scholarly journals Characteristics of rose mosaic diseases

2013 ◽  
Vol 57 (1-2) ◽  
pp. 79-89
Author(s):  
Marek S. Szyndel
Keyword(s):  
Mosaic Virus ◽  
Mosaic Disease ◽  
Ringspot Virus ◽  
Yellow Vein ◽  
Line Pattern ◽  
Arabis Mosaic Virus ◽  
Tobacco Ringspot Virus ◽  
Tomato Ringspot Virus ◽  
Prunus Necrotic Ringspot Virus ◽  
Methods Of Control

Presented review of rose diseases, associated with the mosaic symptoms, includes common and yellow rose mosaic, rose ring pattern, rose X disease, rose line pattern, yellow vein mosaic and rose mottle mosaic disease. Based on symptomatology and graft transmissibility of causing agent many of those rose disorders are called "virus-like diseases" since the pathogen has never been identified. However, several viruses were detected and identified in roses expressing mosaic symptoms. Currently the most prevalent rose viruses are <i>Prunus necrotic ringspot virus</i> - PNRSV, <i>Apple mosaic virus</i> - ApMV (syn. <i>Rose mosaic virus</i>) and <i>Arabis mosaic virus</i> - ArMV Symptoms and damages caused by these viruses are described. <i>Tomato ringspot virus, Tobacco ringspot virus</i> and <i>Rose mottle mosaic virus</i> are also mentioned as rose pa thogcns. Methods of control of rose mosaic diseases are discussed.

scholarly journals Xiphinema rivesi from Slovania Transmit Tobacco ringspot virus and Tomato ringspot virus to Cucumber Bait Plants

Plant Disease ◽  
2007 ◽  
Vol 91 (6) ◽  
pp. 770-770 ◽  
Author(s):  
S. Širca ◽  
B. Geric Stare ◽  
I. Mavrič Pleško ◽  
M. Viršček Marn ◽  
G. Urek ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Plant Protection ◽  
Ringspot Virus ◽  
Feeding Period ◽  
Arabis Mosaic Virus ◽  
Tobacco Ringspot Virus ◽  
Tomato Ringspot Virus ◽  
Bait Plants ◽  
Systemic Symptoms ◽  
Das Elisa

The dagger nematode, Xiphinema rivesi Dalmasso, a member of the X. americanum group, was detected in 2002 for the first time in Slovenia and for the fourth time in Europe (4). X. rivesi is a vector of at least four North American nepoviruses including Cherry rasp leaf virus (CRLV), Tobacco ringspot virus (TRSV), Tomato ringspot virus (ToRSV), and Peach rosette mosaic virus (PRMV) (1,2). All of these viruses are included on the EPPO and EU lists of quarantine organisms, but none of the Xiphinema species found in Europe have been reported to transmit these nepoviruses. Three virus isolates, including TRSV (from Lobelia spp.; virus collection of the Plant Protection Service, Wageningen, The Netherlands), ToRSV (grapevine isolate PV-0381; DSMZ, Braunschweig, Germany), and Arabis mosaic virus (ArMV) (from Vinca spp.; virus collection of the Plant Protection Service), were used in transmission tests with a population of X. rivesi found in Slovenia. X. rivesi is not known to transmit ArMV and this virus was included as a check. The nematodes were extracted from peach orchard soil collected near the village of Dornberk, and transmission tests fulfilled the set of criteria proposed by Trudgill et al. (3). Cucumis sativus cv. Eva, grown in a growth chamber at 25°C, was used as acquisition hosts and transmission bait plants. The acquisition hosts were mechanically inoculated and showing systemic symptoms before the introduction of nematodes. Noninoculated acquisition plants were included as controls. After a 10-day acquisition feeding period, the nematodes were transferred to healthy bait plants and allowed a 14-day inoculation feeding period. X. rivesi transmitted TRSV and ToRSV but not ArMV. TRSV and ToRSV bait plants developed systemic symptoms 4 to 6 weeks after the nematodes were transferred. Transmission of TRSV and ToRSV was confirmed by testing leaf and root sap of bait plants in a double antibody sandwich (DAS)-ELISA. High virus concentrations were detected in the roots and leaves of TRSV and ToRSV symptomatic plants. DAS-ELISA on bait plants from nematodes that had been allowed to feed on ArMV-infected or the virus-free control acquisition plants gave negative results. No symptoms appeared on bait plants used for ArMV transmission or the control bait plants. To our knowledge, this is the first report of transmission of TRSV and ToRSV with a Xiphinema population from Europe. References: (1) D. J. F. Brown et al. Phytopathology 84:646, 1994. (2) L.W. Stobbs et al. Plant Dis. 80:105, 1996. (3) D. L. Trudgill et al. Rev. Nematol. 6:133, 1983. (4) G. Urek et al. Plant Dis. 87:100, 2002.

