First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China

Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text

First Report of the Root-Knot Nematode, Meloidogyne enterolobii, on Sweet potato in Guangxi Province, China

Plant Disease ◽

10.1094/pdis-08-21-1793-pdn ◽

2021 ◽

Author(s):

Luming Jia ◽

H.Y. Wu

Keyword(s):

Population Density ◽

Species Identification ◽

Sweet Potato ◽

Potato Variety ◽

Rrna Genes ◽

Food Crop ◽

Guangxi Province ◽

Specific Primers ◽

First Report ◽

Meloidogyne Enterolobii

Sweet potato (Ipomoea batatas Lam.) is the seventh most widely cultivated food crop in the world and the sixth most widely cultivated food crop in China. In June 2021, sweet potato plants were found to be displaying nutrient deficiencies with red leaves in a sweet potato field in Hepu County, Beihai City, Guangxi Province (21°37′43.41"N，109°10′58.74"E). Black irregular protuberant scars on tubers and nodular galls on roots were found. Thirty-five sweet potato ‘Variety Guiziweishu No. 1’ tubers were randomly collected and 97% were infected with root-knot nematodes. Females (n = 20) had perineal patterns that were oval, with moderate to high dorsal arches, the lateral field was not obvious or absent. Morphological measurement of females (n = 20) were made from micrographs taken with a microscope (Axio Imager, Z2, ZEISS). Measurements (mean + standard error) were: body length (BL) = 932.8 ± 18.4 μm; maximum body width (BW) = 588.8 ± 22.0 μm; vulval slit length = 19.6 ± 0.6 μm; and, vulval slit to anus distance = 22.3±0.8 μm. Morphological measurements of second-stage juveniles (J2; n = 20) were: BL =512.0± 5.9 μm; BW = 17.4 ± 0.6 μm; Stylet length = 13.4 ± 0.2 μm; dorsal pharyngeal gland orifice to stylet base (DGO) =3.4 ± 0.0 μm; and, hyaline tail length = 17.6 ± 0.5 μm. These morphological characteristics fit those of the original description for Meloidogyne enterolobii (Yang and Eisenback 1983). Molecular analyses were conducted to confirm species identification. Genomic DNA was extracted from 12 single J2 (Luo et al. 2020). The rDNA-internal transcribed spacer (ITS) region was sequenced using primers V5367/26S (5′-TTGATTACGTCCCTGCCCTTT-3′/5′-TTTCACTCGCCGTTACTAAGG-3′) (Vrain et al. 1992), and the D2–D3 fragment of the 28S rRNA genes using primers D2A/D3B (5′-GTACCGTGAGGGAAAGTTG-3′/5′-TCGGAAGGAACCAGCTACTA-3′) (De Ley et al. 1999). The target gene sequences were 733 bp (GenBank accession no. MZ413814) and 733 bp (MZ411468), respectively; they were all 99-100% similar to those of M. enterolobii sequences available in the GenBank. Species identification was also confirmed using PCR to amplify rDNA-IGS2 with M. enterolobii-specific primers Me-F/Me-R (5′-AACTTTTGTGAAAGTGCCGCTG-3′/5′-TCAGTTCAGGCAGGATCAACC-3′). The electrophoresis results showed a bright band (∼200 bp) only in the lane with the M. enterolobii-specific primers, similar in size to that previously reported for M. enterolobii (Long et al. 2006). Therefore, this Meloidogyne sp. population on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. To verify the pathogenicity of nematodes, sweet potato ‘Variety Guiziweishu No. 1’ seedlings were individually planted in 18 cm diameter, 11 cm deep plastic pots containing 1000 cm3 autoclaved sandy soil (sand/soil = 3:1). A total of 15 seedlings were inoculated with 10,000 eggs (the population was same with nematode population in soil the field) and 5 seedlings without eggs were used as a control. Plants were maintained at 25-28°C in a greenhouse. After 2 months, root of inoculated plants exhibited elongated swellings similar to symptoms observed in the field. The noninoculated plants did not have any galls or swelling. A reproduction factor (nematode final population density/initial population density) value of 18.6 was obtained. These results confirmed the nematodes’ pathogenicity. To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in Guangxi Province. In 2014, the nematode on sweet potato was reported in Guangdong Province (Gao et al. 2014). Guangxi Province is the largest producer of sweet potato in south China and is the third top producing region in the whole country. Meloidogyne enterolobii is a potential risk to the production of sweet potato in this region, and control measures are needed to prevent any further spread.

