scholarly journals Diversity and distribution of plant parasitic-nematodes on golf courses in localities of Baja California Sur, Mexico

2021 ◽  
Vol 38 (3) ◽  
pp. 652-661
Author(s):  
Omar Sánchez-Arce ◽  
Alejandro Palacios-Espinosa ◽  
José Carillo-Fasio ◽  
Luis Hernández-Montiel ◽  
José Hernández-Rubio ◽  
...  
Keyword(s):  
Baja California ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Tourist Attraction ◽  
Golf Courses ◽  
Baja California Sur ◽  
Plant Parasitic Nematodes ◽  
Funnel Technique ◽  
Plant Parasitic

Golf is a tourist attraction in Baja California Sur (BCS), Mexico. However, the quality of its fields is detracted by presenting yellowing and death on tufgrass. Plant parasitic nematodes are one of the main limitations around the world. However, in BCS, its presence is unknown. In order to determine the diversity and distribution of phytonmatodes in golf courses in BCS, soil samples were collected in four courses. Nematode extraction was done using the Baerman funnel technique. Specimens were identified at the genus level and the population in each zone was quantified. The genera Meloidogyne, Helicotylenchus, Criconema, Xiphinema, Pratylenchus, Tylenchus, Hoplolaimus and Trichodorus were associated with the death of tufgrass with significant variations (p<0.05) in populations. These results are the first records of these genera in the golf courses evaluated, useful in the development of in the State.

scholarly journals First Report of Plant-Parasitic Nematodes on Seashore Paspalum (Paspalum vaginatum) in Florida

Plant Disease ◽  
2004 ◽  
Vol 88 (6) ◽  
pp. 680-680 ◽  
Author(s):  
A. C. Hixson ◽  
W. T. Crow
Keyword(s):  
Sandy Soils ◽  
Coastal Areas ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Golf Courses ◽  
Plant Parasitic Nematodes ◽  
Seashore Paspalum ◽  
Paspalum Vaginatum ◽  
Home Lawns ◽  
Plant Parasitic

Seashore paspalum (Paspalum vaginatum Swartz) is a warm-season grass capable of growing in the saline environments present in coastal areas of Florida (2). A major limitation of cultivating turfgrasses in the sandy soils of Florida is the destruction of roots by plant-parasitic nematodes (3). A survey was performed to determine the plant-parasitic nematodes associated with seashore paspalum. Sampling locations ranged from Daytona Beach to Miami Beach on the eastern coast and from Tampa to Naples on the western coast. Soil samples were taken during the spring and summer months of 2002 and 2003 from different golf courses and home lawns. In 2002, soil samples were taken from five golf courses (37 samples) and seven home lawns (17 samples). In the next year, three golf courses (23 samples) and 13 home lawns (34 samples) were sampled. Nematodes were extracted from 100 cm3 soil samples using a modified centrifugal-sugar flotation technique (1). Ten genera of plant-parasitic nematodes were present from the samples obtained from golf courses. In addition, two more plant-parasitic nematode genera were present in samples from home lawns. The genera most frequently detected were Hoplolaimus, Mesocriconema, Hemicriconemoides, and Helicotylenchus, which were found at 100, 100, 88, and 88% of the golf courses surveyed and at 75, 95, 70, and 85% of the home lawns sampled, respectively. Genera Xiphinema, Pratylenchus, and Tylenchorhynchus, were found in less than 30% of the golf courses and less than 45% of the home lawns sampled. Genera Peltamigratus and Hemicycliophora were associated with a low percentage of the home lawns. A moderately high frequency of the genus Belonolaimus present in soil samples from golf courses (50%) and home lawns (40%) was consistent for other grasses grown in sandy soils associated with coastal areas in Florida (4). Populations of the genera Belonolaimus, Hoplolaimus, Helicotylenchus, Trichodorus, Hemicriconemoides, and Mesocriconema were above the action threshold levels for bermudagrass used by the University of Florida Nematode Assay Laboratory. Genera Hoplolaimus, Belonolaimus, and Trichodorus were associated with irregular-shaped yellowing and declining turfgrass areas sampled in this survey. Large populations of Helicotylenchus spp. (>500 nematodes per 100 cm3 of soil) were often found associated with seashore paspalum. To our knowledge, this is the first report of plant-parasitic nematodes associated with seashore paspalum in Florida. References: (1) W. R. Jenkins. Plant Dis. Rep. 48:692, 1964. (2) J. Morton. Proc. Fla. State Hortic. Soc. 86:482, 1973. (3) V. G. Perry and H. Rhoades. Pages 144–149 in: Nematology in the Southern Region of the United States. Southern Cooperative Series Bull. 276, University of Arkansas Agric. Pub., Fayetteville, 1982. (4) R. T. Robbins and K. R. Barker. J. Nematol. 6:1, 1974.

