scholarly journals Determination of dopamine receptor D2 gene rs1800497 polymorphism using real-time polymerase chain reaction

2019 ◽  
Vol 72 (3-4) ◽  
pp. 110-114
Author(s):  
Katarina Baculov ◽  
Natasa Vucinic ◽  
Jelena Stojcevic-Maletic ◽  
Iva Barjaktarovic
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Dopamine Receptor ◽  
Sensation Seeking ◽  
Deoxyribonucleic Acid ◽  
Receptor Expression ◽  
Chain Reaction ◽  
Single Nucleotide ◽  
Dopamine Receptor D2 ◽  
Polymerase Chain

Introduction. After analyzing a specific nucleotide sequence, located near the dopamine receptor D2 gene, rs1800497 polymorphism was detected, that affects dopamine D2 receptor expression, its density and affinity. This polymorphism is associated with many disorders such as: aggressive behavior, response to stress, sensation seeking, impulsivity, extraversion, anger, random memory, impaired cognitive function, brain glucose metabolism, obesity, pathologic gambling, substance addiction, depression, schizophrenia, that are related to modified gene expression, receptor density and affinity. Due to this association, a considerable interest in detecting a reliable dopamine receptor D2 gene allele was developed. The aim of this paper is optimization of real-time polymerase chain reaction in genotyping dopamine receptor D2 gene rs1800497 polymorphism. Material and Methods. Deoxyribonucleic acid was extracted from the blood of ten healthy individuals. Deoxyribonucleic acid samples were genotyped for dopamine receptor D2 gene rs1800497 (context sequence part containing targeted single nucleotide polymorphism CACAGCCATCCTCAAAGTGCTGGTC[A/G]AG?GCAGGCGCCCAGCTGGACGTCCA) by polymerase chain reaction. The TaqMan assays were used to determine single-nucleotide polymorphisms. The products of amplification were analyzed using Applied Biosystems 7500 fast real-time polymerase chain reaction instrument. Results. After a successful polymerase chain reaction, two alleles that differed in one nucleotide were detected in our samples. Conclusion. Even though it is financially more demanding, real-time polymerase chain reaction method is recommended for dopamine receptor D2 gene genotyping in routine diagnostics because it is simple, accurate, and fast.

scholarly journals Αξιολόγηση της κλινικής σημασίας της ανίχνευσης βακτηριακού DNA στο αίμα και στο ασκιτικό υγρό με τη χρήση πραγματικού χρόνου αλυσιδωτής αντίδρασης πολυμεράσης (Real time polymerase chain reaction -PCR) σε νοσηλευόμενους κιρρωτικούς ασθενείς με ισχυρή υποψία λοίμωξης

2021 ◽  
Author(s):  
Ηλιάνα Μάνη
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Deoxyribonucleic Acid ◽  
Meld Score ◽  
Chain Reaction ◽  
Polymerase Chain ◽  
Roche Diagnostics

