scholarly journals The links between hypertrophy, reproductive potential and longevity in the Saccharomyces cerevisiae yeast.

2016 ◽  
Vol 63 (2) ◽  
Author(s):  
Mateusz Molon ◽  
Renata Zadrag-Tecza
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Cell Volume ◽  
Genetic Background ◽  
Wild Type Strain ◽  
Reproductive Potential ◽  
Model Organism ◽  
Reproductive Capacity ◽  
Wild Type ◽  
Yeast Saccharomyces Cerevisiae ◽  
Daughter Cells

The yeast Saccharomyces cerevisiae has long been used as a model organism for studying the basic mechanisms of aging. However, the main problem with the use of this unicellular fungus is the unit of "longevity". For all organisms, lifespan is expressed in units of time, while in the case of yeast it is defined by the number of daughter cells produced. Additionally, in yeast the phenotypic effects of mutations often show a clear dependence on the genetic background, suggesting the need for an analysis of strains representing different genetic backgrounds. Our results confirm the data presented in earlier papers that the reproductive potential is strongly associated with an increase in cell volume per generation. An excessive cell volume results in the loss of reproductive capacity. These data clearly support the hypertrophy hypothesis. The time of life of all analysed mutants, with the exception of sch9D, is the same as in the case of the wild-type strain. Interestingly, the 121% increase of the fob1D mutant's reproductive potential compared to the sfp1D mutant does not result in prolongation of the mutant's time of life (total lifespan).

scholarly journals Topoisomerase I involvement in illegitimate recombination in Saccharomyces cerevisiae.

1996 ◽  
Vol 16 (4) ◽  
pp. 1805-1812 ◽  
Author(s):  
J Zhu ◽  
R H Schiestl
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Chromosome Aberrations ◽  
Topoisomerase I ◽  
Wild Type Strain ◽  
Hot Spot ◽  
Illegitimate Recombination ◽  
Wild Type ◽  
Yeast Saccharomyces Cerevisiae

Chromosome aberrations may cause cancer and many heritable diseases. Topoisomerase I has been suspected of causing chromosome aberrations by mediating illegitimate recombination. The effects of deletion and of overexpression of the topoisomerase I gene on illegitimate recombination in the yeast Saccharomyces cerevisiae have been studied. Yeast transformations were carried out with DNA fragments that did not have any homology to the genomic DNA. The frequency of illegitimate integration was 6- to 12-fold increased in a strain overexpressing topoisomerase I compared with that in isogenic control strains. Hot spot sequences [(G/C)(A/T)T] for illegitimate integration target sites accounted for the majority of the additional events after overexpression of topoisomerase I. These hot spot sequences correspond to sequences previously identified in vitro as topoisomerase I preferred cleavage sequences in other organisms. Furthermore, such hot spot sequences were found in 44% of the integration events present in the TOP1 wild-type strain and at a significantly lower frequency in the top1delta strain. Our results provide in vivo evidence that a general eukaryotic topoisomerase I enzyme nicks DNA and ligates nonhomologous ends, leading to illegitimate recombination.

scholarly journals Disruption of the RAD52 gene alters the spectrum of spontaneous SUP4-o mutations in Saccharomyces cerevisiae.

Genetics ◽  
1989 ◽  
Vol 122 (3) ◽  
pp. 535-542 ◽  
Author(s):  
B A Kunz ◽  
M G Peters ◽  
S E Kohalmi ◽  
J D Armstrong ◽  
M Glattke ◽  
...  
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Base Pair ◽  
Type Strain ◽  
Wild Type Strain ◽  
Wild Type ◽  
Yeast Saccharomyces Cerevisiae ◽  
Mutator Phenotype ◽  
In The Wild ◽  
Single Base Pair ◽  
Almost All

