First Report of Tomato ringspot virus in Butterfly Bush (Buddleia davidii)

Leaves displaying bright yellow or light green line pattern symptoms were collected from individual, large, mature buddleias in a home garden in Clemson, SC, a botanical garden in Knoxville, TN, and a container-grown plant on sale in a retail home and garden store in Seneca, SC. Buddleias grown in the southeastern United States frequently display virus-like symptoms, but the line pattern symptom displayed by these plants was atypical of the mosaic, mottling, and leaf deformation seen when buddleias are infected with Alfalfa mosaic virus (AMV) or Cucumber mosaic virus (CMV) (2,4). Line pattern symptoms are frequently seen in woody species infected by ilarviruses or nepoviruses (2). No ilarviruses are reported to infect buddleia and only the nepovirus, Strawberry latent ringspot virus, which is restricted mainly to Europe, is reported to infect this species (1,2). The nepoviruses Tomato ringspot virus (ToRSV) and Tobacco ringspot virus (TRSV) are frequently found infecting plants of many species in the southeastern United States (3). Total RNA was extracted from the three symptomatic plants and used in reverse transcription-polymerase chain reactions (RT-PCR) to detect ToRSV and TRSV using primer pairs developed in this laboratory, which amplify regions around the amino terminus of the coat protein of the respective viruses. The expected amplification product for ToRSV of 327 base pairs was obtained from samples tested from each plant, and the nucleotide sequence of the product showed 96% identity with the corresponding fragment of GenBank Accession No. NC_003839 that the primers were designed to amplify. Repeated attempts to isolate a virus from symptomatic leaves using sap inoculation to Chenopodium amaranticolor Coste & Reyne, C. quinoa Willd, Nicotiana clevelandii Gray, and N. tabacum L. have failed. Repeated testing by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) of leaves from the plant growing in Clemson consistently produced absorbance values at 405 nm in the range of 0.47 to 0.55 (mean of 8 separate samples per test) for symptomatic and asymptomatic leaves. The range of values for the positive control (ToRSV-G growing in N. clevelandii) was 1.3 to 1.5. The ranges of values for the noninfected controls (noninfected N. clevelandii and leaf tissue from a buddleia known to be infected with AMV and CMV but in which ToRSV or TRSV had never been detected by RT-PCR) were 0.102 to 0.104 and 0.102 to 0.106, respectively. The extraction buffer produced absorbance readings in the range of 0.098 to 0.102. RT-PCR of RNA extracted from other portions of the leaves used in the ELISA consistently amplified the 327-bp product from symptomatic leaves and from the positive control but not from noninfected control tissues. RNA from asymptomatic leaves on the infected plant also produced the 327-bp product in RT-PCR. Isolation of viruses from woody hosts is frequently difficult, and although, we have yet to succeed to confirm the association between the observed symptom and ToRSV, the evidence from PCR and ELISA would indicate ToRSV is present in these plants. To our knowledge, this is the first report of ToRSV, a member of the genus Nepovirus, in buddleia. References: (1) J. Albouy and J. C. Devergne. Maladies á Virus des Plants Ornementales. INRA Editions, Paris, 1998. (2) J. I. Cooper. Virus Diseases of Trees and Shrubs. 2nd ed. Chapman and Hill, London, 1993. (3) J. R. Edwards and R. G. Christie. Pages 352–353 in: Handbook of Viruses Infecting Legumes. CRC Press, Boca Raton, FL, 1991. (4) C. J. Perkins and R. G. T. Hicks. Plant Pathol. 38:443, 1989.