scholarly journals First Report of Trichodorus obtusus on Turfgrass in North Carolina, U.S.A.

Plant Disease ◽  
2015 ◽  
Vol 99 (2) ◽  
pp. 291-291 ◽  
Author(s):  
W. Ye ◽  
Y. Zeng ◽  
J. Kerns
Keyword(s):  
North Carolina ◽  
South Carolina ◽  
Sequence Data ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Body Width ◽  
Cervical Papilla ◽  
Stubby Root Nematode ◽  
Plant Parasitic

In May 2014, 11 sandy soil samples were collected at a depth of about 5 to 15 cm from a golf course community in Wilmington, NC, composed of Bermudagrass (Cynodon dactylon) from the fairway, St. Augustinegrass (Stenotaphrum secundatum) from the lawn, and Zoysiagrass (Zoysia japonica) from the tee, all of which showed spotted yellowing and necrosis. Plant-parasitic nematodes were extracted from soil samples by a combination of elutriation and sugar centrifugal-flotation methods at the North Carolina Department of Agriculture and Consumer Services, Nematode Assay Lab, Raleigh, NC. The results revealed the presence of several plant-parasitic nematodes, with a stubby-root nematode (Trichodoridae) present. Population densities of stubby-root nematodes were 10 to 90 (average 50) nematodes per 500 cm3 of soil. This species was clearly different from the parthenogenetic stubby-root nematode Nanidorus minor (Colbran, 1956) Siddiqi, 1974 commonly found in North Carolina because of the presence of males and larger body size. Morphological and molecular analyses of this nematode identified the species as Trichodorus obtusus Cobb, 1913. Morphological features of T. obtusus specimens were examined in glycerol permanent mounts. Males (n = 5) had a ventrally curved spicule, three ventromedian precloacal papillae (one ventromedian cervical papilla anterior to the excretory pore, one pair of lateral cervical pores at the level of the ventromedian cervical papilla), and a tail with a non-thickened terminal cuticle. Males were 860 to 1,120 (average 1,018) μm long, body width 38 to 48 (42) μm, onchiostyle 53 to 60 (56) μm, and spicule 54 to 62 (59) μm. Females (n = 5) had a pore-like vulva, a barrel-shaped vagina, and one or two postadvulvar lateral body pores on each side. Females were 990 to 1,330 (1,148) μm long, body width 43 to 56 (48) μm, onchiostyle 50 to 64 (58) μm, and V 49.0 to 57.5% (53.0%). The morphology agreed with the description of T. obtusus (2). DNA was prepared by squashing a single nematode (n = 3) on a microscope slide and collecting in 50 μl of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0). The 18S rDNA region was amplified with the forward primers 18S-G18S4 (5′ GCTTGTCTCAAAGATTAAGCC 3′), SSUF07 (AAAGATTAAGCCATGCATG), and 18S965 (GGCGATCAGATACCGCCCTAGTT) and reverse primers 18S-18P (TGATCCWKCYGCAGGTTCAC), SSUR26 (CATTCTTGGCAAATGCTTTCG), and 18S1573R (TACAAAGGGCAGGGACGTAAT). The 28S D2/D3 region was amplified with the forward primer 28S391a (AGCGGAGGAAAAGAAACTAA) and reverse primer 28S501 (TCGGAAGGAACCAGCTACTA) (4). The resulting 18S (1,547-bp) and 28S D2/D3 (925-bp) sequences were deposited in GenBank under the accession numbers KM276665 and KM276666. The 18S sequence data was 100% homologous with two populations of T. obtusus (JX279930, 898 bp, and JX289834, 897 bp) from South Carolina and one (AY146460, 634 bp) from an unknown source, each with a 1-bp difference in a Blastn search. The 28S D2/D3 sequence data was less than 90% homologous with many Trichodorus species, but no T. obtusus sequence data was available. T. obtusus is known to occur only in the United States and to damage turfgrasses. It is reported in the states of Virginia, Florida, South Carolina, Texas, Iowa, Kansas, Michigan, New York, and South Dakota. This nematode has been reported as a pathogen of bermudagrass in Florida (1) and South Carolina (3), but pathogenicity to St. Augustinegrass and Zoysiagrass is unknown. To our knowledge, this is the first report of T. obtusus on turfgrasses in North Carolina. References: (1) W. T. Crow and J. K. Welch. Nematropica 34:31, 2004. (2) W. Decraemer. The Family Trichodoridae: Stubby Root and Virus Vector Nematodes. Kluwer Academic Publishers, Dordrecht, The Netherlands, 1995. (3) J. B. Shaver et al. Plant Dis. 97:852, 2013. (4) G. R. Stirling et al. Nematology 15:401, 2013.

