DETEKSI SECARA SEROLOGI DAN MOLEKULER BEBERAPA JENIS VIRUS YANG BERASOSIASI DENGAN PENYAKIT MOSAIK TANAMAN NILAM (Pogostemon cablin Benth)

ABSTRAK Penyakit mosaik pada tanaman nilam disebabkan oleh beberapa jenis virus, yaitu Potyvirus, Potexvirus, Cucumber mosaic virus (CMV), dan Broad bean wilt virus 2 (BBWV2). Penelitian ini bertujuan untuk mengidentifikasi secara serologi dan molekuler virus-virus yang berasosiasi dengan gejala mosaik pada nilam di KP. Manoko, KP. Cicurug dan lahan petani di Cijeruk. Sampel daun nilam baik yang menunjukkan gejala mosaik atau pun tidak diambil dari setiap lokasi penanaman masing–masing sebanyak 30 sampel. Kejadian penyakit ditentukan melalui deteksi serologi dengan Direct-ELISA dan Indirect-ELISA terhadap sampel menggunakan empat antiserum, yaitu CMV, Cymbidium mosaic virus (CymMV), Potyvirus, dan BBWV2. Deteksi molekuler dengan RT-PCR dilakukan untuk mengonfirmasi virus baru yang ditemukan. Hasil penelitian menunjukkan bahwa gejala infeksi virus yang ditemukan pada nilam bervariasi, yaitu mosaik lemah, mosaik kuning hijau, mosaik dengan penebalan, mosaik dengan malformasi daun, dan bintik kuning. Secara serologi, kejadian virus pada setiap kebun bervariasi. Di KP Manoko, Potyvirus dan BBWV2 lebih dominan (100%) dibandingkan CymMV. Di KP Cicurug, kejadian Potyvirus dan CMV terlihat lebih dominan (83,3 dan 80%) dibandingkan BBWV2 dan CymMV, sedangkan di Cijeruk, BBWV2 lebih dominan (90%) dari Potyvirus (50%) dan CMV (13,3%). Hasil RT- PCR dengan primer degenerate BBWV, diidentifikasi BBWV2 pada sampel daun nilam dari Manoko, Cicurug, dan Cijeruk, sedangkan dengan primer general Potexvirus, diidentifikasi CymMV hanya dari sampel daun nilam dari asal Manoko. Hasil penelitian ini merupakan laporan pertama tentang BBWV2 dan CymMV pada tanaman nilam di Jawa Barat yang mengindikasikan bahwa virus merupakan kendala utama pada perbenihan nilam yang harus segera diatasi. Kata kunci: BBWV2, CymMV, mosaik, Pogostemon cablin Benth, PCRABSTRACT Mosaic symptoms on patchouli plant are associated with several viruses, i.e. Potyvirus, Potexvirus, CMV, and BBWV2. The objective of the study was to detect virus(es) associated with mosaic symptoms on patchouli at the the patchouli seed nurseries, in Manoko, Cicurug, and Cijeruk. Thirty leaf samples either showing typical symptomatic mosaic or asymptomatic were taken from each location. Serological testing by Direct-ELISA and Indirect-ELISA using four antisera namely CMV, Cymbidium mosaic virus (CymMV), Potyvirus, and BBWV2 was carried out to test the incidence of each virus. Molecular detection by RT-PCR was performed to confirm the new virus(es). The results showed that symptoms of virus infection were found vary, i.e. weak mosaic, green yellow mosaic, mosaic with thickening, mosaic with leaf malformations, and yellow spot. Based on the serological detection, virus(es) incidence varied at each seed nurseries. In Manoko, Potyvirus, and BBWV2 were more dominant (100%) compared with CymMV. In Cicurug, Potyvirus and CMV were more dominat (83.3 and 80%) compared with BBWV2 and CymMV. While in Cijeruk, BBWV2 was the most dominant (90%) than Potyvirus (50%) and CMV(13.3%). Result of RT-PCR with degenerate primers pair of BBWV was succesfully identified BBWV2 from Manoko, Cicurug, and Cijeruk samples, whereas by using Potexvirus general primary, CymMV was identified only from Manoko samples. BBWV2 and CymMV were first reported to infect patchouli in West Java. The result indicate that virus(es) are the major constraint on patchouli seed that should be managed immediately. Key words: BBWV2, CymMV, mosaic, Pogostemon cablin Benth, PCR

Download Full-text

IDENTIFIKASI MOLEKULER BROAD BEAN WILT VIRUS 2 (BBWV2) DAN CYMBIDIUM MOSAIC VIRUS (CYMMV) ASAL TANAMAN NILAM (POGOSTEMON CABLIN BENTH.)