Download Full-text

First Report of Tomato ringspot virus Infecting Pepper in Iran

Plant Disease ◽

10.1094/pdis-07-12-0664-pdn ◽

2012 ◽

Vol 96 (12) ◽

pp. 1828-1828 ◽

Cited By ~ 2

Author(s):

Y. Sokhansanj ◽

F. Rakhshandehroo ◽

R. Pourrahim

Keyword(s):

Mosaic Virus ◽

Ringspot Virus ◽

Local Lesion ◽

Capsicum Frutescens ◽

Polymerase Gene ◽

Rt Pcr ◽

Viral Polymerase ◽

First Report ◽

Tomato Ringspot Virus ◽

Das Elisa

Chili pepper (Capsicum frutescens) represents an important crop in Iran and is under cultivation in different regions in Northern Iran. In spring 2012, commercially grown tabasco (Capsicum frutescens) peppers in Varamin, Shahriar, and Karaj districts of Tehran province developed an undescribed disease. Symptoms observed were mosaic, leaf malformations, and stunting. Fruit symptoms included chlorosis and distortion. To verify the identity of the disease, six fields were surveyed and 72 symptomatic leaves were collected and screened by double antibody sandwich (DAS)-ELISA using specific antibodies to Tobacco ringspot virus (TRSV), Tomato ringspot virus (ToRSV), Pepper mild mottle virus (PMMV), Tomato mosaic virus (ToMV), Tobacco mosaic virus (TMV), and Arabis mosaic virus (ArMV). ToRSV was found in 23% of the samples collected. None of the samples had a positive reaction to other tested viruses. The ToRSV-positive peppers were used for mechanical transmission to Chenopodium quinoa, local lesion host, and after two cycles of single local lesion isolation, they were transferred to Cucumis sativus, Solanum esculentum, and Capsicum fructescens. Inoculations resulted in systemic mosaic and chlorotic local lesion on C. sativus; leaf distortion and mosaic on S. esculentum; and mosaic, mottle, and stunting on C. fructescens. All inoculated plants were positive for ToRSV with DAS-ELISA. To further verify ToRSV infection, reverse transcription (RT)-PCR was conducted. Two primers were designed on the basis of the highly conserved sequences of the putative viral polymerase gene available in the GenBank. RT-PCR of total RNA extract from infected peppers and inoculated plants with the designed primers RdR-R (5′-CGCCTGGTAATTGAGTAGCCC-3′) and RdR-F (5′-GAAGAGCTAGAGCCTCAACCAGG-3′), consistently amplified the 411-bp product, while no amplification products were obtained from noninfected control (healthy plants). The fragment from tabasco pepper was cloned into pTZ57R/T (Ins T/A clone PCR Cloning kit, Fermentas, St. Leon-Rot, Germany) and sequenced in both directions of three clones. The resulting nucleotide sequence (GenBank Accession No. JQ972695) had the highest identity (94%) with the polymerase gene of a ToRSV isolate from blueberry cv. Patriot (Accession No. GQ141528) and had lower identity (91%) with that of a ToRSV isolate from blueberry cv. Bluecrop (Accession No. GQ141525). Tomato ringspot virus (ToRSV) is reported to infect Capsicum spp. in the United States (1,2). Our results confirm the natural infection of pepper plants in Tehran by ToRSV. To our knowledge, this is the first report of ToRSV infection of pepper in Iran. The finding of this disease in Tehran confirms further spread of the virus within northern regions of Iran and prompts the need for research to develop more effective management options to reduce the impact of ToRSV on pepper crops. Beside, primers designed on the basis of putative viral polymerase gene sequences may improve the detection of ToRSV isolates by RT-PCR in Iran. References: (1) S. K. Green and J. S. Kim. Technical Bulletin. No.18, 1991. (2) G. P. Martelli and A. Quacquarelli. Acta Hortic. 127:39, 1983.

Download Full-text

First Report of Potato spindle tuber viroid Naturally Infecting Field Tomatoes in the Dominican Republic

Plant Disease ◽

10.1094/pdis-09-13-0992-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 701-701

Author(s):

K.-S. Ling ◽

R. Li ◽

D. Groth-Helms ◽

F. M. Assis-Filho

Keyword(s):