scholarly journals First Report of Tomato ringspot virus in Butterfly Bush (Buddleia davidii)

Plant Disease ◽  
2003 ◽  
Vol 87 (1) ◽  
pp. 102-102 ◽  
Author(s):  
P. L. Hughes ◽  
S. W. Scott
Keyword(s):  
United States ◽  
Mosaic Virus ◽  
Southeastern United States ◽  
Positive Control ◽  
Ringspot Virus ◽  
Home Garden ◽  
Line Pattern ◽  
Rt Pcr ◽  
First Report ◽  
Tomato Ringspot Virus

Leaves displaying bright yellow or light green line pattern symptoms were collected from individual, large, mature buddleias in a home garden in Clemson, SC, a botanical garden in Knoxville, TN, and a container-grown plant on sale in a retail home and garden store in Seneca, SC. Buddleias grown in the southeastern United States frequently display virus-like symptoms, but the line pattern symptom displayed by these plants was atypical of the mosaic, mottling, and leaf deformation seen when buddleias are infected with Alfalfa mosaic virus (AMV) or Cucumber mosaic virus (CMV) (2,4). Line pattern symptoms are frequently seen in woody species infected by ilarviruses or nepoviruses (2). No ilarviruses are reported to infect buddleia and only the nepovirus, Strawberry latent ringspot virus, which is restricted mainly to Europe, is reported to infect this species (1,2). The nepoviruses Tomato ringspot virus (ToRSV) and Tobacco ringspot virus (TRSV) are frequently found infecting plants of many species in the southeastern United States (3). Total RNA was extracted from the three symptomatic plants and used in reverse transcription-polymerase chain reactions (RT-PCR) to detect ToRSV and TRSV using primer pairs developed in this laboratory, which amplify regions around the amino terminus of the coat protein of the respective viruses. The expected amplification product for ToRSV of 327 base pairs was obtained from samples tested from each plant, and the nucleotide sequence of the product showed 96% identity with the corresponding fragment of GenBank Accession No. NC_003839 that the primers were designed to amplify. Repeated attempts to isolate a virus from symptomatic leaves using sap inoculation to Chenopodium amaranticolor Coste & Reyne, C. quinoa Willd, Nicotiana clevelandii Gray, and N. tabacum L. have failed. Repeated testing by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) of leaves from the plant growing in Clemson consistently produced absorbance values at 405 nm in the range of 0.47 to 0.55 (mean of 8 separate samples per test) for symptomatic and asymptomatic leaves. The range of values for the positive control (ToRSV-G growing in N. clevelandii) was 1.3 to 1.5. The ranges of values for the noninfected controls (noninfected N. clevelandii and leaf tissue from a buddleia known to be infected with AMV and CMV but in which ToRSV or TRSV had never been detected by RT-PCR) were 0.102 to 0.104 and 0.102 to 0.106, respectively. The extraction buffer produced absorbance readings in the range of 0.098 to 0.102. RT-PCR of RNA extracted from other portions of the leaves used in the ELISA consistently amplified the 327-bp product from symptomatic leaves and from the positive control but not from noninfected control tissues. RNA from asymptomatic leaves on the infected plant also produced the 327-bp product in RT-PCR. Isolation of viruses from woody hosts is frequently difficult, and although, we have yet to succeed to confirm the association between the observed symptom and ToRSV, the evidence from PCR and ELISA would indicate ToRSV is present in these plants. To our knowledge, this is the first report of ToRSV, a member of the genus Nepovirus, in buddleia. References: (1) J. Albouy and J. C. Devergne. Maladies á Virus des Plants Ornementales. INRA Editions, Paris, 1998. (2) J. I. Cooper. Virus Diseases of Trees and Shrubs. 2nd ed. Chapman and Hill, London, 1993. (3) J. R. Edwards and R. G. Christie. Pages 352–353 in: Handbook of Viruses Infecting Legumes. CRC Press, Boca Raton, FL, 1991. (4) C. J. Perkins and R. G. T. Hicks. Plant Pathol. 38:443, 1989.

