First Report of Meloidogyne enterolobii on Cultivated Fenugreek, Trigonella corniculata L. in India

Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text

First Report of Root-Knot Nematode Meloidogyne enterolobii on Poinsettia ‘Luv U Pink’ in Taiwan

Plant Disease ◽

10.1094/pdis-09-21-1899-pdn ◽

2021 ◽

Author(s):

Che-Chang Liang ◽

P. Janet Chen

Keyword(s):

United States ◽

18S Rrna ◽

The United States ◽

18S Rrna Gene ◽

Rrna Gene ◽

First Report ◽

Meloidogyne Enterolobii ◽

Mock Control ◽

Haplotype 1 ◽

Coii Region

Poinsettia (Euphorbia pulcherrima Willd. ex Klotzsch.), originated in southern Mexico and northern Guatemala, is the most valuable potted flowering plant in the spurge family (Euphorbiaceae). The European Union and the United States are two biggest poinsettia markets (Taylor et al. 2011), with a wholesale value of $153 million in the United States in 2019. Root knot galls of poinsettia ‘Luv U Pink’ were collected from a production greenhouse located in Nantou County, Taiwan in March 2021. No aboveground symptoms were observed. A nematode population was established from a single female and used for identification and the Koch’s postulate. The perineal patterns of randomly picked 5 females are round or ovoid with moderate to high dorsal arches, but no distinct lateral lines, ventral striae are fine and smooth. The Morphometric characters of second-stage juvenile include: a vermiform body shape, tail narrow and tapering with rounded tail tips, and a distinct hyaline tail end. Measurements of 20 J2 are as follows: body length, 430 (398 - 473) μm; body width, 15.4 (13.4 - 17.8) μm; stylet length,13.4 (13.0 - 14.0) μm; dorsal esophageal gland orifice to basal knob, 3.4 (2.8 - 3.9) μm; tail length, 52.9 (47.6 - 62.2) μm. All morphometric data were consistent with the original description of Meloidogyne enterolobii (Yang and Eisenback 1983). Nematode DNA was extracted using GeneMark Tissue & Cell Genomic DNA Purification Kit (GeneMark, Taiwan) from approximately 1500 J2 and used for amplification of 18S rRNA gene, a D2-D3 region of 28S rRNA gene, and a mtDNA COII region with primer sets 1A/MelR, D2A/D3B, and C2F3/1108, respectively (Power and Harris 1993, Subbotin et al. 2006, Tigano et al. 2005). The sequence of 18S rRNA gene (accession no. MZ948800 haplotype 1 and MZ955998 haplotype 2), haplotype 1 shared 100% identity with that of M. enterolobii from the United States (KP901058) and China (MN832688); haplotype 2 shared 99.8% identity with that of KP901058 and MN832688. The sequence of the D2-D3 region (MZ955995) shared 99% identity with that M. enterolobii from the United States (KP901079). Sequence of the COII region (MZ964625) also shared 99% identity with that of M. enterolobii from the United States (AY446975) and China (MN840970). Phylogenetic trees of the three gene sequences plotted as described by Ye et al. (2021) revealed that the newly described nematode was grouped with M. enterolobii. Sequence analysis of two fragments: 236 bp and 520 bp amplified with gene specific primers Me-F/R and MK7F/R, respectively (Long et al. 2006, Tigano et al. 2010) also confirmed the identity of M. enterolobii. To measure the reproductive factor (Rf), the Poinsettia ‘Luv U Pink’ seedlings with eight true leaves were transplanted into three 12-cm diameter pots each containing 6000 eggs or water (mock control). Forty-five days after inoculation, the average Rf value of three inoculated plants was 6, and no galls were observed on mock control plant roots, confirming that poinsettia is the host of M. enterolobii. M. enterolobii has been reported in several Euphorbia species, including E. heterophylla, E. prostrata, E. punicea and E. tirucalli (Han et al. 2012, Rich et al. 2009). To the best of our knowledge, this is the first report of M. enterolobii infecting E. pulcherrima ‘Luv U Pink’.

Download Full-text

First Report of the Root-Knot Nematode Meloidogyne enterolobii on Bananas in Brazil

Plant Disease ◽

10.1094/pdis-04-18-0602-pdn ◽

2019 ◽

Vol 103 (2) ◽

pp. 377-377 ◽

Cited By ~ 1

Author(s):

L. Luquini ◽

D. Barbosa ◽

C. Ferreira ◽

L. Rocha ◽

F. Haddad ◽

...