United States ◽

Dominican Republic ◽

Mosaic Virus ◽

Potato Spindle Tuber Viroid ◽

The United States ◽

Disease Outbreak ◽

Ringspot Virus ◽

Rt Pcr ◽

Spot Virus ◽

Three Samples

In recent years, viroid disease outbreaks have resulted in serious economic losses to a number of tomato growers in North America (1,2,3). At least three pospiviroids have been identified as the causal agents of tomato disease, including Potato spindle tuber viroid (PSTVd), Tomato chlorotic dwarf viroid (TCDVd), and Mexican papita viroid (MPVd). In the spring of 2013, a severe disease outbreak with virus-like symptoms (chlorosis and plant stunting) was observed in a tomato field located in the Dominican Republic, whose tomato production is generally exported to the United States in the winter months. The transplants were produced in house. The disease has reached an epidemic level with many diseased plants pulled and disposed of accordingly. Three samples collected in May of 2013 were screened by ELISA against 16 common tomato viruses (Alfalfa mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Pepino mosaic virus, Potato virus X, Potato virus Y, Tobacco etch virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato aspermy virus, Tomato bushy stunt virus, Tomato mosaic virus, Tomato ringspot virus, Tomato spotted wilt virus, Groundnut ringspot virus, and Tomato chlorotic spot virus), a virus group (Potyvirus group), three bacteria (Clavibacter michiganensis subsp. michiganensis, Pectobacterium atrosepticum, and Xanthomonas spp.), and Phytophthora spp. No positive result was observed, despite the presence of symptoms typical of a viral-like disease. Further analysis by RT-PCR using Agdia's proprietary pospiviroid group-specific primer resulted in positive reactions in all three samples. To determine which species of pospiviroid was present in these tomato samples, full-genomic products of the expected size (~360 bp) were amplified by RT-PCR using specific primers for PSTVd (4) and cloned using TOPO-TA cloning kit (Invitrogen, CA). A total of 8 to 10 clones from each isolate were selected for sequencing. Sequences from each clone were nearly identical and the predominant sequence DR13-01 was deposited in GenBank (Accession No. KF683200). BLASTn searches into the NCBI database demonstrated that isolate DR13-01 shared 97% sequence identity to PSTVd isolates identified in wild Solanum (U51895), cape gooseberry (EU862231), or pepper (AY532803), and 96% identity to the tomato-infecting PSTVd isolate from the United States (JX280944). The relatively lower genome sequence identity (96%) to the tomato-infecting PSTVd isolate in the United States (JX280944) suggests that PSTVd from the Dominican Republic was likely introduced from a different source, although the exact source that resulted in the current disease outbreak remains unknown. It may be the result of an inadvertent introduction of contaminated tomato seed lots or simply from local wild plants. Further investigation is necessary to determine the likely source and route of introduction of PSTVd identified in the current epidemic. Thus, proper control measures could be recommended for disease management. The detection of this viroid disease outbreak in the Dominican Republic represents further geographic expansion of the viroid disease in tomatoes beyond North America. References: (1). K.-S. Ling and M. Bledsoe. Plant Dis. 93:839, 2009. (2) K.-S. Ling and W. Zhang. Plant Dis. 93:1216, 2009. (3) K.-S. Ling et al. Plant Dis. 93:1075, 2009. (4) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997.

Download Full-text

First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Plant Disease ◽

10.1094/pdis-10-12-0933-pdn ◽

2013 ◽

Vol 97 (4) ◽

pp. 561-561 ◽

Cited By ~ 2

Author(s):

S. Khankhum ◽

P. Bollich ◽

R. A. Valverde

Keyword(s):

Common Bean ◽

Mosaic Virus ◽

Seed Quality ◽

Soybean Mosaic Virus ◽

Ringspot Virus ◽

Wild Plants ◽

Rt Pcr ◽

Sequence Comparisons ◽

First Report ◽

Tobacco Ringspot Virus

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

Download Full-text

First Report of Papaya ringspot virus and Zucchini yellow mosaic virus in Luohanguo (Siraitia grosvenorii) in China

Plant Disease ◽

10.1094/pd-89-0530a ◽

2005 ◽

Vol 89 (5) ◽

pp. 530-530 ◽

Cited By ~ 4

Author(s):

Y.-M. Liao ◽

X.-J. Gan ◽

B. Chen ◽

J.-H. Cai

Keyword(s):