Download Full-text

First Report of Fusarium solani Causing Root Rot on Coptis chinensis in Southwestern China

Plant Disease ◽

10.1094/pdis-02-14-0164-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1273-1273 ◽

Cited By ~ 2

Author(s):

X.-M. Luo ◽

J.-L. Li ◽

J.-Y. Dong ◽

A.-P. Sui ◽

M.-L. Sheng ◽

...

Keyword(s):

Fusarium Solani ◽

Root Rot ◽

Southwestern China ◽

Molecular Characteristics ◽

Distilled Water ◽

Conidial Suspension ◽

Storage Roots ◽

Coptis Chinensis ◽

Causal Organism ◽

First Report

China is the world's largest producer country of coptis (Coptis chinensis), the rhizomes of which are used in traditional Chinese medicine. Since 2008, however, root rot symptoms, including severe necrosis and wilting, have been observed on coptis plants in Chongqing, southwestern China. Of the plants examined from March 2011 to May 2013 in 27 fields, 15 to 30% were covered with black necrotic lesions. The leaves of infected plants showed wilt, necrotic lesions, drying, and death. The fibrous roots, storage roots, and rhizomes exhibited brown discoloration and progressive necrosis that caused mortality of the infected plants. Infected plants were analyzed to identify the causal organism. Discoloration of the internal vascular and cortical tissues of the rhizomes and taproots was also evident. Symptomatic taproots of the diseased coptis were surface sterilized in 1% sodium hypochlorite for 2 min, rinsed in sterile distilled water for 2 min, and then air-dried in sterilized atmosphere/laminar flow. Small pieces of disinfested tissue (0.3 cm in length) were transferred to petri dishes containing potato dextrose agar (PDA) supplemented with 125 μg ml–1 streptomycin sulfate and 100 μg ml–1 ampicillin, and incubated for 5 days at 25°C with a 12-h photoperiod. Four distinct species of fungal isolates (HL1 to 4) derived from single spores were isolated from 30 plants with root rot symptoms collected from the study sites. To verify the pathogenicity of individual isolates, healthy coptis plants were inoculated by dipping roots into a conidial suspension (106 conidia/ml) for 30 min (15 plants per isolate), as described previously (1). Inoculated plants were potted in a mixture of sterilized quartz sand-vermiculite-perlite (4:2:1, v/v) and incubated at 25/18°C and 85 to 90% relative humidity (day/night) in a growth chamber with a daily 16-h photoperiod of fluorescent light. Plants dipped in sterile distilled water were used as controls. After 15 days, symptoms similar to those observed in the field were observed on all plants (n = 15) that were inoculated with HL1, but symptoms were not observed on plants inoculated with HL2, HL3, and HL4, nor on control plants. HL1 was re-isolated from symptomatic plants but not from any other plants. Morphological characterization of HL1 was performed by microscopic examination. The septate hyphae, blunt microconidia (2 to 3 septa) in the foot cell and slightly curved microconidia in the apical cell, and chlamydospores were consistent with descriptions of Fusarium solani (2). The pathogen was confirmed to be F. solani by amplification and sequencing of the ribosomal DNA internal transcribed spacer (rDNA-ITS) using the universal primer pair ITS4 and ITS5. Sequencing of the PCR product revealed a 99 to 100% similarity with the ITS sequences of F. solani in GenBank (JQ724444.1 and EU273504.1). Phylogenetic analysis (MEGA 5.1) using the neighbor-joining algorithm placed the HL1 isolate in a well-supported cluster (97% bootstrap value based on 1,000 replicates) with JQ724444.1 and EU273504.1. The pathogen was thus identified as F. solani based on its morphological and molecular characteristics. To our knowledge, this is the first report of root rot of coptis caused by F. solani in the world. References: (1) K. Dobinson et al. Can. J. Plant Pathol. 18:55, 1996. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Oxford, 2006.

