Searching of Conserved Motifs within a Partial secA Gene Sequence of Phytoplasma Associated with Root (Wilt) Disease of Coconut (Cocos nucifera) in India: Using a Frequency Based Approach

Author(s):  
Sandip Shil ◽  
Kishore K. Das ◽  
Anamika Dutta
Author(s):  
Ali M. Al-Subhi ◽  
Saskia Hogenhout ◽  
Rashid Abdullah Al-Yahyai ◽  
Aisha Gharib Al-Ghaithi ◽  
Abdullah Mohammed Al-Sadi

1989 ◽  
Vol 94 (4) ◽  
pp. 191-194 ◽  
Author(s):  
M. Sasikala ◽  
K. Mathen ◽  
M. P. Govindankutty ◽  
J. J. Solomon ◽  
L. Geetha

2011 ◽  
Vol 282-283 ◽  
pp. 526-530
Author(s):  
Xing Jiang ◽  
Fu An Wu ◽  
Shui Qin Fang ◽  
Yan Dong Zhang ◽  
Jun Wang ◽  
...  

To identify the pathogen of Mulberry wilt disease, a tested strain WJ-1 was isolated from a naturally infected mulberry in Guangzhou, Guangdong province, P. R. China. Hypersensitive reaction, along with Koch’s postulates, morphological, biochemical and physiological characterization, light microscope observation and molecular identification were performed on WJ-1. The results indicated that WJ-1 was a Gram-negative, short-rod shaped bacterium. Based on morphology and the 16S rRNA gene sequence analysis, WJ-1 strain was identified as members of the genusEnterobacter. The phylogenetic tree revealed that WJ-1 shared the highest homology withEnterobacter cloacaestrain M5. It was another evidence on plant disease caused byEnterobacterspecies. We found thatEnterobacterspecies could cause mulberry wilt disease in Guangzhou.


Plant Disease ◽  
2021 ◽  
Author(s):  
Fabian Pilet ◽  
Emilson Rakotoarisoa ◽  
M. R. Rakotomalala ◽  
Sabine Sisteron ◽  
Harisoa Nirina Razakamanana ◽  
...  

Madagascar is a high diversity hotspot in the world, and palms are highly represented with nearly 200 endemic species (Rakotoarinivo et al., 2014). Coconut tree (Cocos nucifera) could have been introduced in Madagascar by Austronesians around AD 400 or 700 (Beaujard, 2011). Sporadic coconut trees showing very severe wilt were observed in 2016 in three localities of the western and northern coast of the island: Katsepy (Sample MG16-001), Antsohyhi (MG16-004 and MG16-005) and Ambaritsatrana (MG16-010). Symptoms correspond on a severe ascendant wilt of the leaves, associated with necrosis of the inflorescences and absence of nuts and death of all trees was confirmed eventually. We investigated the implication of phytoplasma because of the apparent similarity in the symptomatology with Coconut Lethal Yellowing Disease and Coconut Lethal Decline occurring in East Africa (Mpunami et al., 1999), and because the western coast of Madagascar faces the Mozambican channel only 400 km apart from areas along the East African coast where those two diseases occur. Symptomatic (n=4) and asymptomatic (n=6) coconut trees were sampled by stem drilling. DNA was extracted from sawdust samples using a modified CTAB protocol (Mpunami et al., 1999). A direct polymerase chain reaction (PCR) targeting the 16S rRNA gene plus Internal transcribed spacer with the P1-1T (AAGAGTTTGATCCTGGCTCAGGAT)/P7 primers (Schneider et al., 1998) amplified a product of about 1.8 kb for MG16-001 and MG16-005 samples only, while the four DNA extracts from symptomatic trees showed a 1.2 kb amplicon by nested PCR using R16F2n/R16R2 primer pairs in the second round (Lee et al., 1998). Amplification of the secA gene using the primer pair secAFor1/secARev3 (Hodgetts et al., 2008) was performed in a single round and gave a product of 850 bp exclusively for the symptomatic tree DNAs. All amplicons were double strand sequenced (Genewiz, UK). Corresponding high quality sequences were deposited in GenBank and submitted to Blastn on NCBI. The partial 16S rRNA gene sequences (accessions MN264629 to MN264632) obtained using R16F2n/R16R2 primers presented the highest similarity (from 99.47 to 99.56%) to the reference sequence for the phytoplasma associated with the Tanzanian Lethal Decline (GenBank accession X80117). This genetic proximity of the Malagasy strains was confirmed by the partial secA gene sequences (accessions MN267853 to MN267856) presenting the highest similarity (from 89.92 to 90.70%) to the Tanzanian Lethal Decline phytoplasma secA gene partial sequence (Genbank accession KJ462071). Full-length 16S rRNA gene sequences of MG16-001 and MG16-005 strains (accessions MN388765 and MN388766) were submitted to iPhyClassifier virtual RFLP tool (Zhao et al., 2009). The iPhyClassifier tool confirmed that Malagasy strains are related to the reference strain X80117 but belong to a different 16Sr subgroup (similarity coefficient from 0.90 to 0.93, Dev. 1). Both Malagassy strains and LDT phytoplasma should be assigned to a new 16Sr group since X80117 is itself erroneously assigned to 16SrIV group while the closest reference sequence AF509322, 16SrXXIV-A, shared only a similarity of 0.83 (Dev. 1). Occurrence of a phytoplasma associated with a lethal yellowing type syndrome in Madagascar could represent a dangerous threat to coconut crops that play an important socio-economic role in the coastal areas, but also to the many endemic palm species already on high extinction risk.