Mosaic Virus ◽

Zucchini Yellow Mosaic Virus ◽

Viral Disease ◽

Ringspot Virus ◽

Yellow Mosaic Virus ◽

Watermelon Mosaic Virus ◽

Papaya Ringspot Virus ◽

Rt Pcr ◽

First Report ◽

Siraitia Grosvenorii

Luohanguo, Siraitia grosvenorii (Swingle) C. Jeffrey, is a perennial cucurbitaceous plant that is an economically important medicinal and sweetener crop in Guangxi province, China. Surveys conducted during the summer to fall seasons of 2003-2004 in northern Guangxi showed symptoms typical of a viral disease, including leaf mottling, mosaic, vein clearing, curling, and shoestring-like distortion in the field. Mechanical inoculation of sap from leaves of symptomatic plants collected from the surveyed areas caused similar symptoms on tissue culture-derived healthy Luohanguo plants. Two sequences of 0.7 and 1.6 kb with 88 and 97% identity to Papaya ringspot virus (PRSV) and Zucchini yellow mosaic virus (ZYMV) were amplified using reverse transcription-polymerase chain reaction (RT-PCR) with purified flexuous viral particles or total RNA extracted from the symptomatic Luohanguo leaves as templates with conserved degenerate potyvirus primers (1). To confirm the results, primers specific for PRSV (PP1/PP2, genome coordinates 4064-4083/5087-5069, GenBank Accession No X97251) and ZYMV (ZP1/ZP2, genome coordinates 5540-5557/7937-7920, GenBank Accession No L31350) were used to perform RT-PCR from the same RNA templates. The expected 1.0- and 2.3-kb fragments were amplified and they were 90 and 95% identical to PRSV and ZYMV in sequence, respectively. Watermelon mosaic virus was not detected. To our knowledge, this is the first report of the occurrence of PRSV and ZYMV in Luohanguo. Reference: (1) A. Gibbs et al. J. Virol. Methods 63:9, 1997.

Download Full-text

First Report of Blackberry chlorotic ringspot virus in Rubus sp. in the United States

Plant Disease ◽

10.1094/pdis-91-4-0463c ◽

2007 ◽

Vol 91 (4) ◽

pp. 463-463 ◽

Cited By ~ 6

Author(s):

I. E. Tzanetakis ◽

J. D. Postman ◽

R. R. Martin

Keyword(s):

United States ◽

The United States ◽

Ringspot Virus ◽

Tobacco Streak Virus ◽

Rapid Decline ◽

Streak Virus ◽

Black Raspberry ◽

Rt Pcr ◽

Indicator Plants ◽

First Report

Blackberry chlorotic ringspot virus (BCRV), genus Ilarvirus, has been found in Rubus sp. in Scotland (2) and rose in the United States (4). The possibility that BCRV infects other hosts in the United States was explored. We tested 18 accessions of Fragaria sp. and 30 of Rubus sp. maintained at the National Clonal Germplasm Repository in Corvallis, OR. Ilarviruses had been detected in these plants by reverse transcription (RT)-PCR, ELISA, or had caused symptoms typical of ilarviruses on indicator plants. The accessions were tested by RT-PCR with primers F (5′-GTTTCCTGTGCTCCTCA-3′) and R (5′-GTCACACCGAGGTACT-3′) (4) that amplify a 519 to 522 nt (depending on the isolate) region of the RNA 3 of BCRV. The virus was detected in two accessions of black raspberry (Rubus occidentalis L.): RUB433, cv. Lowden and RUB 9012, cv. New Logan. The sequences of the fragments amplified from these accessions (GenBank Accession Nos. EF041817 and EF041818, respectively) had 97% nt sequence identity to each other and 95 and 88% nt identity to the rose and Scottish isolates (GenBank Accession Nos. DQ329378 and DQ091195, respectively). Chenopodium quinoa indicator plants inoculated with isolate RUB 433 developed mild chlorotic spots on the inoculated leaves 4 days after inoculation. RT-PCR and sequencing of the amplicons verified BCRV infection of C. quinoa. RUB 9012 was used for the characterization of Black raspberry latent virus (BRLV), later thought to be an isolate of Tobacco streak virus (TSV). This accession was recently found to be infected with Strawberry necrotic shock virus (SNSV) but not TSV (3). It is possible that BRLV may be a mixture of SNSV and BCRV. SNSV is one of the most abundant viruses of Rubus sp. in the Pacific Northwest (1), and the finding of another ilarvirus, BCRV, may account in part for the rapid decline of Rubus sp. observed in several fields in Oregon and Washington. To our knowledge, this is the first report of BCRV infecting Rubus sp. outside the United Kingdom. References: (1) A. B. Halgren. Ph.D. Diss. Oregon State University, Corvallis, OR, 2006. (2) A. T. Jones et al. Ann. Appl. Biol. 149:125, 2006. (3) I. E. Tzanetakis et al. Arch. Virol. 149:2001, 2004. (4) I. E. Tzanetakis et al. Plant Pathol. 55:568, 2006.

