Biology, Management, and Conservation of Lampreys in North America

2009 ◽  
Keyword(s):  
North America ◽  
Food Resource ◽  
Assimilation Efficiency ◽  
Sampling Period ◽  
Dry Mass ◽  
High Rate ◽  
Diel Periodicity ◽  
Organic Detritus ◽  
Gut Fullness ◽  
Management And Conservation

<em>Abstract</em>.—Larval lampreys are burrowing suspension feeders in streams that efficiently use organic detritus as their primary nutrient source. Although larval lampreys often exhibit daily patterns in activity (being most active at night), diel variations in food habits and feeding behavior have not been investigated. The objective of this study was to determine whether larval northern brook lampreys <em>Ichthyomyzon fossor</em> exhibit diel periodicity in diet composition, assimilation efficiency, or gut fullness. Larvae were collected at 4-h intervals over a 24-h period from the Pike and Pilgrim rivers, Michigan. Organic detritus composed most of the diet ash-free-dry-mass (AFDM) for each sampling period, and averaged 94.7% and 97.4% for the Pike and Pilgrim rivers, respectively. Assimilation efficiency of AFDM averaged 61.3% (range, 55.7–68.9%) for the Pike River and 87.5% (range, 80.8–94.3%) for the Pilgrim River. Gut fullness in the Pike and Pilgrim rivers was low, averaging 0.23 (range, 0.18–0.30) and 0.20 (0.14–0.25) mg diet AFDM per grams larvae, respectively. Although gut fullness did vary slightly on a diel basis, larval northern brook lampreys feed continuously but slowly in order to achieve a high rate of assimilation from a low-quality food resource.

Significance of Organic Detritus in the Diet of Larval Lampreys in the Great Lakes Basin

1994 ◽  
Vol 51 (11) ◽  
pp. 2380-2387 ◽  
Author(s):  
Trent M. Sutton ◽  
Stephen H. Bowen
Keyword(s):  
Great Lakes ◽  
Feeding Rate ◽  
Assimilation Efficiency ◽  
Dry Mass ◽  
Great Lakes Basin ◽  
Organic Detritus ◽  
Upper Peninsula ◽  
Sea Lampreys ◽  
Gut Fullness ◽  
Upper Peninsula Of Michigan

Larval sea lamprey (Petromyzon marinus) and northern brook lamprey (Ichthyomyzon fossor) were collected monthly from three streams in the Upper Peninsula of Michigan from May 1992 through May 1993 and larval sea lampreys were collected during summer months from sites throughout the Great Lakes basin. Organic detritus made up most of the diet ash-free-dry-mass (AFDM) throughout the year, averaging 97.79%, with algae (2.12%) and bacteria (0.09%) making up the remainder of the diet AFDM. Assimilation efficiency for AFDM averaged 72% during warmer months and 53% during cooler months (annual mean = 61%). Gut fullness (amount of AFDM in the anterior one-tenth of the intestine) was low (mean = 0.10 mg diet AFDM∙g−1 ammocoete). There were no significant differences in these measures between ammocoetes collected from the Upper Peninsula and those collected throughout the Great Lakes basin. From a laboratory-determined relationship between gut fullness and feeding rate, feeding rate in the field was estimated to be extremely slow, ranging from 4.2 to 5.5 mg diet AFDM∙g−1 ammocoete∙d−1. These observations indicate that larval lampreys efficiently utilize a diet of organic detritus during warmer months when stream temperatures and food quality are more favorable for feeding, digestion, and growth.

scholarly journals First Report of Southern tomato virus on Tomatoes in Southwest France

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1124-1124 ◽  
Author(s):  
T. Candresse ◽  
A. Marais ◽  
C. Faure
Keyword(s):  
North America ◽  
Seed Transmission ◽  
The United States ◽  
High Rate ◽  
Reference Sequence ◽  
Tomato Mosaic Virus ◽  
Potential Contribution ◽  
First Report ◽  
Tomato Sample ◽  
Potential Pathogenicity