scholarly journals Occurrence of Prunus necrotic ringspot virus and Arabis mosaic virus on Rose in Iran

Plant Disease ◽  
2006 ◽  
Vol 90 (7) ◽  
pp. 975-975 ◽  
Author(s):  
F. Rakhshandehroo ◽  
H. R. Zamani Zadeh ◽  
A. Modarresi ◽  
S. Hajmansoor
Keyword(s):  
Mosaic Virus ◽  
French Bean ◽  
Ringspot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rosa Damascena ◽  
Natural Occurrence ◽  
Arabis Mosaic Virus ◽  
Local Lesions ◽  
Prunus Necrotic Ringspot Virus ◽  
Das Elisa

Rose is an economically important crop for Iran and the world. A survey was carried out from March 2005 to January 2006 to identify viruses infecting rose plants (Rosa × damascena, R. chinensis, R. canina, R. indica, and R. multiflora) in five plantations (Damavand, Tehran, Karaj, Shahre-Rey, and Varamin) in and near the Tehran Province of Iran. Samples (526) from eight rose-growing plantations were collected. All samples were tested for Prunus necrotic ringspot virus (PNRSV), Arabis mosaic virus (ArMV), and Cucumber mosaic virus (CMV) using the dot-immunobinding assay (1) and double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) according to the manufacturer's instructions (Bioreba, Basel, Switzerland). Among the samples tested, PNRSV and ArMV were found in 23.1 and 18.8% of the collection, respectively. No CMV was detected in any of the samples. The presence of ArMV and PNRSV was verified in samples by transmission to indicator test plants, cucumber (Cucumis sativus), French bean (Phaseolus vulgaris), and Cowpea (Vigna unguiculata). Inoculation with extracts from PNRSV-positive plants produced systemic mosaic, stunting, and vein banding on cucumber, and necrotic local lesions on cowpea. No symptoms were observed in French bean. Inoculation with extracts from ArMV-positive plants produced systemic vein banding on cucumber, chlorotic local lesions on French bean, and systemic mosaic on cowpea. These symptoms were similar to those that were described previously for these viruses (2,4). The symptoms observed on indicator plants for each virus corresponded to the results of DAS-ELISA. Examination of crude sap prepared from ArMV- and PNRSV-infected cucumber leaves using immu-nosorbent electron microscopy (IEM) revealed the presence of isometric virus particles with a diameter of approximately 30 and 25 nm, respectively. Frequencies of occurrence of these two viruses as determined by serological detection showed ArMV to be the most prevalent virus in high altitudes (1,700 to 1,900 m above sea level) compared with the lowland regions. Serological tests also indicate that PNRSV is mostly distributed through the red rose varieties (Rosa × damascena, R. chinensis, R. canina, and R. multiflora) and ArMV is within the white varieties (R. canina, R. indica, and R. multiflora). However, mixed infections of PNRSV and ArMV were detected in all rose samples tested. An infection by PNRSV and ArMV either singly or in combination is usually responsible for rose mosaic disease. PNRSV has been isolated in many rose-growing regions worldwide. ArMV alone or in complexes with ilarviruses infect garden and greenhouse rose in Europe and India (3). Mosaic is probably the most commonly found virus on roses. To our knowledge, this is the first report of a natural occurrence of ArMV and PNRSV on rose in Iran. References: (1) E. E. Banttari and P. H. Goodwin. Plant Dis. 69:202, 1985. (2) M. Boulila and M. Marrakchi. Phytopathol. Mediterr. 40:125, 2001. (3) S. Kulshrestha et al. Curr. Sci. 89:1759, 2005. (4) N. Salem et al. Plant Pathol. 86:85, 2004.

