The genetic diversity of heat shock protein 70 gene at promoter and 5' untranslated region in beef cattle

2021 ◽  
Vol 46 (2) ◽  
pp. 136-144
Author(s):  
I. Suhendro ◽  
J. Jakaria ◽  
R.R. Noor
Keyword(s):  
Genetic Diversity ◽  
Heat Shock ◽  
Heat Shock Protein ◽  
Beef Cattle ◽  
Heat Shock Protein 70 ◽  
Untranslated Region ◽  
Direct Sequencing ◽  
Single Nucleotide ◽  
Blood Samples ◽  
Sequencing Method

This study was aimed to identify genetic diversity in the promoter area and 5' UTR (untranslated region) HSP70 (heat shock protein 70) gene in several beef cattle in Indonesia. A total of 86 blood samples of Bali, Madura, PO (Peranakan Ongole), Limousine, and BB (Belgian Blue) cattle were used in this study. The extracted DNA of all blood samples was then analyzed using the direct sequencing method. The genotyping results showed the presence of five SNP (Single Nucleotide Polymorphism) in the promoter region, namely g.-393T>C, g.-343C>A, g.-202T>C and g.-69T>G and three SNPs at 5' UTR, i.e., g.19A>G, g.45C>T, and g.100_101ins30. The frequency of SNP alleles found in PO, Limousine, and BB cattle was in equilibrium, whereas in Bali and Madura cattle populations, the allele frequency was disequilibrium. In general, the level of diversity of observed alleles ranged from low to high (0.26-1.00), where SNP g.19A>G had the widest variety. It was successfully revealed in this analysis that the SNP g.-69T>G binds to both the NF-Y and CAAT box transcription factor. In addition, the 30 bp (base pair) insertions (g.100_101ins30) that were identified in Bali and Madura cattle have never been reported in previous research studies.

Associations among heat shock protein 70 genotype, forage system, and horn-fly infestation of beef cattle

2013 ◽  
Vol 29 (3) ◽  
pp. 237-241
Author(s):  
C.M. Turner ◽  
A.H. Brown ◽  
M.A. Brown ◽  
C.D. Steelman ◽  
C.F. Rosenkrans
Keyword(s):  
Heat Shock ◽  
Heat Shock Protein ◽  
Beef Cattle ◽  
Heat Shock Protein 70 ◽  
Horn Fly ◽  
Forage System

scholarly journals The Regulatory Role of Different Exercises in Irisin, Heat Shock Protein 70 and Some Biochemical Parameters

2021 ◽  
Author(s):  
Taner Akbulut ◽  
Vedat Cinar ◽  
Suleyman Aydin ◽  
Meltem Yardim
Keyword(s):  
Heat Shock ◽  
Heat Shock Protein ◽  
Heat Shock Protein 70 ◽  
Biochemical Parameters ◽  
Exercise Program ◽  
Exercise Group ◽  
Human Organism ◽  
Control Group ◽  
Exercise Programs ◽  
Blood Samples

Background: It is known that exercise causes many changes in the human organism. Understanding the metabolisms underlying these changes is an important issue. The aim of the study was to determine the effects of different and regularly applied exercise programs on irisin, heat shock protein 70 and some biochemical parameters. Methods: 120 male university students participated in the study. Participants were divided into 4 equal groups as control (C), resistance exercise group (RE), high intensity interval (HIIT) and aerobic exercise group (AE). While the control group did not perform any exercise, the pre-determined exercise programs were applied to the other groups for 8 weeks and 3 days in a week. Blood samples were taken from all participants before and after the exercise program. Cholesterol, HDL and LDL cholesterol, triglyceride, creatine kinase (CK), lactate dehydrogenase (LDH), Irisin and Heat shock protein 70 (HSP70) levels were analyzed in blood samples. Results: It is determined that there are significant differences in pre-posttest values ​​of the AE group’s LDH, cholesterol, HDL, Triglyceride and HSP 70 levels, HIIT group’s CK, LDH, Cholesterol, HDL, Triglyceride, Irisin and HSP70 levels and RE group’s CK, LDH, Cholesterol, LDL, Triglyceride and irisin levels (p<0.05). Conlusions: It can be said that; exercise can correct abnormalities in lipid profile, changes in HSP70 levels may vary depending on muscle damage, the increase of irisin due to exercise.