Southern tomato virus (STV) is a recently described virus of tomato reported to be associated with a new disorder in this crop, the tomato yellow stunt disease (2). However, its detection in asymptomatic seedlings of some tomato varieties raises doubts about its pathogenicity (2). STV has a small 3.5-kb dsRNA genome with properties that place it in an intermediate position between the Totiviridae and Partitiviridae families. STV also has an unusual biology because, while being seed-transmitted at a high rate, it is neither mechanically nor graft-transmitted (2). It has so far only been reported from North America (Mississipi and California in the United States, as well as Mexico) (2). Agents with similar genomic organizations but apparently not associated with specific disease symptoms have recently been reported from faba bean, rhododendrons, and blueberry and proposed to represent a novel family of dsRNA viruses tentatively named Amalgamaviridae (1). In the course of plant virus metagenomics experiments, double stranded RNAs extracted from tomato samples from Southwest France collected in 2011 (variety unknown) were analyzed by 454 pyrosequencing. BLAST analysis of the contigs assembled from individual sequencing reads revealed a ca. 2.2 kb long contig with very high (99.7%) identity with the STV reference sequence deposited in GenBank (NC_011591). In order to confirm the presence of STV, an STV-specific primer pair (STV-fw 5′ CTGGAGATGAAGTGCTCGAAGA 3′ and STV-rev 5′ TGGCTCGTCTCGCATCCTTCG 3′) was designed and used to amplify by RT-PCR an 894-bp fragment from the relevant tomato sample. A PCR product of the expected size was obtained and the identity of the amplified agent verified by sequencing of the amplicon. The sequence obtained was identical to contig obtained through pyrosequencing of purified dsRNAs and has been deposited in GenBank (KC333078). This is, to our knowledge, the first report of STV infecting tomato crops outside of North America. The tomato sample from France from which STV was recovered showed distinct viral infection symptoms (e.g., mosaics, leaf deformation), that are clearly different from the symptoms reported for the tomato yellow stunt disease (2). However, the plants were found to be also infected with Tomato mosaic virus and Potato virus Y, so that it is not possible to draw firm conclusions about a potential contribution of STV to the symptoms observed. The high rate of STV seed transmission and its reported presence in commercial seed lots of several varieties (2) suggest that its distribution could be much broader than is currently known and further efforts are clearly needed to provide a final and conclusive answer as to the potential pathogenicity of this agent to tomato crops. References: (1) R. R. Martin et al. Virus Res. 155:175, 2011. (2) S. Sabanadzovic et al. Virus Res. 140:130, 2009.

Some aspects of pollution in Southampton Water

1972 ◽  
Vol 180 (1061) ◽  
pp. 451-468 ◽  
Keyword(s):  
Organic Matter ◽  
Total Mercury ◽  
Mercenaria Mercenaria ◽  
Dry Mass ◽  
High Rate ◽  
Organic Substrates ◽  
Southampton Water ◽  
Thermal Changes ◽  
Particulate Iron ◽  
Phosphate Nitrate

The levels of some trace metals have been studied in Southampton Water. Particulate iron, though variable, is generally high and the concentration appears to be correlated with the amount of particulate matter. Zinc is approximately doubled in concentration inside Southampton Water, but much higher levels are occasionally encountered. Copper and nickel are only somewhat higher and total mercury is lower inside Southampton Water than in Solent waters. Zinc and copper are concentrated approximately 30000 times on a dry mass basis by Mercenaria mercenaria . Mercury is concentrated by Mercenaria and other bivalves; the mud which is especially rich in total mercury may represent an important source of mercury for these animals. Primary nutrients, phosphate, nitrate and ammonium, increase in concentration from seaward on proceeding up the estuεry. Surface waters appear to be especially rich in nitrate and ammonium. Gross pollution seems unlikely in view of low nitrite concentration and high oxygen values virtually throughout the estuary. The high rate of turnover of organic substrates by heterotrophic organisms may be associated with relatively large amounts of organic matter in Southampton Water. This has to some extent been confirmed by direct surveys of particulate and dissolved organic carbon which also suggest that regional differences exist. Higher levels of organic matter occur near the head of the estuary, near Marchwood, the Docks, and the mouth of the River Itchen. Although thermal changes in Southampton Water appear to have been slight, some increase in winter minimal temperatures and in summer maxima have occurred, especially in the Marchwood area. No evidence exists of deleterious effects on marine organisms. Phytoplankton can apparently endure rises of at least 10°C for short periods without injurious effects. The density of zooplankton has not decreased; possibly certain species (e. g. Elminius modestus ) have been favoured by thermal changes. A marked increase in Mercenaria mercenaria population may be associated with the small thermal rise and remarkably high population densities are encountered. Spawning appears to be correlated with summer temperatures exceeding 18 to 19°C.

