Seasonal fluctuation and host species affect Tobacco ringspot virus detection

Tobacco ringspot virus (TRSV) is a pathogen with a wide host range that can cause disease in many perennial species. Yet detection of this virus can be insistent and unreliable, complicating disease management. In this study we asked whether seasonal effects changed the titer and distribution of the virus in Vitis vinifera, Malus domestica, and Prunus armeniaca. We developed an RT-qPCR assay and used it to monitor TRSV accumulation in leaves, stems, and roots over the course of a year. TRSV titer, and the tissues in which it accumulated, changed throughout the year in a host-specific manner which may be due to host plant growth patterns and temperature. These data will aid in determining optimal sampling time, and which tissues to collect to have confidence in diagnostic results.

First report of Tobacco ringspot virus in highbush blueberry in Washington State

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

Affection of Gladiolus plants with Bean Yellow Mosaic Virus, Cucumber Mosaic Virus and Tobacco Ringspot Virus in some Northern and Central regions of Ukraine

Gladioli can be affected with 15 species of viruses, which cause significant economic losses to both floriculture and agriculture. The most prevalent and harmful for gladioli are Bean yellow mosaic virus (BYMV) and Cucumber mosaic virus (CMV), circulating on the territory of Ukraine on vegetable, legume and other crops, and also Tobacco ringspot virus (TRSV), which is included into the List of regulated pests of Ukraine and is the subject to strict control. The aim of the work was to conduct testing of gladiolus plants for the presence of viral infection symptoms and to test them for the affection with the most widespread and dangerous viruses, namely: BYMV, CMV, TRSV. Visual diagnostics, enzyme-linked immunosorbent assay in DAS-ELISA modification, transmission electron microscopy method and statistical data analysis were used in this research. The results of the studies showed absence of TRSV in all tested samples. For the first time in Ukraine, it has been established that gladioli are infected by Bean yellow mosaic virus. Its circulation on gladioli has been registered in Poltava, Kyiv and Sumy regions. Gladioli were also found to be affected by CMV or mixed infection of these pathogens. Gladioli infection by BYMV and CMV in Kyiv region is 88.2% and 93.8%, in Poltava – 69.2% and 55.5%, in Sumy – 66.6% and 0%, respectively. Typical symptoms on gladiolus plants caused by CMV and BYMV isolates are leaf chlorotic stripes and flower color break, less often – spotting on the leaves and plant stunting. It has been revealed that affection of gladioli by CMV and BYMV can be asymptomatic. The diversity, nature and course of viral infections in gladioli demonstrate the relevance of further research and their monitoring in Ukraine.