scholarly journals Heterozygous Single-Nucleotide Polymorphism Genotypes at Heat Shock Protein 70 Gene Potentially Influence Thermo-Tolerance Among Four Zebu Breeds of Nigeria

2021 ◽  
Vol 12 ◽  
Author(s):  
Gbolabo Olaitan Onasanya ◽  
George Mutani Msalya ◽  
Aranganoor Kannan Thiruvenkadan ◽  
Chirukandoth Sreekumar ◽  
Gopalan Krishnaswamy Tirumurugaan ◽  
...  
Keyword(s):  
Single Nucleotide Polymorphism ◽  
Heat Shock ◽  
Heat Shock Protein ◽  
Genetic Variants ◽  
Heat Shock Protein 70 ◽  
Genotypic Frequency ◽  
Nucleotide Polymorphism ◽  
Single Nucleotide ◽  
Unique Snps

Genetic variants at heat shock protein 70 gene and their influence on heat stress (HS) tolerance were studied among selected Nigeria zebu, namely, 25 White Fulani (WF), 21 Sokoto Gudali (SG), 21 Red Bororo (RB), and 23 Ambala (AM). Detection of single nucleotide polymorphism (SNP) followed by determination of genotype and genotypic frequency was made among the selected breeds. The heat tolerance coefficient (HTC) was determined from thermo-related parameters including body temperature, rectal temperature, and respiratory rate. Thermo-Tolerance was evaluated through the SNP–thermo-parameter relationship. Statistical analyses were done using the GLM procedure in SAS. A quantitative real-time/high-resolution melting-based assay detected twelve genetic variants. Five of these were common and shared across all breeds of cattle. Of the remaining seven variants, three were specifically identified in AM, two in SG, and two in RB. Also, SNPs were evaluated and four unique SNPs (C151T, C146T, G90A, and C219A) were identified. Heterozygous animals had lower HTC suggesting their potential to withstand HS than homozygous counterparts. The WF and RB animals had significantly lower values for all parameters (BT, RT, RR, and HTC) compared to AM and SG breeds. Thermo-related parameters were significantly different (P &lt; 0.001), and it is recommended that screening of SNPs in zebu is needed to enable selection for improved thermo-tolerance.

247 ASSOCIATIONS BETWEEN HEAT SHOCK PROTEIN 70 GENETIC POLYMORPHISMS AND CALVING RATES OF BRAHMAN-INFLUENCED COWS

2010 ◽  
Vol 22 (1) ◽  
pp. 281
Author(s):  
C. Rosenkrans Jr ◽  
A. Banks ◽  
S. Reiter ◽  
L. Starkey ◽  
M. Looper
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Heat Shock Protein ◽  
Genetic Polymorphisms ◽  
Heat Shock Protein 70 ◽  
Promoter Region ◽  
Hsp70 Gene ◽  
Nucleotide Polymorphisms ◽  
Hsp70 Promoter ◽  
Single Nucleotide