JURNAL HAMA DAN PENYAKIT TUMBUHAN TROPIKA ◽

10.23960/j.hptt.215188-199 ◽

2016 ◽

Vol 15 (2) ◽

pp. 188

Author(s):

Miftakhurohmah . ◽

Gede Suastika ◽

Tri Asmira Damayanti ◽

Rita Noveriza

Keyword(s):

South Korea ◽

Mosaic Virus ◽

Broad Bean ◽

Rna Extraction ◽

Rt Pcr ◽

West Java ◽

Cymbidium Mosaic Virus ◽

Pogostemon Cablin ◽

Wilt Virus ◽

Broad Bean Wilt Virus

Molecular identification Broad Bean Wilt Virus 2 (BBWV2) and Cymbidium Mosaic Virus (CymMV) from patchouli plant (Pogostemon cablin Benth.). Several viruses have been reported to be associated with mosaic disease on patchouli plant in Indonesia. This study aims to identify the two viruses in patchouli cultivation in West Java by studying the molecular characterization. Mosaic symptomatic leaf samples taken from patchouli cultivation in Manoko (Bandung Barat District, West Java Province). RNA extraction was performed using Xprep Plant RNA mini kit. RNA amplification with RT-PCR technique using primers for the cp gene region of BBWV2 and CymMV. The PCR product was sent to PT. Science Genetics Indonesia to do sequencing, then analyzed nucleotide sequences. Results of RT-PCR were performed successfully obtained DNA bands with size accordance with the predictions of the primer design for BBWV2 and CymMV cp region. Further, based on nucleotide and amino acid sequence analyses, the two virus isolates were confirmed as BBWV2 and CymMV respectively. Phylogenetic analyses revealed that BBWV2 Manoko clustered with BBWV2 from Singapore (original host of Brazilian red-cloak), China (pepper) and South Korea (chili). Whereas, CymMV Manoko become one cluster with CymMV from India (Phaius sp.), Indonesia (Dendrobium), China (vanilla), Thailand (Oncidium), Hawai (Dendrobium) and South Korea Cymbidium).

Download Full-text

VIRUS NILAM: IDENTIFIKASI, KARAKTER BIOLOGI DAN FISIK, SERTA UPAYA PENGENDALIANNYA

Jurnal Penelitian dan Pengembangan Pertanian ◽

10.21082/jp3.v34n1.2015.p1-8 ◽

2015 ◽

Vol 34 (1) ◽

pp. 1 ◽

Cited By ~ 1

Author(s):

Miftakhurohmah Miftakhurohmah ◽

Rita Noveriza

Keyword(s):