Author(s):  
V. K. Chaturvedi ◽  
G. Rajeev ◽  
C. K. Nampoothiri

<div><p><em>Root (wilt) disease (RWD), caused by phytoplasma, is a major problem causing decreased coconut productivity in southern districts of Kerala and its bordering districts of Tamil Nadu in India.  The disease is non-curable but its incidence can be reduced by propagating seedlings from nuts of disease free palms. The disease free palms are selected by ELISA test which uses antiserum obtained from rabbits against  purified phytoplasma extract containing 29, 28 and 18.5 K Da proteins.   With an objective of developing a simpler  and easier biochemical test than ELISA for RWD detection in coconut , direct SDS PAGE profiles of  soluble proteins from crude leaf extracts of healthy and diseased palms of West Coast Tall (susceptible) ,  Chowghat Green Dwarf and Malayan Green Dwarf (high degree resistant) cultivars were evaluated</em> <em>for differences in intensities of  protein bands with molecular masses corresponding closest to the purified phytoplasma extract proteins. It was found that the 31.2, 37.3, 16.9 and 13.8 KDa bands in WCT cultivar, 31 and 40.6 KDa in CGD cultivar and 29.9 and 37.1 KDa bands in the MGD cultivar showed consistent differences in intensities and/or presence or absence of certain bands between healthy and diseased palms.  Correlations and path analysis relationship between intensity of different protein bands and ELISA value also showed significant association of one or two of these marker bands with ELISA values in each cultivar.  The</em> <em>SDS PAGE profiles of crude leaf extracts could be used to effectively distinguish healthy and diseased RWD palms in these three cultivars.</em><strong></strong></p></div>


2020 ◽  
Vol 87 (1) ◽  
pp. 16-23
Author(s):  
Merin Babu ◽  
S. Thangeswari ◽  
A. Josephrajkumar ◽  
V. Krishnakumar ◽  
A. Karthikeyan ◽  
...  

Plant Disease ◽  
2020 ◽  
Author(s):  
Shao-shuai Yu ◽  
Qinghua Tang ◽  
Yuan Wu ◽  
Rui-ling Zhao ◽  
Wei wei Song ◽  
...  

Pericampylus glaucus is an important medicinal plant resource containing active components with potential antitumor activity in China (Zhao & Cui, 2009). During July through August 2020, plants displayed disease symptoms including “witches’ broom”, leaf chlorosis, leaflet and internode shortening that impacted their growth (Fig. 1). These plants were first found in Dingan county of Hainan province, China. Total DNA from 12 plants were extracted using 0.10 g fresh plant leaves based on CTAB method. After amplification using primers specific for phytoplasma 16S rRNA, tuf and secA gene targets, R16mF2R16mR1 (Lee et al, 1993), fTuf1/rTuf1 (Schneider et al., 1997) and secAfor1/secArev3 (Hodgetts et al., 2008), the target bands of the three gene fragments of phytoplasma were detected in the disease sample DNA from six disease plants, and not in the healthy sample DNA from six healthy plants. Nucleotide sequences of the three genes were obtained from the PCR products sequencing and analyzed by DNAMAN 5.0 software. The three gene fragments of the DNA extracted from the disease samples were identical, with length of 1334 bp 16S rRNA (GenBank accession: MT872515), 989 bp tuf (MT755960) and 750 bp secA (MT755961) gene fragments, putatively encoding 329 (tuf) and 249 (secA) amino acids sequence separately. The phytoplasma strain was named as Pericampylus glaucus witches’-broom (PgWB) phytoplasma, PgWB-hnda strain, belonging to 16SrI-B subgroup by iPhyClassifier analysis. Homology and phylogenetic analysis indicated that based on 16S rRNA gene fragments, PgWB-hnda, pepper yellow crinkle phytoplasma PYC-hnhk (MT760793), chinaberry witches’-broom phytoplasma CWB-hnsy1 (KP662119) and CWB-hn (EF990733), periwinkle virescence phytoplasma PeV-hnhk (KP662136), with 100.0 % identity value, arecanut yellow leaf phytoplasma AYL-hnwn (FJ998269) and AYL-hn (FJ694685), with 99.8 % identity value, were clustered into one clade. Based on the analysis of tuf gene sequence fragments, PgWB was closely related to PYC-hnhk (MT755960), CWB-hnsy1 (KP662155), PeV-hnhk (KP662172) with 99.9 % identity value. Based on the analysis of secA gene sequence fragments, PgWB was closely related to CWB-hnsy1 (KP662173) with 99.7 % identity value, PYC-hnhk (MT755961), PeV-hnhk (KP662190) with 99.4 % identity value. To our knowledge, this is the first time that Pericampylus glaucus witches’-broom disease caused by 16SrI-B subgroup phytoplasma strain was found in China. Multilocus sequence analysis showed that PgWB was closely related to the phytoplasma strains causing pepper yellow crinkle, chinaberry witches’-broom, periwinkle virescence and areca palm yellow leaf diseases, all occurred in Hainan Island of China.


Sign in / Sign up

Export Citation Format

Share Document