Keyword(s):

Root Knot Nematode ◽

First Report ◽

Meloidogyne Enterolobii

Download Full-text

First Report of Root-Knot Nematode Meloidogyne enterolobii on Gardenia jasminoides in China

Plant Disease ◽

10.1094/pdis-12-18-2128-pdn ◽

2019 ◽

Vol 103 (6) ◽

pp. 1434

Author(s):

X. H. Lu ◽

G. S. Solangi ◽

D. J. Li ◽

J. L. Huang ◽

Y. Zhang ◽

...

Keyword(s):

Root Knot Nematode ◽

First Report ◽

Gardenia Jasminoides ◽

Meloidogyne Enterolobii

Download Full-text

First Report of Meloidogyne enterolobii Infecting Artocarpus heterophyllus Worldwide

Plant Disease ◽

10.1094/pdis-12-14-1292-pdn ◽

2015 ◽

Vol 99 (9) ◽

pp. 1284 ◽

Cited By ~ 1

Author(s):

J. A. Brito ◽

T. Smith ◽

D. W. Dickson

Keyword(s):

Artocarpus Heterophyllus ◽

First Report ◽

Meloidogyne Enterolobii

Download Full-text

First Report of the Root-Knot Nematode Meloidogyne enterolobii Parasitizing Watermelon from Veracruz, Mexico

Plant Disease ◽

10.1094/pdis-06-13-0636-pdn ◽

2014 ◽

Vol 98 (3) ◽

pp. 428-428 ◽

Cited By ~ 12

Author(s):

A. Ramírez-Suárez ◽

L. Rosas-Hernández ◽

S. Alcasio-Rangel ◽

T. O. Powers

Keyword(s):

Phylogenetic Trees ◽

Citrullus Lanatus ◽

Pcr Amplification ◽

Original Description ◽

Root Knot Nematode ◽

Morphometric Characters ◽

First Report ◽

Worldwide Distribution ◽

Meloidogyne Enterolobii ◽

Stylet Length

In early April 2012, a sampling of watermelon crop Citrullus lanatus (Thunb.) Matsum & Nakai, 1916 cv. Sunsugar took place as part of the National System of Epidemiological Phytosanitary Surveillance (SINAVEF-MEX). This sampling was conducted at Riachuelos locality, Tecolutla, Veracruz, located at the geographic coordinates: 20.42008° N and 96.9627° W, within 50 meters of the Gulf of Mexico. Plants showed yellowing, stunting, and high levels of infection expressed by extensive galling on the roots. These symptoms were reproduced in the greenhouse on watermelon cv. Sunsugar. Egg masses were extracted to obtain juveniles (J2). Female necks and perineal patterns were mounted as well as males and J2 to take measurements of selected morphometric characters. To determine the nematode identity based on a morphological species concept, the following characters were considered. Females: stylet length, DGO and perineal pattern; males: stylet length; J2: body, stylet, tail, and hyaline tail terminus length. The morphometric analysis showed that those values corresponded to the original description of the root-knot nematode Meloidogyne enterolobii Yang & Eisenback, 1983 (=M. mayaguensis Rammah & Hirschmann, 1988) (1,2,3,4). For confirmation of this finding, a molecular diagnosis was performed using markers located in rDNA and mtDNA by PCR amplification and DNA sequencing. The rDNA region analyzed was the expansion segments D2-D3 of the 28S gene (primers D2A and D3B). This produced an amplified product of 780 bp. With regard to mtDNA, an amplification of the marker located between the genes COII/16S (primers C2F3 and 1108) resulted in a fragment of 705 bp that is specific for M. enterolobii (1). Sequences of the amplified products were compared with sequences from GenBank (NCBI). The sequences of both markers exhibited 99 and 100% identity with sequences corresponding to M. enterolobii isolates from Florida, Puerto Rico, and China. Maximum likelihood phylogenetic trees of rDNA and mtDNA sequences demonstrated that the Mexican isolate of M. enterolobii grouped among other isolates exclusive of other Meloidogyne species. The detection of this nematode in Veracruz, Mexico, expands the previously known worldwide distribution. It represents a serious threat due to the high level of aggressiveness shown in watermelon, which was so severe that growers had to change to a different crop. To our knowledge, this is the first report of the root-knot nematode M. enterolobii infecting watermelon cv. Sunsugar in Veracruz, Mexico. References: (1) J. Brito et al. J. Nematol. 36:232, 2004. (2) G. Karssen et al. ZooKeys 181:67, 2012. (3) A. Rammah and H. Hirshmann. J. Nematol. 20:58, 1988. (4) B. Yang and J. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text