Stress proteins and their genetic polymorphisms have been associated with decreased male and female fertility. Our objectives were to 1) identify single nucleotide polymorphisms (SNP) located in the promoter region of the bovine heat shock protein 70 (Hsp70) gene and 2) evaluate associations between Hsp70 SNP and calving rates of multiparous Brahman-influenced cows (n = 99). Genomic DNA was extracted from the buffy coats of EDTA- treated whole blood. Primers HSP-Pro749F (GCCAGGAAACCAGAGACAGA) and HSP-Pro1268R (CCTACGCAGGAGTAGGTGGT) were used for PCR amplification of a 539-base segment of the bovine Hsp70 promoter (GenBank accession number M98823). Eleven single nucleotide polymorphisms were detected: 8 transitions (G1013A, n = 2; G1045A, n = 8; C1069T, n = 4; A1096G, n = 14; G1117A, n = 12; T1134C, n = 7; C1154G, n = 11; andT1204C, n = 56), 2 transversions (A1125C, n = 53; and G1128T, n = 51), and 1 deletion at base position 895 (n = 37). Within an SNP, calving percentages were compared by chi-square analysis. Concentrations of Hsp70 and Julian date were analyzed by ANOVA, with each SNP represented as the main effect in the model. Cows that were homozygous for the minor allele at both transversion (A1125C and G1128T) sites had lower (P < 0.05) calving rates when compared with cows that were homozygous for the primary allele (48 v. 75%). Homozygous and heterozygous deletion of cytosine at base 895 resulted in lower (P < 0.05) calving percentages than homozygous cytosine cows (8, 50, 82%; respectively). In addition, DD cows had the latest (P < 0.05) Julian calving date. Eighteen Hsp70 promoter haplotypes were deduced, and 7 of those haplotypes (n = 37) included the deletion at base 895. Thirty-two cows had the haplotype consistent with the sequence deposited at GenBank, and the remaining 30 cows had an SNP other than the deletion. Cows with the deletion haplotypes had greater (P < 0.05) serum Hsp70 concentrations and lower (P < 0.05) calving rates (5.1, 4.7, and 3.5 MSE 0.5 ng mL-1; and 35, 78, and 87%; respectively, for Deletion, No, and Yes). Furthermore, cows with the deletion haplotypes had the latest (P < 0.05) Julian calving date (85, 77, and 73 d, respectively, for Deletion, No, and Yes). Our results suggest that the promoter region of the bovine Hsp70 gene is polymorphic and might be useful in selecting cows with greater fertility.

5′-Untranslated region of heat shock protein 70 mRNA drives translation under hypertonic conditions

2013 ◽  
Vol 431 (2) ◽  
pp. 321-325 ◽  
Author(s):  
Laura Rocchi ◽  
Roberta R. Alfieri ◽  
Pier Giorgio Petronini ◽  
Lorenzo Montanaro ◽  
Maurizio Brigotti
Keyword(s):  
Heat Shock ◽  
Heat Shock Protein ◽  
Heat Shock Protein 70 ◽  
Untranslated Region

scholarly journals The effect of single-nucleotide polymorphisms within heat shock protein beta 1 on beef quantity in Korean native steers

2020 ◽  
Vol 63 (2) ◽  
pp. 417-422
Author(s):  
Jung-Keun Suh ◽  
Jae-Sung Lee ◽  
Hongsik Kong ◽  
Yoonseok Lee ◽  
Hong-Gu Lee
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Heat Shock Protein ◽  
Direct Sequencing ◽  
Muscle Growth ◽  
Least Square ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Fat Thickness ◽  
The Relationship

Abstract. Heat shock protein beta 1 (HSPB1), a member of the heat-shock family of protein, is a relatively small (27 kDa) molecular chaperone protein associated with cellular development. The relationship between HSPB1 expression and muscle growth in beef cattle has previously been reported, but there have been no reports of DNA markers related to meat quantity in Korean native steers. Therefore, the aim of this study was to evaluate the relationship of single-nucleotide polymorphisms (SNPs) within HSPB1 in terms of the carcass traits related to muscle growth in Korean native steers. Through direct sequencing, we discovered three SNPs: g.111 T > C SNP (rs208395876) and g.2548 C > G SNP (rs483014585) were respectively located in 5′ UTR (untranslated region) and 3′ UTR. Further, g.2352 T > C SNP (rs110832311) was located in the adjacent region of the RNA splicing site. The least square means of steers with a CC genotype of g.111 T > C SNP had a significantly higher meat ratio (P = 0.04), while the least square means of steers with a CC genotype of g.2352 T > C SNP had a significantly higher meat ratio (P = 0.002) and lower back-fat thickness (P = 0.004) than those of the other genotype. Moreover, although the least square means of steers with CC-CC, CT-CC, and TT-CC genotypes were significantly decreased for back-fat thickness, they were significantly increased for the meat ratio. Therefore, our results suggested that g.111 T > C SNP and g.2352 T > C SNP could be a causal mutation related to an adipose metabolism in Korean cattle steer.

Sign in / Sign up

Export Citation Format

Share Document