Disrupt the bacterial growth in the insect vector to block the transmission of Candidatus Liberibacter asiaticus to citrus, the causal agent of citrus greening disease

During July 2002, surveys of mandarin orchards were conducted in Punakha Valley and Wangdue districts of Bhutan. Symptoms of the greening disease were observed in most of the orchard. The incidence of disease was recorded up to 30% in 24 private orchards with more than 5,000 trees total. Affected trees were generally stunted with leaves showing symptoms of mottling. Sometimes, symptoms were seen only on one part of the canopy. The greening disease is caused by a fastidious phloem restricted bacterium, “Candidatus Liberibacter asiaticus” in Asian countries and “Candidatus Liberibacter africanus” in African countries. To confirm the presence of this bacterium causing greening disease in Bhutan, 33 leaf samples were collected from seven locations in Bhutan and stored at -80°C. Petioles and midribs were used for extraction of DNA using DNeasy Plant Mini Kit (Qiagen Gmbh, Hilden, Germany). Polymerase chain reaction (PCR) was initially performed with a sample from Rimchu, Bhutan using primer pair 5′TATAAAGGTTGACCTTTCGAGTTT/5′ACAAAAGCAGAAATAGCACGAACAA previously designed for amplification of ribosomal protein genes of β-operon of two liberibacter species (1). An amplicon of approximately 700 bp was obtained. The size of the PCR product is similar to that amplified from “Candidatus Liberibacter asiaticus”. The amplicon was cloned in pGEM-T easy vector and sequenced. The clone was 703 nt long and showed 100% sequence homology with the corresponding sequence of “Candidatus Liberibacter asiaticus” confirming that “Candidatus Liberibacter asiaticus” is the cause of greening disease in Bhutan. Later, one sample from each location was analyzed and found to be positive to greening. To our knowledge, this is the first report of this bacterium and greening disease in Bhutan, and citrus greening appears to be the main cause of declining citrus in the Punakha Region of Bhutan. Reference: (1) A. Jocquellet et al. Page 363 in: Proc. Conf. Int. Organ. Citrus Virol. 14th. IOCV, Riverside, CA, 2000.

Download Full-text

Production of monoclonal antibody against Ompa protein of Candidatus Liberibacter asiaticus causing citrus greening disease

Vietnam Journal of Biotechnology ◽

10.15625/1811-4989/18/3/14634 ◽

2020 ◽

Vol 18 (3) ◽

pp. 529-541

Author(s):

Ho Thi Thuong ◽

Nguyen Thi Thom ◽

Nguyen Thi Tra ◽

Trinh Thai Vy ◽

Pham Bich Ngoc ◽

...

Keyword(s):

Strong Interaction ◽

Research Direction ◽

Citrus Greening ◽

Candidatus Liberibacter Asiaticus ◽

Citrus Greening Disease ◽

Candidatus Liberibacter ◽

Liberibacter Asiaticus ◽

Ompa Protein ◽

Greening Disease ◽

Vhh Antibodies

Citrus Greening, also known as HuangLongbing (HLB), is considered one of the most dangerous citrus diseases, and limiting the production of citrus trees all over the world. Production of antibodies against Ompa protein of Candidatus Liberibacter asiaticus (CLas) for detection of citrus greening disease is considered as promising research direction. In this study, for the purpose of producting antibodies against Ompa of CLas, we firstly used the camel VHH antibody library for screening VHH antibodies against Ompa using phage-display technique. Next, phages which had strong interaction with Ompa as shown in ELISA were selected for phagemid isolation and the DNA fragments encoding VHH antibodies were sequenced. The DNA fragment encoding the best VHH antibody was then selected and inserted into the expression vector pET-21a (+), then cloned in Ecoli DH5α strain and expressed in BL21 (DE3) strain. The expression of VHH antibodies against Ompa was optimized at different temperatures with an inductive concentration of 0.1 M IPTG. Anti-Ompa VHH antibodies were purified under denatured conditions then re-folded. The biological activity of the VHH antibody with Ompa antigen was assessed by indirect-ELISA reaction. Results indicated that the VHH antibody had a very strong interaction with the Ompa antigen. This opens up the prospect of applying VHH antibody in the detection of citrus greening disease.