Nocturnally constrained foraging of a lotic minnow (Rhinichthys cataractae)

1989 ◽  
Vol 67 (8) ◽  
pp. 2008-2012 ◽  
Author(s):  
Joseph M. Culp
Keyword(s):  
Seasonal Changes ◽  
Prey Availability ◽  
Diel Periodicity ◽  
Foraging Activity ◽  
Light Levels ◽  
Prey Composition ◽  
Rhinichthys Cataractae ◽  
Nocturnal Foraging ◽  
Gut Fullness ◽  
Foraging Pattern

Diel periodicity in foraging activity of the longnose dace (Rhinichthys cataractae) was determined by measuring dace activity over the stream bed, gut fullness, and the digestive state of prey items. Although most species of minnows are either diurnally or crepuscularly active, dace began foraging within 1 h after sunset with light levels near 10 lx and ceased before sunrise throughout the ice-free period. During the day few prey were taken as the dace remained under the shelter of stones. This nocturnal foraging pattern did not appear to be affected by spawning or seasonal changes in prey composition. Nocturnal foraging in dace is not likely a response to prey availability, but may be a response to avoid diel periods when salmonid competitors or visual predators are active.

Discrimination among potential buloke (Allocasuarina leuhmannii) feeding trees by the endangered south-eastern red-tailed black-cockatoo (Calyptorhynchus banksii graptogyne)

2004 ◽  
Vol 31 (3) ◽  
pp. 311 ◽  
Author(s):  
Martine Maron ◽  
Alan Lill
Keyword(s):  
Food Resource ◽  
Model Performance ◽  
Dry Mass ◽  
Foraging Efficiency ◽  
Tree Diameter ◽  
Breast Height ◽  
South Eastern ◽  
Second Year ◽  
Individual Trees ◽  
Number Of Seeds

Remnant buloke (Allocasuarina luehmannii) woodland and scattered buloke trees appear to provide an important seasonal food resource for the endangered south-eastern red-tailed black-cockatoo (Calyptorhynchus banksii graptogyne). The factors that differed between buloke trees in which the cockatoos fed and those in which they did not feed were investigated in two consecutive years (Season 1 and Season 2). Tree diameter at breast height (DBH), individual mean seed dry mass, individual mean cone dry mass, mean number of seeds per cone, and proportion of total cone mass comprising seeds (seed ratio) were all significantly greater in feeding than non-feeding trees in both Season 1 and Season 2. A predictive model incorporating these five variables correctly classified 83% of trees measured in Season 1 as either feeding or non-feeding trees. Validation of predictive models with new data is essential in evaluating model performance, so the model was used to classify the feeding and non-feeding trees from which the variables were recorded during Season 2. The model, although derived only from the data collected during Season 1, was equally as effective in predicting the feeding status of trees in Season 2, despite the fact that the trees in which the cockatoos fed during the second year were not the same individual trees as those used in the previous year. The differences between feeding and non-feeding trees suggested that cockatoos choose to feed in trees in which they are able to optimise their foraging efficiency. As individual buloke trees appear to vary in their suitability for cockatoo foraging from year to year, it is not possible to exclude any buloke within the range of the cockatoo as a potential future food resource for this endangered bird.

Factors influencing temporal variation of a Sargassum filipendula (Phaeophyta: Fucales) bed in a subtropical shore

2009 ◽  
Vol 89 (2) ◽  
pp. 315-321 ◽  
Author(s):  
G.B. Jacobucci ◽  
M.O. Tanaka ◽  
F.P.P. Leite
Keyword(s):  
Temporal Variation ◽  
Abiotic Factors ◽  
Sampling Period ◽  
Dry Mass ◽  
Hypnea Musciformis ◽  
Temporal Fluctuations ◽  
Eastern Brazil ◽  
Sargassum Filipendula ◽  
Noticeable Reduction ◽  
Abiotic And Biotic Factors

In the present study, we evaluate the influence of biotic and abiotic factors on temporal fluctuations of Sargassum filipendula in a subtropical shore. Monthly algal samples, abiotic components, amphipod grazer density, and epiphyte biomass were obtained from a Sargassum bed in south-eastern Brazil. Density of S. filipendula fronds decreased during the sampling period, whereas dry mass was more constant, although with a noticeable reduction in the warmer months. Hypnea musciformis was the most frequent epiphyte on S. filipendula, occurring in all sampling periods, although with significant temporal variation. Sargassum filipendula density and dry mass were both influenced by epiphyte dry mass, temperature, and amphipod grazers. Sargassum filipendula biomass negatively influenced total epiphyte biomass, whereas H. musciformis biomass was positively influenced by phosphate, nitrite, and S. filipendula density and negatively influenced by S. filipendula dry mass and amphipod grazer abundance. Algal temporal fluctuations can be related to local abiotic and biotic factors, but the variation observed for S. filipendula and its epiphytes suggest that these factors have quite distinct effects for these algae.

Sign in / Sign up

Export Citation Format

Share Document