Download Full-text

Characteristics of rose mosaic diseases

Acta Agrobotanica ◽

10.5586/aa.2004.008 ◽

2013 ◽

Vol 57 (1-2) ◽

pp. 79-89

Author(s):

Marek S. Szyndel

Keyword(s):

Mosaic Virus ◽

Mosaic Disease ◽

Ringspot Virus ◽

Yellow Vein ◽

Line Pattern ◽

Arabis Mosaic Virus ◽

Tobacco Ringspot Virus ◽

Tomato Ringspot Virus ◽

Prunus Necrotic Ringspot Virus ◽

Methods Of Control

Presented review of rose diseases, associated with the mosaic symptoms, includes common and yellow rose mosaic, rose ring pattern, rose X disease, rose line pattern, yellow vein mosaic and rose mottle mosaic disease. Based on symptomatology and graft transmissibility of causing agent many of those rose disorders are called "virus-like diseases" since the pathogen has never been identified. However, several viruses were detected and identified in roses expressing mosaic symptoms. Currently the most prevalent rose viruses are Prunus necrotic ringspot virus - PNRSV, Apple mosaic virus - ApMV (syn. Rose mosaic virus) and Arabis mosaic virus - ArMV Symptoms and damages caused by these viruses are described. Tomato ringspot virus, Tobacco ringspot virus and Rose mottle mosaic virus are also mentioned as rose pa thogcns. Methods of control of rose mosaic diseases are discussed.

Download Full-text

First Report of Cucumber green mottle mosaic virus on Melon in the United States

Plant Disease ◽

10.1094/pdis-02-14-0176-pdn ◽

2014 ◽

Vol 98 (8) ◽

pp. 1163-1163 ◽

Cited By ~ 35

Author(s):

T. Tian ◽

K. Posis ◽

C. J. Maroon-Lango ◽

V. Mavrodieva ◽

S. Haymes ◽

...

Keyword(s):