Mosaic Virus ◽

Yellow Mosaic Virus ◽

Tobacco Necrosis Virus ◽

Rt Pcr ◽

Cymbidium Mosaic Virus ◽

Peanut Stripe Virus ◽

Mild Mosaic Virus ◽

Wilt Virus ◽

Broad Bean Wilt Virus

Infeksi virus pada tanaman nilam dapat menyebabkan penurunan produksi dan kualitas minyak. Sembilan jenis virus diidentifikasi menginfeksi tanaman nilam, yaitu Patchouli mosaic virus (PatMoV), Patchouli mild mosaic virus (PatMMV), Telosma mosaic virus (TeMV), Peanut stripe virus (PStV), Patchouli yellow mosaic virus (PatYMV), Tobacco necrosis virus (TNV), Broad bean wilt virus 2 (BBWV2), Cucumber mosaic virus (CMV), dan Cymbidium mosaic virus (CymMV). Kesembilan virus tersebut memiliki genom RNA, tetapi panjang dan bentuk partikelnya berbeda. Deteksi dan identifikasi berdasarkan bagian partikel virus dapat dilakukan secara serologi dengan teknik ELISA dan secara molekuler dengan RT-PCR. Gejala awal tanaman nilam terserang virus yaitu mosaik atau belang pada daun pucuk dan pada gejala berat tanaman menjadi kerdil. Infeksi virus dapat bersifat tunggal, tetapi ada pula infeksi oleh beberapa virus. Virus menular secara mekanis dan sebagian melalui penyambungan dan vektor. TNV, BBWV2, dan CMV memiliki kisaran inang yang luas, sedangkan virus yang lain inangnya terbatas. Virus nilam umumnya memiliki titik panas inaktivasi dan titik batas pengenceran yang tinggi, sedangkan ketahanan in vitro tidak stabil. Pendekatan terbaik pengendalian virus ialah menggunakan bahan tanaman bebas virus atau tahan virus dan pengendalian vektor. Tanaman bebas virus dapat diperoleh melalui kultur meristem, sedangkan pengendalian vektor dapat menggunakan pestisida nabati atau kimia.

Download Full-text

First Report of Cucumber mosaic virus on Vigna marina in Taiwan

Plant Disease ◽

10.1094/pdis-06-10-0459 ◽

2010 ◽

Vol 94 (10) ◽

pp. 1267-1267 ◽

Cited By ~ 1

Author(s):

T.-C. Deng ◽

C.-H. Tsai ◽

H.-L. Tsai ◽

J.-Y. Liao ◽

W.-C. Huang

Keyword(s):

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Broad Bean ◽

Solomon Islands ◽

Natural Host ◽

Vector System ◽

Rt Pcr ◽

First Report ◽

Wilt Virus ◽

Broad Bean Wilt Virus

Vigna marina (Burm.) Merr., the dune bean or notched cowpea, is a tropical creeping vine that grows on sand dunes along the coastal regions of Taiwan. Although V. marina is a weed, some varieties are also grown for fodder and food. This legume is a natural host of Bean common mosaic virus in the Solomon Islands (1) and Alfalfa mosaic virus or Beet western yellows virus in Australia (2). In April 2009, plants of V. marina showing severe mosaic and chlorotic ringspots on the foliage were found in the coastal region of Hualien County in eastern Taiwan. Indirect ELISA on a single diseased plant showed positive results with antibodies against the cucumber isolate of Cucumber mosaic virus (CMV) but negative to Broad bean wilt virus-1, Broad bean wilt virus-2, and some potyviruses (Agdia Inc., Elkhart, IN). A pure isolate of CMV was obtained from V. marina through three successive passages of single lesion isolation in sap-inoculated Chenopodium quinoa. Results of mechanical inoculations showed that the CMV-V. marina isolate was successfully transmitted to C. amaranticolor, C. murale, C. quinoa, Chrysanthemum coronarium, Gomphrena globosa, Nicotiana benthamiana, N. tabacum cv. Vam-Hicks, Phaseolus limensis, P. lunatus, P. vulgaris, Tetragonia tetragonioides, V. marina, V. radiata, and V. unguiculata subsp. sesquipedalis. These results of artificial inoculations were confirmed by ELISA. Homologous reactions of the CMV-V. marina isolate with a stock polyclonal antiserum against the CMV-cucumber isolate (4) were observed in sodium dodecyl sulfate-immunodiffusion. To determine the specific CMV subgroup, total RNA was extracted from inoculated leaves of C. quinoa using the Total Plant RNA Extraction Miniprep System (Viogene, Sunnyvale, CA). A DNA fragment of 940 bp covering the 3′ end of the coat protein gene and C-terminal noncoding region of RNA-3 was amplified using the Cucumovirus-specific primers (3) after reverse transcription (RT)-PCR with AccuPower RT/PCR PreMix Kit (Bioneer, Daejeon, Korea). The product was gel purified by Micro-Elute DNA/Clean Extraction Kit (GeneMark Technology Co., Tainan, Taiwan) and cloned in yT&A Cloning Vector System (Yeastern Biotech Co., Taipei, Taiwan) for sequencing (Mission Biotech Co., Taipei, Taiwan) and the sequence was submitted to GenBank (No. HM015286). Pairwise comparisons of the sequence of CMV-V. marina isolate with corresponding sequences of other CMV isolates revealed the maximum (95 to 96%) nucleotide identities with CMV subgroup IB isolates (strains Nt9 and Tfn) compared with 94 to 95% identities with subgroup IA isolates (strains Y and Fny) or 77 to 78% identities with subgroup II (strains LS and Q). These results suggest that CMV is the causal agent for the mosaic disease of V. marina in Taiwan and the isolate belongs to subgroup I. To our knowledge, this is the first report of V. marina as a natural host of CMV. This strain of CMV with specific pathogenicity could threaten crop production in the coastal zones. In addition, V. marina associated with native coastal vegetation was injured by CMV infection, which might lead to ecological impacts on shoreline fading. References: (1) A. A. Brunt. Surveys for Plant Viruses and Virus Diseases in Solomon Islands. FAO, Rome, 1987. (2) C. Büchen-Osmond, ed. Viruses of Plants in Australia. Retrieved from http://www.ictvdb.rothamsted.ac.uk/Aussi/aussi.htm . September, 2002. (3) S. K. Choi et al. J. Virol. Methods 83:67, 1999. (4) S. H. Hseu et al. Plant Prot. Bull. (Taiwan) 29:233, 1987.