Εισαγωγή: Η αυτόματη βακτηριακή περιτονίτιδα (ΑΒΠ) συνοδεύεται από υψηλή θνητότητα. Στόχος της παρούσας εργασίας ήταν η αξιολόγηση του βακτηριακού δεοξυριβονουκλεοτιδικού οξέος (bacterial deoxyribonucleic-acid, bactDNA) ως μέσου για την ακριβή ταυτοποίηση παθογόνων στην ΑΒΠ και επιπλέον η μελέτη της προγνωστικής του αξίας κατά τη διάρκεια και μετά από επεισόδιο ΑΒΠ. Μέθοδος: Στη μελέτη συμπεριελήφθησαν διαδοχικοί ασθενείς με ΑΒΠ (ομάδα ΑΒΠ) και ασθενείς με μη αντιρροπούμενη κίρρωση χωρίς ΑΒΠ (ομάδα ελέγχου). Κλασσικές καλλιεργητικές τεχνικές εφαρμόστηκαν για την απομόνωση και ταυτοποίηση παθογόνων από το αίμα και το ασκιτικό υγρό. Η μοριακή μέθοδος SeptiFast test (Roche-Diagnostics) εφαρμόστηκε για την ανίχνευση παθογόνων απευθείας στο ασκιτικό υγρό. Η θνητότητα μελετήθηκε στην ομάδα της ΑΒΠ. Αποτελέσματα: Πενήντα-πέντε ασθενείς [διάμεση ηλικία 60 (ενδοτεταρτημοριακό εύρος 53-74), 69.1% άνδρες, MELD score 18 (13-29)] με ΑΒΠ εντάχθηκαν προοπτικά. Οι καλλιέργειες του ασκιτικού υγρού ήταν θετικές στο 52.7% (17.2% ανθεκτικά παθογόνα) και το bactDNA στο 29.1% των ασθενών (συνδυασμένη ευαισθησία 58.2%). Η συμφωνία των 2 μεθόδων ήταν 84.6%. Τρεις ασθενείς με αρνητικές καλλιέργειες είχαν θετικό. Το bactDNA ήταν αρνητικό στο σύνολο των 36 ασθενών της ομάδας ελέγχου (100% ειδικότητα). Η μοριακή μέθοδος δεν παρείχε τη δυνατότητα ανίχνευσης ανθεκτικών στελεχών. Στην πολυπαραγοντική ανάλυση Cox για την επιβίωση στις 7 ημέρες, ως παράμετροι με ανεξάρτητη συσχέτιση με πτωχή πρόγνωση αναδείχθηκαν το MELD score (P=0.049) και η C-αντιδρώσα πρωτεΐνη (P=0.012). Μετά τον αποκλεισμό ασθενών που απεβίωσαν την πρώτη εβδομάδα μετά τη διάγνωση ΑΒΠ, ασθενείς με θετικό bactDNA στην εισαγωγή, είχαν δυσμενέστερη πρόγνωση σε σύγκριση με ασθενείς με αρνητικό (log rank P=0.005). Οι παράμετροι που συσχετίστηκαν ανεξάρτητα με τη θνητότητα 30-ημερών ήταν ο λόγος πολυμορφοπύρηνα / λεμφοκύτταρα αίματος (P=0.011) και το θετικό bactDNA (P=0.020). Συμπεράσματα: Τα αποτελέσματα δεν υποστηρίζουν την χρήση του bactDNA για την βελτίωση της ταυτοποίησης παθογόνων στην ΑΒΠ. Όμως, αποτελεί δείκτη θνητότητας 30 ημερών σε ασθενείς που επιβιώνουν του οξέος επεισοδίου.

DIAGNOSIS OF VENTRICULAR DRAINAGE-RELATED BACTERIAL MENINGITIS BY BROAD-RANGE REAL-TIME POLYMERASE CHAIN REACTION

Neurosurgery ◽  
2007 ◽  
Vol 61 (2) ◽  
pp. 306-312 ◽  
Author(s):  
Susanna Deutch ◽  
Daniel Dahlberg ◽  
Jesper Hedegaard ◽  
Michael B. Schmidt ◽  
Jens K. Møller ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Bacterial Meningitis ◽  
Real Time ◽  
Deoxyribonucleic Acid ◽  
Bacterial Load ◽  
Diagnostic Strategy ◽  
Ventricular Drainage ◽  
Chain Reaction ◽  
Gram Negative ◽  
Polymerase Chain

Abstract OBJECTIVE To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR-BM). METHODS We applied a PCR that targeted conserved regions of the 16S ribosomal ribonucleic acid gene to cerebrospinal fluid (CSF) samples from patients with external ventricular drainage or a ventriculoperitoneal shunt during the course of VR-BM. We compared the PCR results with CSF cultures. A total of 350 routine CSF samples were consecutively collected from 86 patients. The CSF deoxyribonucleic acid was automatically purified and subjected to PCR. Amplicons from the PCR samples that were positive for VR-BM were subsequently deoxyribonucleic acid sequenced for final identification. Clinical data were extracted from patient files. RESULTS Sixteen patients had at least one VR-BM-positive sample as diagnosed from culture or PCR. Nineteen episodes were diagnosed with signs of VR-BM (n = 16 patients) or were determined to be contaminated (n = 3 patients). Four episodes of VR-BM were diagnosed via PCR alone and were predominantly caused by gram-negative pathogens, five episodes were diagnosed via culture alone, and seven episodes were diagnosed via both culture and PCR. Five patients had mixed infections. Overall, 71 samples were positive for VR-BM as indicated by either one or both of the methods. Eighteen CSF samples were VR-BM positive as indicated by culture alone, and 21 CSF samples were positive as indicated via PCR alone. CONCLUSIONS Culture supplemented with broad-range, real-time PCR may increase the number of etiologically diagnosed VR-BM episodes, particularly when these are caused by gram-negative bacteria.

Sign in / Sign up

Export Citation Format

Share Document