First Report of Root-Knot Nematode Meloidogyne enterolobii on Cockscomb (Celosia argentea var. cristata) in Taiwan

Plant Disease ◽

10.1094/pdis-10-21-2126-pdn ◽

2021 ◽

Author(s):

Jo Tzu Ho ◽

Che-Chang Liang ◽

P. Janet Chen

Keyword(s):

United States ◽

18S Rdna ◽

The United States ◽

Root Knot Nematode ◽

First Report ◽

Meloidogyne Enterolobii ◽

Celosia Argentea ◽

Pathogenicity Tests ◽

Primer Sets ◽

Coii Region

Cockscomb (Celosia argentea) is commonly found in subtropical and temperate zones of Africa, South America and South East Asia, and is a popular ornamental plant in the family Amaranthaceae. Cockscomb has been known to contain antiviral proteins, betalains, and anthocyanin, which can be applied in beneficial ways (2). In September 2020, a cockscomb plant (Celosia argentea var. cristata) showing typical galling root symptoms likely infected by root-knot nematodes (Meloidogyne sp.) was collected from a garden in Taichung, Taiwan, and a quick exam of several individuals using MK7F/R primers (7) indicating they were M. enterolobii. Nematode population was established from a single egg mass and was later used for species identification and pathogenicity tests. Five perineal patterns of mature females from the single female population show round to oval shapes with weak lateral lines. Dorsal arches are moderate to high, almost squared, with the smooth ventral striae. Second-stage juveniles are vermiform and have a slender tail, tapering to rounded tip with distinct hyaline region at the tail terminus. Morphological measurements of 28 J2s revealed body length = 457.2 ± 20.6 (416.1-506.9) μm, body width = 16.0 ± 2.0 (13.4-20.3) μm, stylet length = 14.7 ± 0.5 (13.9-15.9) μm, dorsal gland orifice to the stylet base = 4.0 ± 0.5 (2.0-4.8) μm, and tail length = 56.0 ± 3.8 (47.4-60.3) μm. Female perineal patterns and morphometric data are similar to the original description of Meloidogyne enterolobii (9). DNA purified from approximately 1500 juveniles using GeneMark Tissue & Cell Genomic DNA Purification Kit (GeneMark, Taiwan) was used to amplify 18S rDNA fragment, D2-D3 expansion segments of 28S rDNA, and a COII region on mtDNA with primer sets 1A/MelR, D2A/D3B, and C2F3/1108, respectively (4,5,6). The 18S rDNA sequence (OK076893) of this study shares 99.94% nucleotide identity with those of M. enterolobii isolated from the United States (KP901058) and China (MN832688). D2D3 sequence of haplotype 1 (OK076898) shows 100% identity to those of M. enterolobii from China (MT193450) and Taiwan (KP411230). Sequence of haplotype 2 (OK076899) shows 99.86% identity to those of M. enterolobii from the United States (MN809527) and China (MN269945). Sequence of the COII region (OK086042) show 99.86% identity to that of M. enterolobii from China (MN269945). Phylogenetic trees of the three gene sequences were plotted following Ye et al.(10), revealing that the newly described root-knot nematode on Cockscomb is grouped with other M. enterolobii isolates. DNA fragment amplified by primer sets Me-F/R(3) and MK7F/R specifically targeting of M. enterolobii yielded 236 bp and 520 bp, respectively. Pathogenicity tests were assayed, from July to September 2021, on three-week-old nematode-free cockscomb plant directly germinated from seeds of SkyStar® (ASUSA SPIKE SEEDS, Taipei, Taiwan) planted in a 10.5 cm diameter pot filled with 600 ml sterilized peat moss: sand (1:1, v/v) soil in a 28℃walk-in chamber. Nematode eggs were extracted using 0.05% NaoCl as described by Vrain(8), and cockscomb plants (n=3) were inoculated by adding 6000 eggs (10 eggs/ cm3). Cockscomb plants treated with water were used as mock controls. Rf value of the inoculated plants were determined by the method of Belair and Benoit (1) 45 days after inoculation, and the average was 4.13. No galls were observed on the roots of control plants. The results confirmed that cockscomb is the new host of M. enterolobii. To the best of our knowledge, this is the first report of M. enterolobii on Celosia argentea var. cristata in Taiwan.

Download Full-text