Download Full-text

First Report of Tomato mottle mosaic virus Infection of Pepper in China

Plant Disease ◽

10.1094/pdis-03-14-0317-pdn ◽

2014 ◽

Vol 98 (10) ◽

pp. 1447-1447 ◽

Cited By ~ 16

Author(s):

Y. Y. Li ◽

C. L. Wang ◽

D. Xiang ◽

R. H. Li ◽

Y. Liu ◽

...

Keyword(s):

Mosaic Virus ◽

Broad Bean ◽

Bell Pepper ◽

Tomato Mosaic Virus ◽

Rt Pcr ◽

Degenerate Primers ◽

Autonomous Region ◽

First Report ◽

Tibet Autonomous Region ◽

Wilt Virus

Tomato mottle mosaic virus (ToMMV), a tentative member in genus Tobamovirus, was first reported from a greenhouse tomato sample collected in Mexico in 2013 (2). In August 2013, foliar mottle, shrinking, and necrosis were observed on pepper plants in several vegetable greenhouses of Lhasa, Tibet Autonomous Region, China. Seven symptomatic samples were collected and tested by dot-blot ELISA with antisera against Cucumber mosaic virus, Tobacco mosaic virus (TMV), Cucumber green mottle mosaic virus, Tomato spotted wilt virus, Turnip mosaic virus, and Broad bean wilt virus 2 (kindly provided by Dr. Xueping Zhou of Zhejiang University, China) (3). One of the bell pepper (Capsicum annuum var. grossum) samples reacted with the TMV antibody. Rod-shaped virus particles 300 nm in length were observed in this sample under electron microscopy. The results suggested that a tobamovirus closely related to TMV might be a causal agent. Total nucleic acids were then extracted from all seven samples using a CTAB method (1) and tested by RT-PCR using a pair of tobamovirus degenerate primers, TobamoF (GCWAAGGTKGTWYTBGTRGAYGG) and TobamoR (GTAATTGCTATTGDGTWCCWGC). These two primers were designed according to a conserved region of the TMV, Tomato mosaic virus, and ToMMV genomes (nt 2551-3433 of ToMMV genome [KF477193]). An amplicon of approximately 880 bp was obtained only from the TMV-positive sample. The amplicon was cloned and sequenced (GenBank Accession No. KJ605653). NCBI BLAST search showed that it shared the highest identity (99%) with ToMMV (KF477193), and shared the sequence homology of 82% to Tomato mosaic virus (AF332868) and 77% to TMV (V01408). The results indicated that the symptomatic pepper was infected with ToMMV. To investigate the distribution and incidence of ToMMV, 313 samples of symptomatic pepper, tomato, pumpkin, cucumber, radish, Chinese cabbage, broad bean, pea, and kidney bean samples were collected from 65 fields in Yunnan Province and Tibet Autonomous Region, and tested in RT-PCR with ToMMV-specific primers ToMMVF (AGAGAGATGGCGATAGGTTAAC, identical to nt 830-851 of ToMMV genome, GenBank Accession No. KF477193) and ToMMVR (CTGCAGTCATAGGATCTACTTC, complementary to nt1849-1828). The virus was detected in three tabasco peppers (C. frutescens) from Yunnan and one bell pepper plant from Tibet, suggesting that ToMMV has a restricted host range and is not common in these two regions. To our knowledge, this is the first report of natural infection of ToMMV in peppers as well as in China. References: (1) R. Li et al. J. Virol. Methods 154:48, 2008. (2) R. Li et al. Genome Announc. 1(5):e00794-13, 2013. (3) Y. Xie et al. Virol. J. 10:142, 2013.