Download Full-text

First Report of Xanthomonas arboricola pv. pruni Causing Leaf and Fruit Spot on Apricot (Prunus armeniaca L.) in Montenegro

Plant Disease ◽

10.1094/pdis-01-21-0161-pdn ◽

2021 ◽

Author(s):

Tamara Popović ◽

Jelena Menković ◽

Andjelka Prokić ◽

Aleksa Obradoviċ

Keyword(s):

Dna Sequences ◽

Prunus Armeniaca ◽

Bacterial Suspension ◽

Molecular Characteristics ◽

Strictly Aerobic ◽

Distilled Water ◽

First Report ◽

Fruit Spot ◽

Prunus Armeniaca L ◽

Xanthomonas Arboricola

In July 2020, symptoms of leaf and fruit spot were observed on two-year old apricot plants (Prunus armeniaca L.), cultivar Rubista in plantation covering approximately 0,5 ha near Podgorica, central Montenegro. The intensity of infection on leaves was more than 70%. Initially, leaf spots were mainly circular, 2 to 5 mm in diameter, water-soaked, surrounded by a weak chlorotic halo, but later became light to dark brown and necrotic. Eventually, the spots merged and necrotic tissue dropped out, leaving a “shot-hole” leaf appearance. On apricot fruits small, dark brown, mainly circular superficial lesions were observed. The lesions merged and formed large necrotic areas reducing the quality of fruits. Symptoms were not observed on woody parts, such as twigs or stem. A total of 10 bacterial strains, forming yellow, convex, and mucoid colonies on yeast extract–dextrose–CaCO3 (YDC) medium, were isolated from symptomatic leaf and fruit tissue. All strains induced hypersensitive reaction in tobacco leaves. They were Gram-negative, strictly aerobic, oxidase negative, catalase positive, hydrolyzed gelatine and esculin but not starch, and did not grow at 37°C, showing similar biochemical properties as a reference strain Xanthomonas arboricola pv. pruni (Xap) (NCPPB 416) used in all tests as a positive control. Strains were further identified by PCR analysis, using primer pair XapY17-F/XapY17-R (Pagani 2004; Pothier et al. 2011), resulting in a single band of 943 bp, characteristic for Xap. Additionally, BOX-PCR with the BOX A1R primer (Schaad et al. 2001) showed 100% homology in genetic profiles of all tested strains and control strain. Amplification and partial sequencing of the gyrB gene of four representative strains was performed using set of primers described by Parkinson et al. (2007). Obtained DNA sequences showed that analysed strains (GenBank nos. MW473770, MW473771, MW473772, and MW473773) share 99.44 to 99.57% of gyrB sequence identity with Xap pathotype strain ICMP51. Pathogenicity of all strains was confirmed by spraying young apricot shoots using a hand-held sprayer, and by infiltration of apricot leaves (cv. Roksana) from the abaxial surface using a syringe without needle, with the bacterial suspension (107 CFU/ml in sterile distilled water), in three replicates. Sterile distilled water and reference Xap strain (NCPPB 416), were used as negative and positive controls, respectively. The inoculated shoots and leaves were maintained at approx. 25°C and high humidity conditions. Tissue necrosis appeared on all inoculated shoots 5 to 11 days and leaves 5 to 9 days after inoculation. Koch’s postulates were completed by re-isolation of the pathogen from inoculated tissue and identification by PCR using XapY17-F/XapY17-R primers. Based on pathogenic, biochemical and molecular characteristics, the strains isolated from apricot leaves and fruits in Montenegro were identified as Xap - causal agent of bacterial leaf spot and canker of stone fruits. This quarantine pathogen was previously reported on almond (Panić et al. 1998) and on peach (Popović et al. 2020) in Montenegro. This is the first report of Xap affecting apricot in this country. Therefore, strict phytosanitary measures have to be implemented to prevent spread of the pathogen in other areas and other susceptible hosts.