United States ◽

Mosaic Virus ◽

Seed Production ◽

Citrullus Lanatus ◽

The United States ◽

Rt Pcr ◽

First Report ◽

Rigid Rod ◽

Yolo County ◽

Das Elisa

In July 2013, a melon (Cucumis melo var. Saski) field in Yolo County, California, was inspected as part of a phytosanitary inspection for seed production. The leaves of the plants showed mosaic, green mottle, and blotches. When plant sap was examined using a transmission electron microscope, rigid rod-shaped particles were observed. Melon plant samples were analyzed by both CDFA and USDA APHIS PPQ laboratories and tested positive using DAS-ELISA against Cucumber green mottle mosaic virus (CGMMV) (Agdia, Elkhart, IN). To confirm the presence of CGMMV, total RNA was analyzed by RT-PCR using primers CGMMV-F5370 5′-CTAATTATTCTGTCGTGGCTGCGGATGC-3′ and CGMMV-R6390 5′-CTTGCAGAATTACTGCCCATA-3′ designed by PPQ based on 21 genomic sequences of CGMMV found worldwide. The 976-bp amplicon was sequenced (GenBank Accession No. KJ453559) and BLAST analysis showed the sequence was 95% identical to MP and CP region of CGMMV isolates reported from Russia (GQ495274, FJ848666), Spain (GQ411361), and Israel (KF155231), and 92% to the isolates from China (KC852074), Korea (AF417243), India (DQ767631), and Japan (D12505). These analyses confirm the virus was CGMMV. To our knowledge, this is the first report of CGMMV in the United States. Based on our sequence data, a second set of primers (CGMMV-F5796 5′-TTGCGTTTAGTGCTTCTTATGT-3′ and CGMMV-R6237 5′-GAGGTGGTAGCCTCTGACCAGA-3′), which amplified a 440-bp amplicon from CGMMV CP region, was designed and used for testing all the subsequent field and seed samples. Thirty-seven out of 40 randomly collected Saski melon samples tested positive for CGMMV, suggesting the virus was widespread in the field. All the melon samples also tested positive for Squash mosaic virus (SqMV) using DAS-ELISA (Agdia). Therefore, the symptoms observed likely resulted from a mixed infection. The melon field affected by CGMMV was immediately adjacent to fields of cucumber (Cucumis sativus var. Marketmore 76) and watermelon (Citrullus lanatus var. Sugar Baby) crops, both for seed production with no barrier between the crops. CGMMV was also detected from symptomatic plants from both fields. Seed lots used for planting all three crops were tested and only the melon seed was positive for CGMMV, suggesting the seed as the source of infection. The sequenced 440-bp RT-PCR amplicons from CGMMV-infected cucumber and watermelon plants and melon seeds were 99% identical to the CGMMV from the field melon. A cucumber plant infected with CGMMV but not SqMV was used for mechanical inoculation at the Contained Research Facility at University of California, Davis. Inoculated cucumber, melon, and watermelon plants showed green mottle and mosaic similar to that observed in the field. CGMMV is a highly contagious virus and damage by this virus on cucurbit crops has been reported in regions where CGMMV is present (2). CGMMV was detected on cucumber grown in greenhouses in Canada with 10 to 15% yield losses reported due to this virus (1). The three cucurbit crops in Yolo County were planted in an isolated area with no other cucurbits nearby. Measures, including destroying all the cucurbit plant material, have been taken to eradicate the virus. Use of CGMMV free cucurbit seed is necessary for prevention of this disease. References: (1) K.-S. Ling et al. Plant Dis. 98:701, 2014. (2) J. Y. Yoon et al. J. Phytopathol. 156:408, 2008.

Download Full-text

First Report of Turnip mosaic virus Infecting Brassica carinata (Ethiopian Mustard) in the United States

Plant Disease ◽

10.1094/pdis-05-13-0500-pdn ◽

2013 ◽

Vol 97 (12) ◽

pp. 1664-1664 ◽

Cited By ~ 3

Author(s):

B. Babu ◽

H. Dankers ◽

S. George ◽

D. Wright ◽

J. Marois ◽

...

Keyword(s):