Download Full-text

Metagenomic Analysis of Marigold: Mixed Infection Including Two New Viruses

Viruses ◽

10.3390/v13071254 ◽

2021 ◽

Vol 13 (7) ◽

pp. 1254

Author(s):

Hang Yin ◽

Zheng Dong ◽

Xulong Wang ◽

Shuhao Lu ◽

Fei Xia ◽

...

Keyword(s):

Phylogenetic Analysis ◽

Mosaic Virus ◽

Complete Genome ◽

Plum Pox Virus ◽

Cryptic Virus ◽

Sequence Identity ◽

Complete Genome Sequence Analysis ◽

Wilt Virus ◽

Broad Bean Wilt Virus

Marigold plants with symptoms of mosaic, crinkle, leaf curl and necrosis were observed and small RNA and ribo-depleted total RNA deep sequencing were conducted to identify the associated viruses. Broad bean wilt virus 2, cucumber mosaic virus, turnip mosaic virus, a new potyvirus tentatively named marigold mosaic virus (MMV) and a new partitivirus named as marigold cryptic virus (MCV) were finally identified. Complete genome sequence analysis showed MMV was 9811 nt in length, encoding a large polyprotein with highest aa sequence identity (57%) with the putative potyvirus polygonatumkingianum virus 1. Phylogenetic analysis with the definite potyviruses based on the polyprotein sequence showed MMV clustered closest to plum pox virus. The complete genome of MCV comprised of dsRNA1 (1583 bp) and dsRNA2 (1459 bp), encoding the RNA-dependent RNA polymerase (RdRp), and coat protein (CP), respectively. MCV RdRp shared the highest (75.7%) aa sequence identity with the unclassified partitivirus ambrosia cryptic virus 2, and 59.0%, 57.1%, 56.1%, 54.5% and 33.7% with the corresponding region of the definite delta-partitiviruses, pepper cryptic virus 2, beet cryptic virus 3, beet cryptic virus 2, pepper cryptic virus 1 and fig cryptic virus, respectively. Phylogenetic analysis based on the RdRp aa sequence showed MCV clustered into the delta-partitivirus group. These findings enriched our knowledge of viruses infecting marigold, but the association of the observed symptom and the identified viruses and the biological characterization of the new viruses should be further investigated.

Download Full-text

First Report of Yam mild mosaic virus in Yam in Guangxi Province, China

Plant Disease ◽

10.1094/pdis-04-11-0350 ◽

2011 ◽

Vol 95 (10) ◽

pp. 1320-1320 ◽

Cited By ~ 4

Author(s):

C. Zou ◽

J. Meng ◽

Z. Li ◽

M. Wei ◽

J. Song ◽

...