Download Full-text

First Report of the Occurrence of Sweet potato leaf curl virus in Tall Morningglory (Ipomoea purpurea) in China

Plant Disease ◽

10.1094/pdis-93-7-0764b ◽

2009 ◽

Vol 93 (7) ◽

pp. 764-764 ◽

Cited By ~ 9

Author(s):

C. X. Yang ◽

Z. J. Wu ◽

L. H. Xie

Keyword(s):

Sweet Potato ◽

Dna Sequences ◽

Ipomoea Batatas ◽

Rolling Circle Amplification ◽

The United States ◽

Natural Occurrence ◽

Potato Leaf ◽

First Report ◽

Leaf Curl Virus ◽

Leaf Curl

Natural occurrence of Sweet potato leaf curl virus (SPLCV) has been reported in Ipomoea batatas (sweet potato, Convolvulaceae) or I. indica (Convolvulaceae) in several countries including the United States, Sicily, and China (1–3). In September of 2007, while collecting samples showing begomovirus-like symptoms in the Chinese province of Fujian, we observed tall morningglory (I. purpurea (L.) Roth, also known as Pharbitis purpurea (L.) Voigt), plants with slightly yellow mosaic and crinkled leaves. Total DNA was extracted from leaves of these plants and tested by rolling circle amplification (4). Amplification products were digested by the restriction enzyme BamHI for 30 min. Restriction products (2.8 kb) were then cloned into pMD18T vector (Takara Biotechnology, China) and sequenced. Comparison of complete DNA sequences by Clustal V analysis revealed that these samples were infected by the same virus, and an isolate denoted F-p1 was selected for further sequence analysis. F-p1 was 2,828 nucleotides, with the typical genomic organization of begomoviral DNA-A (GenBank Accession No. FJ515896). F-p1 was compared with the DNA sequences available in the NCBI database using BLAST. The whole DNA sequence showed the highest nucleotide sequence identity (92.1%) with an isolate of SPLCV (GenBank Accession No. FJ176701) from Jiangsu Province of China. The result confirmed that the samples from the symptomatic tall morningglory were infected by SPLCV. To our knowledge, this is the first report of the natural occurrence of SPLCV in I. purpurea, a common weed species in China. References: (1). P. Lotrakul et al. Plant Dis. 82:1253, 1998. (2). R. W. Briddon et al. Plant Pathol. 55:286, 2006. (3) Y. S. Luan et al. Virus Genes 35:379, 2007. (4) D. Haible et al. J. Virol. Methods 135:9, 2006.

Download Full-text

First Report of Colletotrichum truncatum Causing Anthracnose on Oxalis corniculata in China

Plant Disease ◽

10.1094/pdis-10-21-2170-pdn ◽

2022 ◽

Author(s):

Huizheng Wang ◽

Jinye Gao ◽

Yang Zhao ◽

Minghong Fan ◽

Wei He ◽

...

Keyword(s):