Abstract Defects in the RAD52 gene of the yeast Saccharomyces cerevisiae confer a mutator phenotype. To characterize this effect in detail, a collection of 238 spontaneous SUP4-o mutations arising in a strain having a disrupted RAD52 gene was analyzed by DNA sequencing. The resulting mutational spectrum was compared to that derived from an examination of 222 spontaneous mutations selected in a nearisogenic wild-type (RAD52) strain. This comparison revealed that the mutator phenotype was associated with an increase in the frequency of base-pair substitutions. All possible types of substitution were detected but there was a reduction in the relative fraction of A.T----G.C transitions and an increase in the proportion of G.C----C.G transversions. These changes were sufficient to cause a twofold greater preference for substitutions at G.C sites in the rad52 strain despite a decrease in the fraction of G.C----T.A transversions. There were also considerable differences between the distributions of substitutions within the SUP4-o gene. Base-pair changes occurred at fewer sites in the rad52 strain but the mutated sites included several that were not detected in the RAD52 background. Only two of the four sites that were mutated most frequently in the rad52 strain were also prominent in the wild-type strain and mutation frequencies at almost all sites common to both strains were greater for the rad52 derivative. Although single base-pair deletions occurred in the two strains with similar frequencies, several classes of mutation that were recovered in the wild-type background including multiple base-pair deletions, insertions of the yeast transposable element Ty, and more complex changes, were not detected in the rad52 strain.(ABSTRACT TRUNCATED AT 250 WORDS)

scholarly journals A heat shock-resistant mutant of Saccharomyces cerevisiae shows constitutive synthesis of two heat shock proteins and altered growth.

1984 ◽  
Vol 99 (4) ◽  
pp. 1441-1450 ◽  
Author(s):  
H Iida ◽  
I Yahara
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Heat Shock ◽  
Type Strain ◽  
Wild Type Strain ◽  
Growth Control ◽  
Protein S ◽  
Resistant Mutant ◽  
Wild Type ◽  
Yeast Saccharomyces Cerevisiae ◽  
Sulfur Starvation

A heat shock-resistant mutant of the budding yeast Saccharomyces cerevisiae was isolated at the mutation frequency of 10(-7) from a culture treated with ethyl methane sulfonate. Cells of the mutant are approximately 1,000-fold more resistant to lethal heat shock than those of the parental strain. Tetrad analysis indicates that phenotypes revealed by this mutant segregated together in the ratio 2+:2- from heterozygotes constructed with the wild-type strain of the opposite mating type, and are, therefore, attributed to a single nuclear mutation. The mutated gene in the mutant was herein designated hsr1 (heat shock response). The hsr1 allele is recessive to the HSR1+ allele of the wild-type strain. Exponentially growing cells of hsr1 mutant were found to constitutively synthesize six proteins that are not synthesized or are synthesized at reduced rates in HSR1+ cells unless appropriately induced. These proteins include one hsp/G0-protein (hsp48A), one hsp (hsp48B), and two G0-proteins (p73, p56). Heterozygous diploid (hsr1/HSR1+) cells do not synthesize the proteins constitutively induced in hsr1 cells, which suggests that the product of the HSR1 gene might negatively regulate the synthesis of these proteins. The hsr1 mutation also led to altered growth of the mutant cells. The mutation elongated the duration of G1 period in the cell cycle and affected both growth arrest by sulfur starvation and growth recovery from it. We discuss the problem of which protein(s) among those constitutively expressed in growing cells of the hsr1 mutant is responsible for heat shock resistance and alterations in the growth control.

scholarly journals Membrane proteins associated with amino acid transport by yeast (Saccharomyces cerevisiae)

1980 ◽  
Vol 192 (2) ◽  
pp. 659-664 ◽  
Author(s):  
J R Woodward ◽  
H L Kornberg
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Amino Acid ◽  
Membrane Proteins ◽  
Wild Type Strain ◽  
Osmotic Shock ◽  
Wild Type ◽  
Amino Acid Permease ◽  
Yeast Saccharomyces Cerevisiae ◽  
General Amino Acid Permease ◽  
Wild Type Yeast

Cells of the wild-type yeast (Saccharomyces cerevisiae) strain Y185, grown under conditions that de-repress the formation of a general amino acid permease (‘Gap’) system, bind delta-N-chloroacetyl[1-(14)C]ornithine; L- and D-amino acid substrates of the general amino acid permease system protect against this binding. The protein responsible is released from the cells by homogenization or by preparation of protoplasts; it is not released by osmotic shock. This protein is virtually absent from the wild-type strain when it is grown under conditions that repress the general amino acid permease system, and is also absent from a Gap- mutant Y185-His3, selected by its resistance to D-amino acids. This mutant and repressed wild-type cells also fail to form a number of membrane proteins elaborated by de-repressed wild-type cells. It is possible that all these proteins are components of the general amino acid permease system.