United States ◽

Mosaic Virus ◽

The United States ◽

Turnip Mosaic Virus ◽

Brassica Carinata ◽

Rt Pcr ◽

First Report ◽

Ethiopian Mustard ◽

Plant Pathol ◽

Pcr Assays

Brassica carinata L. Braun (Ethiopian mustard) is an annual oil seed crop currently being evaluated for its potential use as a source of biofuel. Due to its high content of erucic acid, it provides a biodegradable non-fossil fuel feedstock that has many applications ranging from biofuels to other industrial uses such as polymers, waxes, and surfactants. Moreover, high glucosinolate content adds the scope of B. carinata being used as a bio-fumigant. B. carinata is amenable to low input agriculture and has great economic potential to be used as a winter crop, especially in the southeastern United States. Virus-like leaf symptoms including mosaic, ringspot, mottling, and puckering were observed on B. carinata (cvs. 080814 EM and 080880 EM) in field trials at Quincy, FL, during spring 2013, with disease incidence of >80%. A more extensive survey of the same field location indicated that mosaic symptoms were the most common. Viral inclusion assays (1) of leaves with a range of symptoms indicated the presence of potyvirus-like inclusion bodies. Total RNA extracts (RNeasy Plant Mini Kit, Qiagen Inc., Valencia, CA) from six symptomatic samples and one non-symptomatic B. carinata sample were subjected to reverse transcription (RT)-PCR assays using SuperScript III One-Step RT-PCR System (Invitrogen, Life Technologies, NY), and two sets of potyvirus-specific degenerate primers MJ1-F and MJ2-R (2) and NIb2F and NIb3R (3), targeting the core region of the CP and NIb, respectively. The RT-PCR assays using the CP and NIb specific primers produced amplicons of 327 bp and 350 bp, respectively, only in the symptomatic leaf samples. The obtained amplicons were gel-eluted and sequenced directly (GenBank Accession Nos. KC899803 to KC899808 for CP and KC899809 to KC899813 for NIb). BLAST analysis of these sequences revealed that they came from Turnip mosaic virus (TuMV). Pairwise comparisons of the CP (327 bp) and NIb (350 bp) segments revealed 98 to 99% and 96 to 98% nucleotide identities, respectively, with corresponding sequences of TuMV isolates. These results revealed the association of TuMV with symptomatic B. carinata leaf samples. Although TuMV has been reported from B. carinata in Zambia (4), this is the first report of its occurrence on B. carinata in the United States. Considering the importance of B. carinata as a biofuel source, this report underscores the need for developing effective virus management strategies for the crop. References: (1) R. G. Christie and J. R. Edwardson. Plant Dis. 70:273, 1986. (2) M. Grisoni et al. Plant Pathol. 55:523, 2006. (3) L. Zheng et al. Plant Pathol. 59:211, 2009. (4) D. S. Mingochi and A. Jensen. Acta Hortic. 218:289, 1988.

Download Full-text

First Report of Impatiens necrotic spot virus in Mexico in Tomatillo and Pepper Plants

Plant Disease ◽

10.1094/pdis-01-13-0092-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1124-1124 ◽

Cited By ~ 5

Author(s):

B. E. González-Pacheco ◽

L. Silva-Rosales

Keyword(s):

Mosaic Virus ◽

Ringspot Virus ◽

Impatiens Necrotic Spot Virus ◽

Post Inoculation ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

First Report ◽

True Leaf ◽

Necrotic Spots

Mexico contributes 20% of the total worldwide pepper exports (1). Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) has emerged and has possibly caused diseases in various crops and ornamentals in Mexico. INSV was treated as a quarantine virus in Mexico (2) but not anymore. During the growing seasons of 2009 to 2011, surveys were conducted in the counties of Guanajuato and Querétaro in the states of the same names. Sampling included tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) plantations where plants with possible viral symptoms were observed. The symptoms observed were dark necrotic spots on some leaves and on the stems. These were similar to those observed elsewhere (3). Leaf spots further developed into localized necrotic areas. Using ELISA (Agdia, Elkhart, IN) with polyclonal antibodies, all collected samples showing symptoms tested positive for INSV and negative for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tobacco ringspot virus (TRSV), and Tomato ringspot virus (ToRSV). In order to identify the causal agent of these symptoms, INSV-specific sequences available for the S genomic fragments were obtained from NCBI GenBank. They were aligned and used to design primers to amplify a 250-bp fragment from total extracted RNA from healthy and symptomatic plants using reverse transcription (RT)-PCR. Primers used were INSVF (5′CCCAACTGCCTCTTTAGTGC3′) and INSVR (5′GGACAATGGATCTGCTCTGA3′). Three extracted plasmids, each containing an amplified and cloned fragment for the pepper and tomatillo isolates, were sequenced (GenBank Accession Nos. KC503051 and KC503052, respectively). Both nucleotide sequences showed 95% identity with the Chinese, Italian, and Japanese INSV sequences (FN400773, DQ425096, and AB207803, respectively) and 94% identity to other INSV isolates (4). The putative Mexican INSV pepper isolate, derived from a necrotic spot, was mechanically inoculated to other experimental host plants after grinding 1 g of symptomatic leaf tissue in 3 ml of a buffer with quaternary ammonium salts at 0.5%, pH 7.8. Ten plants, at the second true-leaf stage, of each Capsicum annuum cv. cannon and Citrullus lanatus were inoculated after carborundum abrasion of the second true leaf. At 15 days post inoculation, systemic chlorotic necrotic spots, stunting, and apical malformation were observed in capsicum plants while wilting was shown in watermelon plants. RT-PCR analyses and nucleotide sequence of the amplified product confirmed the presence and identity of both virus isolates. To our knowledge, this is the first report of INSV in Mexico found naturally in tomatillo and pepper and experimentally in watermelon plants. Derived from this report, INSV distribution in Mexico should be studied due to its potential impact on these two economically important crops. References: (1) Food and Agriculture Organization of the United Nations. FAOSTAT, retrieved online at http://faostat.fao.org , 2013. (2) DGSV-CNRF. Impatiens necrotic spot virus (INSV). SAGARPA-SENASICA. México, 2011. (3) M. Ding et al. Plant Dis. 95:357, 2011. (4) I. Mavrič et al. Plant Dis. 85:12, 2001.