Keyword(s):

Mosaic Virus ◽

Viral Genome ◽

Terminal Region ◽

Mild Mosaic ◽

Rt Pcr ◽

Degenerate Primers ◽

Germplasm Exchange ◽

First Report ◽

Pcr Products ◽

Mild Mosaic Virus

Yams (Dioscorea spp.) are widely grown in China as vegetables and herbal medicine. However, studies on viral diseases on yams are still limited. As a pilot project of a government initiative for improving yam productivity, a small study was conducted in Guangxi, a southern province of China, on viral disease in yams. Incidence of virus-like disease for the three extensively grown D. alata cultivars, GH2, GH5, and GH6, were 12 to 40%, 12 to 29%, and 11 to 25%, respectively, as found in a field survey with a five-plot sampling method in 2010. A total of 112 leaf samples showing mosaic or mottling or leaves without symptoms were collected from the cvs. GH2, GH5, GH6, and seven additional cultivars (D. alata cvs. GY2, GY23, GY47, GY69, GY62, GY72, and D. batatas cv. Tiegun). To determine if the symptoms were caused by Yam mild mosaic virus (YMMV; genus Potyvirus, family Potyviridae), total RNA was extracted from leaves with a commercial RNA purification kit (TIANGEN, Beijing, China), and reverse-transcription (RT)-PCR was conducted with a YMMV-specific primer pair (4) that amplifies the 3′-terminal portion of the viral genome. A PCR product with the predicted size of 262 bp was obtained from samples of GH5 (number testing positive of total number of leaves = 5 of 12), GH6 (24 of 42), and GY72 (1 of 1), but not from asymptomatic leaves. PCR products from a GH5 sample (YMMV-Nanning) and a GH6 sample (YMMV-Luzhai) were cloned and sequenced using an ABI PRISM 3770 DNA Sequencer. The two PCR products were 97% identical at nucleotide (nt) level and with the highest homology (89% identity) to a YMMV isolate (GenBank Accession No. AJ305466). To further characterize the isolates, degenerate primers (2) were used to amplify viral genome sequence corresponding to the C-terminal region of the nuclear inclusion protein b (NIb) and the N-terminal region of the coat protein (CP). These 781-nt fragments were sequenced and a new primer, YMMV For1 (5′-TTCATGTCGCACAAAGCAGTTAAG-3′) corresponding to the NIb region, was designed and used together with primer YMMV UTR 1R to amplify a fragment that covers the complete CP region of YMMV by RT-PCR. These 1,278-nt fragments were sequenced (GenBank Accession Nos. JF357962 and JF357963). CP nucleotide sequences of the YMMV-Nanning and YMMV-Luzhai isolates were 94% similar, while amino acid sequences were 99% similar. BLAST searches revealed a nucleotide identity of 82 to 89% and a similarity of 88 to 97% for amino acids to sequences of YMMV isolates (AF548499 and AF548519 and AAQ12304 and BAA82070, respectively) in GenBank. YMMV is known to be prevalent on D. alata in Africa and the South Pacific, and has recently been identified in the Caribbean (1) and Colombia (3). To our knowledge, this is the first report of the natural occurrence of YMMV in China and it may have implications for yam production and germplasm exchange within China. References: (1) M. Bousalem and S. Dallot. Plant Dis. 84:200, 2000. (2) D. Colinet et al. Phytopathology 84:65, 1994. (3) S. Dallot et al. Plant Dis. 85:803, 2001. (4) R. A. Mumford and S. E. Seal. J. Virol. Methods 69:73, 1997.

Download Full-text

Tropical soda apple mosaic virus Identified in Solanum capsicoides in Florida

Plant Disease ◽

10.1094/pdis-91-9-1204a ◽

2007 ◽

Vol 91 (9) ◽

pp. 1204-1204 ◽

Cited By ~ 2

Author(s):

S. Adkins ◽

G. McAvoy ◽

E. N. Rosskopf

Keyword(s):