Download Full-text

Understanding Citrus Greening Disease and Its Possible Management Strategies in Nepal

International Journal of Applied Sciences and Biotechnology ◽

10.3126/ijasbt.v9i4.40805 ◽

2021 ◽

Vol 9 (4) ◽

pp. 227-234

Author(s):

Sameer Pokhrel ◽

Swikriti Pandey ◽

Ashish Ghimire ◽

Savyata Kandel

Keyword(s):

Management Strategies ◽

Citrus Greening ◽

Insect Vector ◽

Candidatus Liberibacter Asiaticus ◽

Citrus Greening Disease ◽

The World ◽

Citrus Production ◽

Candidatus Liberibacter ◽

Liberibacter Asiaticus ◽

Citrus Orchards

Huanglongbing (HLB), also known as citrus greening, is a devastating disease of citrus that has decimated several citrus orchards throughout the world. The disease is associated with three species of unculturable and phloem-limited bacteriae, Candidatus Liberibacter asiaticus, Candidatus Liberibacter africanus and Candidatus Liberibacter americanus. The most common species of bacteria found in Nepal is Candidatus Liberibacter asiaticus which is transmitted by an insect vector, Asian citrus psyllid (Diaphorina citri). This disease has been detected in several economically important citrus production areas of Nepal, which resulted in heavy yield loss. No cure for the disease has been discovered yet and it is essential to practice proper management strategies to maintain citrus health and sustain citrus production under HLB pressure. Several disease management approaches such as pathogen-free nursery establishment, use of disease tolerant rootstock cultivars, proper irrigation and nutrient supply, removal of HLB affected trees, and control of psyllid with frequent insecticide application are widely practiced throughout the world. This review article highlights the characteristics of the citrus greening disease and its insect vector and gives insights into their management techniques. Several technologically advanced options available to minimize the HLB infection might not be feasible currently in Nepal due to economic and topographic constraints. This article also aims to bring into focus the cost-effective methods that growers in Nepal can practice to mitigate the impact of HLB disease in their citrus orchards. Int. J. Appl. Sci. Biotechnol. Vol 9(4): 227-238.

Download Full-text

Huanglongbing, Caused by ‘Candidatus Liberibacter asiaticus,’ Detected in New Locations Across Southern and Coastal Georgia

Plant Health Progress ◽

10.1094/php-09-19-0064-s ◽

2020 ◽

Vol 21 (1) ◽

pp. 31-35

Author(s):

Jonathan E. Oliver ◽

Md Emran Ali ◽

Sumyya Waliullah ◽

Jake Price ◽

Jessica Warren ◽

...

Keyword(s):

Citrus Greening ◽

Molecular Testing ◽

Citrus Tree ◽

Candidatus Liberibacter Asiaticus ◽

Citrus Greening Disease ◽

New Locations ◽

Candidatus Liberibacter ◽

Liberibacter Asiaticus ◽

Greening Disease ◽

Southern Georgia

Huanglongbing (HLB) or citrus greening disease is the most devastating disease of citrus worldwide. This disease, caused by the bacterium ‘Candidatus Liberibacter asiaticus’ (CLas), leads to low fruit quality and unproductive trees. In 2008, HLB was found in a residential citrus tree in Savannah, Georgia, and, as a result, the state has been quarantined for this disease since 2009. Nonetheless, little is known about the distribution of CLas within Georgia, even though the commercial planting of citrus in Georgia has increased exponentially in recent years. In 2019, 94 samples from commercial and residential citrus trees within 11 counties in coastal and southern Georgia were collected and tested for the presence of CLas. Molecular testing results revealed the presence of CLas in three counties where HLB had not been previously reported and in 9% of samples overall. This is the first definitive report confirming HLB in southern Georgia counties besides those along the coast.

Download Full-text