Viruses infecting hop, Humulus lupulus, in Australia

1987 ◽  
Vol 38 (1) ◽  
pp. 83 ◽  
Author(s):  
D Munro
Keyword(s):  
Heat Treatment ◽  
Mosaic Virus ◽  
Immunosorbent Assay ◽  
Latent Virus ◽  
Ringspot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Meristem Culture ◽  
Arabis Mosaic Virus ◽  
Foliar Symptoms ◽  
Prunus Necrotic Ringspot Virus

In 1981 a survey of the main commercial hop cultivar in Australia, Pride of Ringwood, showed that foliar symptoms were associated with the presence of carlavirus particles. The incidence of plants containing particles varied between fields from 0 to 58%. In 1982 a survey based on enzyme-linked immunosorbent assay showed that the carlaviruses were hop mosaic and hop latent viruses and that they infected 1-68% and 1-58% of plants respectively. Prunus necrotic ringspot virus infected 4-9% of plants. Arabis mosaic virus was detected in a cultivar of English origin and American hop latent virus in cultivars of recent American origin, but neither of these viruses was detected in Australian-bred hops. Virus-free plants suitable for propagation were located in cultivars Pride of Ringwood and B23, and were produced by heat treatment and meristem culture of cultivar Southern Cross.

scholarly journals Survey for Viruses of Grapevine in Oregon and Washington

Plant Disease ◽  
2005 ◽  
Vol 89 (7) ◽  
pp. 763-766 ◽  
Author(s):  
R. R. Martin ◽  
K. C. Eastwell ◽  
A. Wagner ◽  
S. Lamprecht ◽  
I. E. Tzanetakis
Keyword(s):  
Mosaic Virus ◽  
Ringspot Virus ◽  
Wine Grape ◽  
Grapevine Fanleaf Virus ◽  
Arabis Mosaic Virus ◽  
Field Isolates ◽  
Tomato Ringspot Virus ◽  
Rupestris Stem Pitting ◽  
Stem Pitting ◽  
Vitis Spp

Grapevines (Vitis spp.) in Washington and Oregon were surveyed for the prevalence of key grapevine viruses. Samples collected from 1,522 vines in Washington were tested for Rupestris stem pitting associated virus (RSPaV), Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tomato ringspot virus (ToRSV), and Grapevine leafroll associated virus-3 (GLRaV-3). Tests were also conducted for GLRaV-1 and -2 on 420 samples from Washington. Two hundred forty samples collected from wine grape vineyards in Oregon were tested for GLRaV-1, -2, and -3, and an additional 2,880 samples were collected from 40 vineyards known to have high populations of Xiphinema americanum nematodes. The latter were tested for ArMV, ToRSV, and GFLV. GLRaV-1, -2, and -3 were detected in 2.6, 0.2, and 6.5% of the Washington samples and in 3.0, 0.4, and 4.4% of the Oregon samples. RSPaV was detected in 4.6% of the samples from Washington. No ToRSV, ArMV, or GFLV was detected in any of the samples from Oregon or Washington. Transmission of field isolates of GLRaV-3 from Washington by the grape mealybug also was demonstrated.

Efficiency of a chemo-thermotherapy technique for eliminating Arabis mosaic virus (ArMV) and Prunus necrotic ringspot virus (PNRSV) from in vitro rose plantlets

2016 ◽  
Vol 5 (4) ◽  
pp. 497-506 ◽  
Author(s):  
Amir Modarresi Chahardehi ◽  
◽  
Farshad Rakhshandehroo ◽  
Javad Mozafari ◽  
Leila Mousavi ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Ringspot Virus ◽  
Arabis Mosaic Virus ◽  
Prunus Necrotic Ringspot Virus

scholarly journals First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Plant Disease ◽  
2013 ◽  
Vol 97 (4) ◽  
pp. 561-561 ◽  
Author(s):  
S. Khankhum ◽  
P. Bollich ◽  
R. A. Valverde
Keyword(s):  
Common Bean ◽  
Mosaic Virus ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Ringspot Virus ◽  
Wild Plants ◽  
Rt Pcr ◽  
Sequence Comparisons ◽  
First Report ◽  
Tobacco Ringspot Virus

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

Sign in / Sign up

Export Citation Format

Share Document