Download Full-text

First Report of Strawberry latent ringspot virus in a Mentha sp. from North America

Plant Disease ◽

10.1094/pdis.2004.88.8.907b ◽

2004 ◽

Vol 88 (8) ◽

pp. 907-907 ◽

Cited By ~ 18

Author(s):

J. D. Postman ◽

I. E. Tzanetakis ◽

R. R. Martin

Keyword(s):

United States ◽

North America ◽

Consensus Sequence ◽

The United States ◽

Ringspot Virus ◽

Yellow Vein ◽

Cdna Clones ◽

Meristem Culture ◽

Rt Pcr ◽

First Report

Yellow veinbanding symptoms have been observed in several mint clones at the U.S. Department of Agriculture, Agricultural Research Service, National Clonal Germplasm Repository (NCGR) mint collection in Corvallis, Oregon. The most dramatic symptoms are in a “variegated” clone of Mentha × gracilis Sole (NCGR Accession No. MEN-454), which is marketed widely in the nursery industry under cultivar names such as Golden Ginger Mint and Green and Gold. Tucker and Fairbrothers (2) proposed the name Mentha gentilis (= M. × gracilis) L. ‘Variegata’ for forms of this species with a graft transmissible variegation. Doublestranded RNA (dsRNA) was extracted from three mint clones with veinbanding symptoms of varying intensity. The dsRNA from MEN-454 was cloned, and sequences from several clones corresponded to RNA 2 of Strawberry latent ringspot virus (SLRSV), a tentative member of the family Sequiviridae. Sequences of additional cDNA clones suggested that two previously unknown viruses and the satellite RNA of SLRSV were also present in MEN-454. On the basis of the sequences of the SLRSV clones, primers F (5′ CCTCTCCAACCTGCTAGACT 3′) and R (5′ AAGCGCATGAAGGTGTAACT 3′) were developed and used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify a 497-bp fragment of RNA 2 of SLRSV from MEN-454. No amplicons in RT-PCR tests or dsRNA was obtained from a clone of MEN-454 that was freed of the yellow vein symptom by heat therapy and apical meristem culture. The consensus sequence of cloned dsRNA and sequenced PCR products for SLRSV from MEN-454 has been deposited in GenBank (Accession No. AY 438666). Chenopodium quinoa, inoculated mechanically with leaf extracts from MEN-454, developed chlorosis and apical necrosis that were similar to symptoms reported for SLRSV infection (1). The presence of SLRSV in C. quinoa was confirmed using RT-PCR. Variegated M. × gracilis clones were obtained from wholesale and mail-order nurseries in Maryland, Ohio, and Nebraska. Samples were assayed using RT-PCR utilizing the F and R primers for presence of SLRSV. All samples tested positive for the virus using RT-PCR. Because of the presence of additional viruses, we cannot attribute yellow vein symptoms solely to SLRSV, however the presence of this virus in clones of M. × gracilis ‘Variegata’ from different regions throughout the United States demonstrates that SLRSV is distributed widely in the United States. To our knowledge, this is the first report of SLRSV in mint in North America. References: (1) K. Schmelzer. Phytopathol. Z. 66:1, 1969. (2) A. O. Tucker and D. E. Fairbrothers. Taxon 21:209, 1972.

Download Full-text