Relative Humidity ◽

Dna Sequences ◽

Disease Incidence ◽

Shandong Province ◽

Molecular Characteristics ◽

Morphological Identification ◽

Pathogenicity Test ◽

Colletotrichum Truncatum ◽

First Report ◽

Negative Controls

Oxalis corniculata L., which belongs to the family Oxalidaceae R. Br., is a very common perennial herb. It is usually planted on bare land or under the forest as landscaping plants, and the whole plant can be used for its medicinal values of clearing heat, detoxification and detumescence. In August 2019, typical symptoms of anthracnose on O. corniculata leaves were observed in the green belt on the campus of Shandong University of Technology (36.81°N, 117.99°E), Shandong Province, China. The disease incidence was above 40% by investigating more than 300 m2 of planting area. Most of O. corniculata are planted under the forest where the disease is found, mainly in the environment with high relative humidity and less ventilation. The infected leaves appeared initially as tawny oval or irregular spots, and then the lesions enlarged gradually until the leaves became dieback or wholly withered, which greatly reduced the landscape effect of O. corniculata. Diseased leaves were collected by cutting into small pieces and sterilized with 75% ethanol for 30 s and 2% sodium hypochlorite (NaClO) for 60 s, rinsed with sterile deionized water for three times. Each air-dried tissue segment was cultured on potato dextrose agar (PDA) and incubated at 25℃ for 5 to 7 days in the dark (Zhu et al. 2013). Fifteen isolates were obtained from 20 symptomatic leaves and the cultures were initially gray white, subsequently became grayish to dark green after 7 days, with copious gray aerial mycelium and black microsclerotia. Three isolates were verified by the amplification of DNA sequences of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), actin (ACT), histone H3 (H3) and chitin synthase (CHS1) genes, using the primer pairs GDF1/GDR1, ACT-512F/ACT-783R, CYLH3F/CYLH3R, and CHS-79F/CHS-234R (Damn et al. 2019, Fu et al. 2019, Liu et al. 2013), respectively. The sequenced genes (GenBank accession no. OK017473, OK159078, OK159076, OK159077) shared 99.62 to 100.00% nucleotide identity with the corresponding genes of Colletotrichum truncatum strain UASB-Cc-10 (GenBank accession no. KF322064.1, KF322055.1, KF322073.1, KF319059.1), respectively, which was consistent with the morphological identification (Sawant et al. 2012). Pathogenicity test was performed with six healthy O. corniculata plants infected with mycelial plugs (about 3 mm in diameter) of three C. truncatum isolates from a 5-day-old culture, while the negative controls on the same leaves were inoculated with sterile PDA plugs. All plants were placed in a greenhouse at 25 to 30℃ with 90% relative humidity. The experiment was conducted three times. Five days later, all inoculated leaves appeared brown sunken spots, whereas no symptoms appeared on negative controls. The same pathogens, C. truncatum, were identified from the inoculated leaves on the basis of morphological and molecular characteristics as described above, confirming Koch’s postulates. To our knowledge, anthracnose caused by C. truncatum on O. corniculata is the first report in China. The discovery of this new disease is beneficial to the application and protection of O. corniculata, a popular landscape and medicinal plant. References: Damn, U., et al. 2019. Stud. Mycol. 92:1. https://doi.org/10.1016/j.simyco.2018.04.001 Fu, M., et al. 2019. Persoonia 42:1. https://doi.org/10.3767/persoonia.2019.42.01 Liu, F., et al. 2013. Mycologia 105:844. https://doi.org/10.3852/12-315 Sawant, I. S., et al. 2012. New Dis. Rep. 25:2. https://doi.org/10.5197/j.2044-0588.2012.025.002 Zhu, L., et al. 2013. J. Phytopathol. 161:59. https://doi.org/10.1111/jph.12019 The author(s) declare no conflict of interest. Acknowledgments: This research was financially supported by the Top Talents Program for One Case One Discussion of Shandong Province and Academy of Ecological Unmanned Farm (2019ZBXC200).

Download Full-text

First Report of the Root-Knot Nematode Meloidogyne ethiopica on Tomato and Cucumber in Turkey

Plant Disease ◽

10.1094/pdis-01-13-0019-pdn ◽

2013 ◽

Vol 97 (9) ◽

pp. 1262-1262 ◽

Cited By ~ 13

Author(s):

G. Aydınlı ◽

S. Mennan ◽

Z. Devran ◽

S. Širca ◽

G. Urek

Keyword(s):