scholarly journals Surveying for Virus-vectoring Nematodes in Container-grown Blueberry Plants in Oregon

2016 ◽  
Vol 17 (3) ◽  
pp. 175-176 ◽  
Author(s):  
D. Sharma-Poudyal ◽  
C. Fraley ◽  
N. K. Osterbauer
Keyword(s):  
Soil Surface ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Plastic Sheet ◽  
Gravel Bed ◽  
Effective Barrier ◽  
Gravel Layer ◽  
Potting Media ◽  
Plant Parasitic

The goal of this study was to determine the risk of finding virus-vectoring nematodes in containerized blueberry plants placed on gravel. To detect dagger nematode, soil, and potting media samples were collected from blueberry nurseries growing plants in containers using soilless potting media, with the containers placed on a gravel bed or, for one nursery, on a plastic sheet placed on the soil surface. Potting media samples were collected from containers holding plants and soil samples were collected from beneath the gravel or plastic barrier. Nematodes were extracted from all of the samples using sucrose centrifugation. No dagger or other plant parasitic nematodes were detected in any of the samples tested. These results suggest no treatment of soilless potting media is necessary before planting blueberries into containers. Similarly, the gravel layer seems to be an effective barrier for suppressing dagger and other plant parasitic nematodes. Accepted for publication 25 July 2016. Published 8 August 2016.

The distribution of Tylenchulus semipenetrans and other parasitic nematodes associated with citrus in northern Victoria

1978 ◽  
Vol 18 (90) ◽  
pp. 148 ◽  
Author(s):  
RH Brown
Keyword(s):  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Tylenchulus Semipenetrans ◽  
Citrus Orchards ◽  
Citrus Nematode ◽  
Plant Parasitic

Citrus orchards in the Cobram district of northern Victoria were surveyed in 1976 for the presence of plant parasitic nematodes; in particular for the citrus nematode Tylenchulus semipenetrans. One hundred and forty-six soil samples were collected from 38 orchards. Nine genera were recorded, the most prevalant being Tylenchulus and Paratrichodorus (95 per cent and 37 per cent respectively, of all samples). T. semipenetrans was present in all orchards sampled. Population levels of T. semipenetrans larvae exceeded 1000 per 500 g of soil in 60 per cent of samples.

Two new species of Aphelenchoides (Nematoda: Aphelenchida: Aphelenchoidea: Aphelenchidae) from Manipur, India

Biologia ◽  
2012 ◽  
Vol 67 (3) ◽  
Author(s):  
Loukrakpam Bina Chanu ◽  
Naorem Mohilal ◽  
Mohammad Shah
Keyword(s):  
New Species ◽  
Soil Samples ◽  
Cephalic Region ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Lateral Field ◽  
Short Tail ◽  
Tamarind Seed ◽  
Two New Species ◽  
Plant Parasitic