Complementary transcripts from two genes necessary for normal meiosis in the yeast Saccharomyces cerevisiae

1990 ◽  
Vol 10 (6) ◽  
pp. 2809-2819
Author(s):  
M J Malavasic ◽  
R T Elder
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Wild Type Strain ◽  
Specific Gene ◽  
Wild Type ◽  
Yeast Saccharomyces Cerevisiae ◽  
Spore Viability ◽  
Reading Frame ◽  
Dna Strands ◽  
Normal Meiosis ◽  
Sequence Similarities

The SPO12 gene, which is required for meiosis I chromosome division during sporulation of the yeast Saccharomyces cerevisiae, has been isolated. DNA sequencing has identified an open reading frame of 173 codons that encodes the putative SPO12 protein and has no significant sequence similarities to known genes. The last 15 amino acids of this putative protein have a high negative charge, which appears to be required for function. A second sporulation-specific gene, designated SPO16, was found adjacent to SPO12 and shown to be necessary for efficient spore formation. The two genes are encoded on opposite DNA strands with only 103 nucleotides between the termination codons. Up to 700 nucleotides of the SPO12 and SPO16 transcripts are complementary, and the 3' untranslated region of the longest SPO16 transcript is complementary to all or nearly all of the SPO12 mRNA. A strain homozygous for an insertion which removes the complementarity between the SPO12 and SPO16 mRNAs has an efficiency of sporulation, number of spores per ascus, and spore viability identical to those of a wild-type strain. The complementarity therefore has either no function or only a subtle function in meiosis and sporulation.

scholarly journals Transcription of Cell Wall Mannoproteins-1 gene in Saccharomyces cerevisiae Mutant

2018 ◽  
Vol 4 (2) ◽  
pp. 174-181
Author(s):  
Hermansyah Hermansyah
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Protein Phosphatase ◽  
Genetic Background ◽  
Wild Type Strain ◽  
Pcr Analysis ◽  
Transcriptional Level ◽  
Amino Acid Residues ◽  
Wild Type ◽  
Rt Pcr ◽  
Phosphate Groups

Protein phosphatase (PPases) are enzymes to catalyze the phosphate groups removal from amino acid residues of proteins by protein kinases.  The PPG1, one of PPases in Saccharomyces cerevisiae has less information in function/role.  In this research, the disruption of DPPG1::CgHIS3 in FY833 genetic background was successfully constructed by PCR-mediated disruption strategies using pCgHIS3 (EcoRI-HindIII) (=pYMS314) (pUC19 base) and primer pair of PPG1, forward (41 to 100) and reverse (1048 to 1101).  A BamHI - BamHI fragment 3,28 kb DPPG1::CgHIS3 consisting of 1 kb upstream PPG1+ 1.78 kb CgHIS3 + 0.5 down stream of PPG1) was confirmed using PCR and detected using electrophoresis. Phenotypic assay of DPPG1::CgHIS3 in FY833 and did not show 200mg/ml Calco fluor sensitivity, while another mutant DPPG1::CgHIS3 in W303-IA show 100mg/ml congo red sensitivity. Furthermore, to confirm whether DPPG1 could increase a CWP1 transcriptional level was performed Real Time (RT) PCR analysis using Primer pair Kf (AATTCGGCCTGGTGAGTATCC) and Kr (GTTTCAAAGTGCCGTTATCACT GT). RT-PCR’s data showed that transcriptional level of CWP1 in DPPG1::CgHIS3 changed less than two-folds comparing with in wild type strain. This result indicated that disruption of PPG1 in S.cerevisiae did not change CWP1 transcriptional level significantly.  

scholarly journals Complementary transcripts from two genes necessary for normal meiosis in the yeast Saccharomyces cerevisiae.