Species Identification ◽

Dna Sequences ◽

Higher Plants ◽

Phylogenetic Analyses ◽

Egg Laying ◽

Correct Identification ◽

Root Knot Nematode ◽

First Report ◽

Meloidogyne Ethiopica ◽

Meloidogyne Sp

The root-knot nematode Meloidogyne ethiopica Whitehead, mainly reported from African countries, was first described in 1968 in Tanzania (4). It was further detected in South America (Brazil, Chile, and Peru) (2). In 2004, M. ethiopica was recorded for the first time in Europe on tomato (3) and later in field soil samples from maize (Zea mays L.) and kiwi [Actinidia deliciosa (A. Chev.) C. F. Liang & A. R. Ferguson] collected in the area of Kavalla in North Greece (1). M. ethiopica was included on the EPPO alert list of harmful organisms in 2011. In summer 2009, severe stunting, leaf wilting, and extensive root galling of a presumed root-knot nematode (Meloidogyne sp.) were detected during a routine survey for root nematodes attacking tomato (Solanum lycopersicum L.) crops from two greenhouses in the campus of University of Ondokuz Mayis and attacking cucumber (Cucumis sativus L.) crops from commercial greenhouses in Çarsamba district of Samsun Province, Turkey. Perineal patterns of Meloidogyne sp. females collected from infested roots were variable, with moderately high to high dorsal arch, lateral line mostly indistinct and striae usually wavy, which is very similar to that seen in M. incognita Kofoid & White. Such variability among perineal patterns precluded its accurate identification. For further species identification, protein extracted from young egg-laying females were resolved in 3% stacking (pH 6.8) and 7% separating (pH 8.8) polyacrylamide gel with Tris-glycine buffer. The gels were stained with α-naphthyl acetate substrate for esterase activity (1). The esterase phenotypes exhibited a three banded pattern, E3, that was identical to M. ethiopica. Therefore, esterase studies were repeated including nematodes from M. ethiopica culture from Slovenia used as a reference. In addition, small subunit rDNA sequence analyses were performed to complete species identification. DNA sequences of a 1.6-kb rDNA fragment were generated using two sets of primers (1) and deposited in the NCBI GenBank with the accession number KC551945. The sequence was compared to the corresponding fragments of M. ethiopica and closely related species from the NCBI GenBank. DNA sequence of M. ethiopica from Turkey exhibited the highest identity of 99.8% to the sequence FJ559408 of M. ethiopica from Slovenia. Sequences KC551945, FJ559408, AY942630, and JQ768373 of M. ethiopica from Turkey, Slovenia, Brazil, and Greece, respectively, clustered together and formed a separate clade using phylogenetic analyses. This species may pose a threat for vegetable production in Turkey since it has a wide host range infesting numerous higher plants including monocotyledons, dicotyledons, herbaceous, and woody plants. Furthermore, M. ethiopica may have been present in Turkey for many years because correct identification based only on perineal pattern is difficult. Thus, misidentification might have been possible. The distribution of this nematode in more extensive vegetable fields should be determined. To our knowledge, this is the first report of M. ethiopica in Turkey and the third finding of this species in Europe. References: (1) I. L. Conceição et al. Eur. J. Plant Pathol. 134:451, 2012. (2) S. N. Murga-Gutierrez et al. Nematropica. 42:57, 2012. (3) S. Širca et al. Plant Disease. 88:680, 2004. (4) A. G. Whitehead. Nematology. 15:315, 1969.

Download Full-text

Effect of Homeopathic Preparations on Lettuce, Parasitized or Not by Meloidogyne enterolobii

Homeopathy ◽

10.1055/s-0040-1716402 ◽

2020 ◽

Author(s):

Thais Moraes Ferreira ◽

Mariana Zandomênico Mangeiro ◽

Alexandre Macedo Almeida ◽

Ricardo Moreira Souza

Keyword(s):

Plant Pathogens ◽

Nematode Control ◽

Plant Tolerance ◽

Nematode Reproduction ◽

Meloidogyne Enterolobii ◽

Negative Effect ◽

Meloidogyne Spp ◽

Constant Dose ◽

Lettuce Growth ◽

Complementary Strategy

Abstract Background There are relatively few scientific works on the use of homeopathy to manage plant pathogens, particularly nematodes. A handful of studies focused on Meloidogyne spp. parasitizing vegetables have brought contradictory results on nematode control and enhancement of plant tolerance to parasitism. Objective Our goal was to assess the effect of Cina—a well-known anti-nematode ingredient—on Meloidogyne enterolobii parasitizing lettuce. Methods Cina was applied daily on nematode-inoculated plants, from the seedling stage until harvest. We tested an evenly spaced range of Hahnemannian concentrations (c), which were applied though irrigation with a constant dose of the ingredient. Several absolute and relative controls were employed to allow the assessment of the effect of Cina on nematode reproduction and lettuce growth. Results Cina affected growth of non-parasitized plants, both positively and negatively; this effect was modulated by the c applied and the thermal stress suffered by the plants in one of the assays. The effect of Cina on the growth of nematode-parasitized plants was neutral or negative. Cina reduced nematode reproduction by 25–36%. Conclusion Based on the moderate negative effect of Cina on M. enterolobii reproduction, it seems this ingredient may be useful as a complementary strategy for Meloidogyne control. But Cina did not enhance the tolerance of lettuce to Meloidogyne spp.