AbstractAnalysis of the soil samples collected from around rhizospheric region of mulberry plants grown in Yurembam Rose Garden, Yurembam, Imphal West, Manipur yielded several soil and plant parasitic nematodes. Among them four species of Aphelenchoides were recorded. Upon detailed study, two species of Aphelenchoides were found to be new to science. Aphelenchoides dhanachandi sp. n. is characterized by ventrally curved body, clearly set off cephalic region and tail ending into a sharp pointed terminus, and stylet slender, 13.6–15.3 (14 ± 0.7) μm long with indistinct basal swellings and tamarind seed-shaped median bulb. Aphelenchoides neoechinocaudatus sp. n. is characterized by straight body with four incisures in the lateral field, flatten cephalic region, slender stylet with indistinct basal swellings, 11.9 μm long, elongated pear-shaped median bulb and short tail with pointed mucro. The two species are illustrated here.

scholarly journals Research Note. New data on plant parasitic nematode Longidorus distinctus Lamberti, Choleva & Agostinelli, 1983 (Nematoda: Longidoridae) from Poland

2017 ◽  
Vol 54 (2) ◽  
pp. 179-182
Author(s):  
F. W. Kornobis ◽  
U. Sobczyńska
Keyword(s):  
Parasitic Nematode ◽  
Sequence Data ◽  
Soil Samples ◽  
Research Note ◽  
Parasitic Nematodes ◽  
Distribution Map ◽  
Plant Parasitic Nematodes ◽  
Its1 Sequence ◽  
The Family ◽  
Plant Parasitic

SummaryDuring a survey on the occurrence of the plant parasitic nematodes of the family Longidoridae in Poland, 925 soil samples were taken. Longidorus distinctus was present in 10 (1.08 %) of these samples. In this Research Note we provide: 1) distribution map of these populations, 2) morphometric data, 3) sequence data for D2-D3 28S rDNA and (partial)18S-ITS1 -5.8S(partial) markers and 4) LdistFOR primer (5′-GGCTGTAAAGATATATGCGT-3’) effective in obtaining ITS1 sequence for the species. Morphometric similarities and dissimilarities with data on other published populations are discussed.

NEMATODES IN TOBACCO IN THE MARITIME PROVINCES OF CANADA

1976 ◽  
Vol 56 (2) ◽  
pp. 357-364 ◽  
Author(s):  
J. KIMPINSKI ◽  
K. E. LELACHEUR ◽  
L. S. THOMPSON ◽  
C. B. WILLIS ◽  
C. F. MARKS
Keyword(s):  
New Brunswick ◽  
Prince Edward Island ◽  
Parasitic Nematodes ◽  
Meloidogyne Hapla ◽  
Plant Parasitic Nematodes ◽  
Maritime Provinces ◽  
Nicotiana Tabacum L ◽  
Tobacco Roots ◽  
Plant Parasitic

Soil and root samples were collected from tobacco (Nicotiana tabacum L.) fields in Prince Edward Island, Nova Scotia, and New Brunswick in 1970 and 1972, and also from P.E.I, in 1971 and 1974. Twenty genera of plant and soil nematodes were recovered. The dominant plant-parasitic species were Pratylenchus crenatus Loof, 1960 and P. penetrans (Cobb, 1917) Filipjev and Stek., 1941. These two species were often found in the same sample and were most numerous in P.E.I., though their numbers were lower than had been recorded previously in forage and vegetable surveys. Meloidogyne hapla Chitwood, 1949 was recovered in low numbers from some of the samples. Nematicide treatments usually reduced the number of Pratylenchus spp., but there were no significant increases in yield or quality of tobacco. Laboratory and greenhouse experiments indicated that M. hapla did not invade or reproduce in tobacco roots as quickly as did P. penetrans. Neither species influenced plant growth significantly. It was concluded that plant-parasitic nematodes are riot a major problem in tobacco in the Maritime provinces.

Molecular biodiversity assessment of plant-parasitic nematodes in Dokdo Island, Korea

Nematology ◽  
2019 ◽  
Vol 21 (3) ◽  
pp. 275-292 ◽  
Author(s):  
Dongwoo Kim ◽  
Hwal-Su Hwang ◽  
Jae-Kyoung Shim ◽  
JiYoung Yang ◽  
Jae Hong Pak ◽  
...  
Keyword(s):  
Parasitic Nematode ◽  
Rhizosphere Soil ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Biodiversity Assessment ◽  
Plant Parasitic Nematodes ◽  
Species Diagnosis ◽  
Molecular Biodiversity ◽  
Natural Monument ◽  
Plant Parasitic