1990 ◽  
Vol 10 (6) ◽  
pp. 2809-2819 ◽  
Author(s):  
M J Malavasic ◽  
R T Elder
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Wild Type Strain ◽  
Specific Gene ◽  
Wild Type ◽  
Yeast Saccharomyces Cerevisiae ◽  
Spore Viability ◽  
Reading Frame ◽  
Dna Strands ◽  
Normal Meiosis ◽  
Sequence Similarities

The SPO12 gene, which is required for meiosis I chromosome division during sporulation of the yeast Saccharomyces cerevisiae, has been isolated. DNA sequencing has identified an open reading frame of 173 codons that encodes the putative SPO12 protein and has no significant sequence similarities to known genes. The last 15 amino acids of this putative protein have a high negative charge, which appears to be required for function. A second sporulation-specific gene, designated SPO16, was found adjacent to SPO12 and shown to be necessary for efficient spore formation. The two genes are encoded on opposite DNA strands with only 103 nucleotides between the termination codons. Up to 700 nucleotides of the SPO12 and SPO16 transcripts are complementary, and the 3' untranslated region of the longest SPO16 transcript is complementary to all or nearly all of the SPO12 mRNA. A strain homozygous for an insertion which removes the complementarity between the SPO12 and SPO16 mRNAs has an efficiency of sporulation, number of spores per ascus, and spore viability identical to those of a wild-type strain. The complementarity therefore has either no function or only a subtle function in meiosis and sporulation.

scholarly journals Dependence of the yeast Saccharomyces cerevisiae post-reproductive lifespan on the reproductive potential.

2013 ◽  
Vol 60 (1) ◽  
Author(s):  
Renata Zadrag-Tecza ◽  
Mateusz Molon ◽  
Jan Mamczur ◽  
Tomasz Bilinski
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Inverse Relationship ◽  
Budding Yeast ◽  
Reproductive Potential ◽  
Model Organism ◽  
Reproductive Stage ◽  
Yeast Cells ◽  
Yeast Saccharomyces Cerevisiae ◽  
Two Stages

The lifespan of budding yeast cells is divided into two stages: reproductive and post-reproductive. The post-reproductive stage of the yeast's lifespan has never been characterized before. We have analyzed the influence of various mutations on the post-reproductive (PRLS) and replicative (RLS) lifespans. The results indicate that PRLS demonstrates an inverse relationship with RLS. The observed lack of differences in the total lifespan (TLS) (expressed in units of time) of strains differing up to five times in RLS (expressed in the number of daughters formed) suggests the necessity of revision of opinions concerning the use of yeast as a model organism of gerontology.

scholarly journals Effects of Mutations of RAD50, RAD51, RAD52, and Related Genes on Illegitimate Recombination in Saccharomyces cerevisiae

Genetics ◽  
1996 ◽  
Vol 142 (2) ◽  
pp. 383-391 ◽  
Author(s):  
Yasumasa Tsukamoto ◽  
Jun-ichi Kato ◽  
Hideo Ikeda
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Quantitative Analysis ◽  
Structural Analysis ◽  
Recombination Rate ◽  
Type Strain ◽  
Negative Selection ◽  
Wild Type Strain ◽  
Illegitimate Recombination ◽  
Wild Type ◽  
In The Wild

Abstract To examine the mechanism of illegitimate recombination in Saccharomyces cerevisiae, we have developed a plasmid system for quantitative analysis of deletion formation. A can1 cyh2 cell carrying two negative selection markers, the CAN1 and CYH2 genes, on a YCp plasmid is sensitive to canavanine and cycloheximide, but the cell becomes resistant to both drugs when the plasmid has a deletion over the CAN1 and CYH2 genes. Structural analysis of the recombinant plasmids obtained from the resistant cells showed that the plasmids had deletions at various sites of the CAN1-CYH2 region and there were only short regions of homology (1-5 bp) at the recombination junctions. The results indicated that the deletion detected in this system were formed by illegitimate recombination. Study on the effect of several rad mutations showed that the recombination rate was reduced by 30-, 10-, 10-, and 10-fold in the rad52, rad50, mre11, and xrs2 mutants, respectively, while in the rud51, 54, 55, and 57 mutants, the rate was comparable to that in the wild-type strain. The rad52 mutation did not affect length of homology at junction sites of illegitimate recombination.

Sign in / Sign up

Export Citation Format

Share Document