Sequence Analysis ◽

Mosaic Virus ◽

Sandwich Elisa ◽

Tomato Mosaic Virus ◽

Rt Pcr ◽

Degenerate Primers ◽

Lee County ◽

Cp Gene ◽

Local Lesions ◽

Tropical Soda Apple

Red soda apple (Solanum capsicoides All.), a member of the Solanaceae, is a weed originally from Brazil (3). It is a perennial in southern Florida and is characterized by abundant prickles on stems, petioles, and leaves. Prickles on stems are more dense than those on its larger, noxious weed relative, tropical soda apple (Solanum viarum Dunal), and the mature red soda apple fruits are bright red in contrast to the yellow fruits of tropical soda apple (2). Virus-like foliar symptoms of light and dark green mosaic were observed on the leaves of a red soda apple in a Lee County cow pasture during a tropical soda apple survey during the fall of 2004. The appearance of necrotic local lesions following inoculation of Nicotiana tabacum cv. Xanthi nc with sap from the symptomatic red soda apple leaves suggested the presence of a tobamovirus. Tropical soda apple mosaic virus (TSAMV), a recently described tobamovirus isolated from tropical soda apple in Florida, was specifically identified by a double-antibody sandwich-ELISA (1). An additional six similarly symptomatic red soda apple plants were later collected in the Devils Garden area of Hendry County. Inoculation of N. tabacum cv. Xanthi nc with sap from each of these symptomatic plants also resulted in necrotic local lesions. Sequence analysis of the TSAMV coat protein (CP) gene amplified from total RNA by reverse transcription (RT)-PCR with a mixture of upstream (SolA5′CPv = 5′-GAACTTWCAGAAGMAGTYGTTGATGAGTT-3′; SolB5′CPv = 5′-GAACTCACTGARRMRGTTGTTGAKGAGTT-3′) and downstream (SolA3′CPvc = 5′-CCCTTCGATTTAAGTGGAGGGAAAAAC-3′; SolB3′CPvc = 5′-CGTTTMKATTYAAGTGGASGRAHAAMCACT-3′) degenerate primers flanking the CP gene of Solanaceae-infecting tobamoviruses confirmed the presence of TSAMV in all plants from both locations. Nucleotide and deduced amino acid sequences of the 483-bp CP gene were both 98 to 99% identical to the original TSAMV CP gene sequences in GenBank (Accession No. AY956381). TSAMV was previously identified in tropical soda apple in these two locations in Lee and Hendry counties and three other areas in Florida (1). Sequence analysis of the RT-PCR products also revealed the presence of Tomato mosaic virus in the plant from Lee County. To our knowledge, this represents the first report of natural TSAMV infection of any host other than tropical soda apple and suggests that TSAMV may be more widely distributed in solanaceous weeds than initially reported. References: (1) S. Adkins et al. Plant Dis. 91:287, 2007. (2) N. Coile. Fla. Dep. Agric. Consum. Serv. Div. Plant Ind. Bot. Circ. 27, 1993. (3) U.S. Dep. Agric., NRCS. The PLANTS Database. National Plant Data Center. Baton Rouge, LA. Published online, 2006.

Download Full-text

Occurrence of viruses on pepper plantations in the Czech Republic – Short communication

Horticultural Science ◽

10.17221/69/2011-hortsci ◽

2012 ◽

Vol 39 (No. 3) ◽

pp. 139-143 ◽

Cited By ~ 2

Author(s):

J. Svoboda ◽

L. Svobodová-Leišová

Keyword(s):

Czech Republic ◽

Mosaic Virus ◽

Short Communication ◽

Alfalfa Mosaic Virus ◽

Sources Of Resistance ◽

Pepper Mild Mottle Virus ◽

The Czech Republic ◽

Tomato Spotted Wilt ◽

Wilt Virus ◽

Broad Bean Wilt Virus

A survey of viruses on capsicum plants in the Czech Republic was carried out in the years 2006–2010. Altogether, 375 leaf samples with symptoms suggesting viral infection were collected both from open fields and greenhouses. These samples were examined for the presence of Alfalfa mosaic virus (AMV), Broad bean wilt virus-1 (BBWV-1), Cucumber mosaic virus (CMV), Pepper mild mottle virus (PMMoV), Potato virus Y (PVY), Tobacco mosaic virus (TMV) and Tomato spotted wilt virus (TSWV) by ELISA. Viruses detected in the samples were AMV, BBWV-1, CMV and PVY. The most prevalent were CMV and PVY which were present in 24 and 29% of tested samples, respectively. In some cases a complex infection of two viruses was detected. Gene sources of resistance against CMV and PVY are mentioned. The relation of virus occurrence on aphid incidence is discussed.

Download Full-text