslop-Harrison
Keyword(s):  
In Situ Hybridization ◽  
Restriction Fragment ◽  
Dna Sequences ◽  
Genomic Dna ◽  
Restriction Enzymes ◽  
Hybrid Plant ◽  
Rrna Genes ◽  
Next Generation ◽  
Root Tips

Triticale (2n=6x=42) is a hybrid plant including rye (R) and wheat (A and B) genomes. Using genomic in situ hybridization with rye DNA as a probe, we found the chromosomes of the R genome were not intermixed with the wheat chromosomes in 85% of nuclei. After treatment of seedlings with low doses of the drug 5-azacytidine (5-AC), leading to hypomethylation of the DNA, the chromosomes became intermixed in 60% of nuclei; the next generation showed intermediate organization. These results correlate with previous data showing that expression of R-genome rRNA genes, normally suppressed, is activated by 5-AC treatment and remains partially activated in the next generation. The distribution of 5-methylcytosine (5-mC) was studied using an antibody to 5-mC. Methylation was detected along the lengths of all chromosomes; there were some chromosome regions with enhanced and reduced methylation, but these were not located at consistent positions, nor were there differences between R and wheat genome chromosomes. After 5-AC treatment, lower levels of methylation were detected. After 5-AC treatment, in situ hybridization with rye genomic DNA sometimes showed micronuclei of rye origin and multiple translocations between wheat and rye chromosomes. Genomic DNA was analysed using methylation-sensitive restriction enzymes and, as probes, two rDNA sequences, two tandemly organised DNA sequences from rye (pSc200 and pSc250), and copia and the gypsy group retrotransposon fragments from rye and wheat. DNA extracted immediately after 5-AC treatment was cut more by methylation-sensitive restriction enzymes than DNA from untreated seedlings. Each probe gave a characteristic restriction fragment pattern, but rye- and wheat-origin probes behaved similarly, indicating that hypomethylation was induced in both genomes. In DNA samples from leaves taken 13–41 days after treatment, RFLP (Restriction Fragment Length Polymorphism) patterns were indistinguishable from controls and 5-AC treatments with all probes. Surprising differences in hybridization patterns were seen between DNA from root tips and leaves with the copia-fragment probes.

BKm minisatellite sequences are not sex associated but reveal DNA fingerprint polymorphisms in rainbow trout

Genome ◽  
1989 ◽  
Vol 32 (5) ◽  
pp. 865-868 ◽  
Author(s):  
Marilyn A. Lloyd ◽  
Mary J. Fields ◽  
Gary H. Thorgaard
Keyword(s):  
Rainbow Trout ◽  
Genomic Dna ◽  
Repetitive Sequences ◽  
Restriction Enzymes ◽  
Dna Fingerprint ◽  
Salmo Gairdneri ◽  
Agarose Gels ◽  
Outbred Strain ◽  
Males And Females ◽  
Female Snake

GATA-GACA repetitive sequences first isolated from a female snake (termed BKm sequences) and associated with sex chromosomes in some species were hybridized to DNA from rainbow trout (Salmo gairdneri). Genomic DNA was studied from three groups of rainbow trout: (i) randomly selected males and females from an outbred group, (ii) androgenetic individuals from an inbred strain, and (iii) parents and offspring of an outbred strain. Three restriction enzymes (EcoRI, HaeIII, or HinfI) were used to digest the genomic DNA. The DNA was electrophoresed in agarose gels, transferred to nylon membranes, and the GATA-GACA repetitive sequence probe was hybridized to this DNA. There was no evidence of sex-associated patterns of hybridization with the enzymes used. However, the sequences reveal DNA fingerprint polymorphisms which appear to be inherited in a stable manner.Key words: BKm, GATA-GACA repetitive sequences, DNA fingerprint, rainbow trout, Salmo gairdneri.

scholarly journals Identification of Campylobacter jejuni ATCC 43431-Specific Genes by Whole Microbial Genome Comparisons

2004 ◽  
Vol 186 (14) ◽  
pp. 4781-4795 ◽  
Author(s):  
Frédéric Poly ◽  
Deborah Threadgill ◽  
Alain Stintzi
Keyword(s):  
Dna Sequences ◽  
Genomic Dna ◽  
Genomic Library ◽  
Open Reading Frames ◽  
Dna Fragments ◽  
Helicobacter Hepaticus ◽  
Type Iv ◽  
Novel Approach ◽  
The Mean ◽  
Reading Frames

ABSTRACT This study describes a novel approach to identify unique genomic DNA sequences from the unsequenced strain C. jejuni ATCC 43431 by comparison with the sequenced strain C. jejuni NCTC 11168. A shotgun DNA microarray was constructed by arraying 9,600 individual DNA fragments from a C. jejuni ATCC 43431 genomic library onto a glass slide. DNA fragments unique to C. jejuni ATCC 43431 were identified by competitive hybridization to the array with genomic DNA of C. jejuni NCTC 11168. The plasmids containing unique DNA fragments were sequenced, allowing the identification of up to 130 complete and incomplete genes. Potential biological roles were assigned to 66% of the unique open reading frames. The mean G+C content of these unique genes (26%) differs significantly from the G+C content of the entire C. jejuni genome (30.6%). This suggests that they may have been acquired through horizontal gene transfer from an organism with a G+C content lower than that of C. jejuni. Because the two C. jejuni strains differ by Penner serotype, a large proportion of the unique ATCC 43431 genes encode proteins involved in lipooligosaccharide and capsular biosynthesis, as expected. Several unique open reading frames encode enzymes which may contribute to genetic variability, i.e., restriction-modification systems and integrases. Interestingly, many of the unique C. jejuni ATCC 43431 genes show identity with a possible pathogenicity island from Helicobacter hepaticus and components of a potential type IV secretion system. In conclusion, this study provides a valuable resource to further investigate Campylobacter diversity and pathogenesis.

Sign in / Sign up

Export Citation Format

Share Document