Download Full-text

An integrative redescription of Hypsibius dujardini (Doyère, 1840), the nominal taxon for Hypsibioidea (Tardigrada: Eutardigrada)

Zootaxa ◽

10.11646/zootaxa.4415.1.2 ◽

2018 ◽

Vol 4415 (1) ◽

pp. 45 ◽

Cited By ~ 41

Author(s):

PIOTR GĄSIOREK ◽

DANIEL STEC ◽

WITOLD MOREK ◽

ŁUKASZ MICHALCZYK

Keyword(s):

Dna Sequences ◽

Evolutionary Biology ◽

Model Organism ◽

Laboratory Strain ◽

Sensu Stricto ◽

Nominal Species ◽

28S Rrna ◽

The Family ◽

The 19Th Century ◽

Hypsibius Dujardini

A laboratory strain identified as “Hypsibius dujardini” is one of the best studied tardigrade strains: it is widely used as a model organism in a variety of research projects, ranging from developmental and evolutionary biology through physiology and anatomy to astrobiology. Hypsibius dujardini, originally described from the Île-de-France by Doyère in the first half of the 19th century, is now the nominal species for the superfamily Hypsibioidea. The species was traditionally considered cosmopolitan despite the fact that insufficient, old and sometimes contradictory descriptions and records prevented adequate delineations of similar Hypsibius species. As a consequence, H. dujardini appeared to occur globally, from Norway to Samoa. In this paper, we provide the first integrated taxonomic redescription of H. dujardini. In addition to classic imaging by light microscopy and a comprehensive morphometric dataset, we present scanning electron photomicrographs, and DNA sequences for three nuclear markers (18S rRNA, 28S rRNA, ITS-2) and one mitochondrial marker (COI) that are characterised by various mutation rates. The results of our study reveal that a commercially available strain that is maintained in many laboratories throughout the world, and assumed to represent H. dujardini sensu stricto, represents, in fact, a new species: H. exemplaris sp. nov. Redescribing the nominal taxon for Hypsibiidae, we also redefine the family and amend the definitions of the subfamily Hypsibiinae and the genus Hypsibius. Moreover, we transfer H. arcticus (Murray, 1907) and Hypsibius conifer Mihelčič, 1938 to the genus Ramazzottius since the species exhibit claws and eggs of the Ramazzottius type. Finally, we designate H. fuhrmanni as subjectively invalid because the extremely poor description precludes identifying neotype material.

Download Full-text

Species-specific duplex PCR for the detection of Pratylenchus penetrans

Nematology ◽

10.1163/156854109x428016 ◽

2009 ◽

Vol 11 (6) ◽

pp. 847-857 ◽

Cited By ~ 21

Author(s):

Lieven Waeyenberge ◽

Nicole Viaene ◽

Maurice Moens

Keyword(s):

Internal Control ◽

Dna Sequences ◽

Rrna Gene ◽

Duplex Pcr ◽

Specific Primers ◽

5.8S Rrna Gene ◽

5.8S Rrna ◽

Wide Range ◽

Pcr Products ◽

Species Specific

Abstract ITS1, the 5.8S rRNA gene and ITS2 of the rDNA region were sequenced from 20 different Pratylenchus species. Additionally, the same region was sequenced from seven populations of P. penetrans. After purifying, cloning and sequencing the PCR products, all sequences were aligned in order to find unique sites suitable for the design of species-specific primers for P. penetrans. Since ITS regions showed variability between and even within populations of P. penetrans, only three small DNA sequences were suitable for the construction of three potentially useful species-specific primers. New species-specific primers were paired with existing universal ITS primers and tested in all possible primer combinations. The best performing primer set, supplemented with a universal 28S rDNA primer set that served as an internal control, was tested in duplex PCR. The ideal annealing temperature, Mg2+ concentration and primer ratios were then determined for the most promising primer set. The optimised duplex PCR was subsequently tested on a wide range of different Pratylenchus spp. and 25 P. penetrans populations originating from all over the world. To test the sensitivity, the duplex PCR was conducted on DNA extracted from a single P. penetrans nematode mixed with varying amounts of nematodes belonging to another Pratylenchus species. Results showed that a reliable and sensitive P. penetrans species-specific duplex PCR was constructed.

Download Full-text