Summary Dokdo Island has a unique biodiversity that has been preserved as a natural monument. Although the biodiversity of Dokdo has been investigated, little information is available regarding the nematodes. The diversity of plant-parasitic nematodes was investigated using both ITS and D2-D3 sequences. Nematodes extracted from 59 rhizosphere soil samples were morphologically identified as belonging to eight genera: Geocenamus, Helicotylenchus, Rotylenchulus, Heterodera, Paratylenchus, Pratylenchus, Pratylenchoides and Xiphinema. Further, nucleotide sequences were determined from 85 individuals of different genera for species diagnosis. We identified 13 species, including three species of the genus Pratylenchus (P. crenatus, P. kumamotoensis and P. neglectus), Helicotylenchus sp. 1, Rotylenchulus sp. 1, Paratylenchus nanus, Heterodera trifolii, Heterodera spp., Pratylenchoides ritteri, Geocenamus sp. 1, Geocenamus sp. 2, Xiphinema brevicollum and Xiphinema sp. 1. The dominant plant-parasitic nematode on Dokdo was P. crenatus, which was found in 25.4% of the samples. Our study provides important information about the biodiversity of plant-parasitic nematodes on Dokdo Island.

scholarly journals Plant-Parasitic Nematodes Are Potential Pathogens of Miscanthus × giganteus and Panicum virgatum Used for Biofuels

Plant Disease ◽  
2011 ◽  
Vol 95 (4) ◽  
pp. 413-418 ◽  
Author(s):  
Tesfamariam Mekete ◽  
Kimberly Reynolds ◽  
Horacio D. Lopez-Nicora ◽  
Michael E. Gray ◽  
Terry L. Niblack
Keyword(s):  
Panicum Virgatum ◽  
Damage Threshold ◽  
Threshold Value ◽  
Nematode Species ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Population Densities ◽  
Miscanthus Giganteus ◽  
Plant Parasitic

A survey of Miscanthus × giganteus and switchgrass plots throughout the midwestern and southeastern United States was conducted to determine the occurrence and distribution of plant-parasitic nematodes associated with these biofuel crops. During 2008, rhizosphere soil samples were collected from 24 Miscanthus × giganteus and 38 switchgrass plots in South Dakota, Iowa, and Illinois. Additional samples were collected from 11 Miscanthus × giganteus and 10 switchgrass plots in Illinois, Kentucky, Georgia, and Tennessee the following year. The 11 dominant genera recovered from the samples were Pratylenchus, Helicotylenchus, Xiphinema, Longidorus, Heterodera, Hoplolaimus, Tylenchorhynchus, Criconemella, Paratrichodorus, Hemicriconemoides, and Paratylenchus. Populations of Helicotylenchus, Xiphinema, and Pratylenchus were common and recorded in 90.5, 83.8, and 91.9% of the soil samples from Miscanthus × giganteus, respectively, and in 91.6, 75, and 83.3% of the soil samples from switchgrass, respectively. Prominence value (PV) (PV = population density × √frequency of occurrence/10) was calculated for the nematodes identified. Helicotylenchus had the highest PV (PV = 384) and was followed by Xiphinema (PV = 152) and Pratylenchus (PV = 72). Several of the nematode species associated with the two biofuels crops were plant parasites. Of these, Pratylenchus penetrans, P. scribneri, P. crenatus, Helicotylenchus pseudorobustus, Hoplolaimus galeatus, X. americanum, and X. rivesi are potentially the most damaging pests to Miscanthus × giganteus and switchgrass. Due to a lack of information, the damaging population thresholds of plant-parasitic nematodes to Miscanthus × giganteus and switchgrass are currently unknown. However, damage threshold value ranges have been reported for other monocotyledon hosts. If these damage threshold value ranges are any indication of the population densities required to impact Miscanthus × giganteus and switchgrass, then every state surveyed has potential for yield losses due to plant-parasitic nematodes. Specifically, Helicotylenchus, Xiphinema, Pratylenchus, Hoplolaimus, Tylenchorhynchus, Criconemella, and Longidorus spp. were all found to have population densities within or above the threshold value ranges reported for other monocotyledon hosts.

Sign in / Sign up

Export Citation Format

Share Document