First report on the association of ‘Candidatus Phytoplasma asteris’ with lethal wilt disease of coconut (Cocos nucifera L.) in India

A new species of cixiid planthopper (Hemiptera: Fulgoroidea) in the genus Oecleus Stål, Oecleus mackaspringi sp. n., is described from Spring Garden, Jamaica. This new taxon is associated with coconut palm (Cocos nucifera L.) and was found while surveying palm plots with active cases of lethal yellowing (LY). This is the first report of the genus Oecleus from Jamaica. Sequence data for the COI gene and 18S gene are also provided.

Download Full-text

Detection of Root (Wilt) Disease of Coconut (Cocos nucifera L.) based on polyacrylamide gel electrophoresis

IRA-International Journal of Applied Sciences (ISSN 2455-4499) ◽

10.21013/jas.v3.n3.p1 ◽

2016 ◽

Vol 3 (3) ◽

Author(s):

V. K. Chaturvedi ◽

G. Rajeev ◽

C. K. Nampoothiri

Keyword(s):

Tamil Nadu ◽

Cocos Nucifera ◽

Polyacrylamide Gel Electrophoresis ◽

Elisa Test ◽

Wilt Disease ◽

Leaf Extracts ◽

Sds Page ◽

Cocos Nucifera L ◽

High Degree ◽

Disease Free

<div>Root (wilt) disease (RWD), caused by phytoplasma, is a major problem causing decreased coconut productivity in southern districts of Kerala and its bordering districts of Tamil Nadu in India. The disease is non-curable but its incidence can be reduced by propagating seedlings from nuts of disease free palms. The disease free palms are selected by ELISA test which uses antiserum obtained from rabbits against purified phytoplasma extract containing 29, 28 and 18.5 K Da proteins. With an objective of developing a simpler and easier biochemical test than ELISA for RWD detection in coconut , direct SDS PAGE profiles of soluble proteins from crude leaf extracts of healthy and diseased palms of West Coast Tall (susceptible) , Chowghat Green Dwarf and Malayan Green Dwarf (high degree resistant) cultivars were evaluated for differences in intensities of protein bands with molecular masses corresponding closest to the purified phytoplasma extract proteins. It was found that the 31.2, 37.3, 16.9 and 13.8 KDa bands in WCT cultivar, 31 and 40.6 KDa in CGD cultivar and 29.9 and 37.1 KDa bands in the MGD cultivar showed consistent differences in intensities and/or presence or absence of certain bands between healthy and diseased palms. Correlations and path analysis relationship between intensity of different protein bands and ELISA value also showed significant association of one or two of these marker bands with ELISA values in each cultivar. The SDS PAGE profiles of crude leaf extracts could be used to effectively distinguish healthy and diseased RWD palms in these three cultivars.</div>

Download Full-text

First Report of Lethal Yellowing Group (16Sr IV) of Phytoplasmas in Vernonia cinerea in Jamaica

Plant Disease ◽

10.1094/pdis-92-7-1132a ◽

2008 ◽

Vol 92 (7) ◽

pp. 1132-1132 ◽

Cited By ~ 5

Author(s):

S. E. Brown ◽

B. O. Been ◽

W. A. McLaughlin

Keyword(s):

Cocos Nucifera ◽

Coconut Palm ◽

Weed Species ◽

First Report ◽

Representative Sequence ◽

Pcr Products ◽

Lethal Yellowing ◽

Vector Identity ◽

Cocos Nucifera L ◽

Vernonia Cinerea

Coconut lethal yellowing disease (CLY) has had a devastating effect on the coconut (Cocos nucifera L.) industry in Jamaica and Latin America. A study was conducted in Jamaica during 2005 to identify alternate hosts of the CLY phytoplasma. Since weeds are known to act as reservoir hosts of numerous pathogens, Vernonia cinerea (L.) (Asteraceae), a prevalent weed species on coconut farms island-wide, was collected from coconut farms in areas of high and low levels of CLY incidence, although none of the plants displayed disease symptoms. DNA was extracted from plant samples by the method of Dellaporta et al. (1) and analyzed by nested PCR assay employing phytoplasma universal rRNA operon primers P1/P7 (2,4) and LY16Sf/LY16-23Sr (3). DNA derived from CLY-diseased or healthy coconut palm served as positive and negative controls, respectively, in each assay. Amplification of an rDNA product of the expected size (1.7 kb) confirmed phytoplasma infections in 53 of 118 (44.9%) V. cinerea test plants. Twenty-seven of the rDNA PCR products were analyzed by digestion with restriction enducleases RsaI, MspI, MseI, TaqI, HinfI, and HhaI. The restriction fragment length polymorphism profiles obtained were similar to that observed in the CLY-infected coconut palm. V. cinerea rDNA amplicons were cloned and sequenced (in both directions) and a representative sequence was deposited in GenBank (Accession No. EU057983). Blast analysis determined this sequence to be most similar (99%) to that of CLY phytoplasma in Jamaica (Accession No. AF49807) and Florida (Accession No. AF498309). To our knowledge, this is the first report of the 16Sr IV group of phytoplasmas infecting V. cinerea. Presence of the lethal yellowing phytoplasmas in dicotyledonous plant species has important epidemiological implications concerning vector identity and ecology. Futhermore, it is now evident that weed control on coconut farms could assist in the management of CLY disease in Jamaica. References: (1) S. L. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1993. (2) S. Deng and C. Hiruki. J. Microbiol. Methods 14:53, 1991. (3) N. A. Harrison et al. Ann. Appl. Biol. 141:183, 2002. (4) C. D. Smart et al. Appl. Environ. Microbiol. 62:2988, 1996.

Download Full-text

First Report of Fruit Basal Rot by Ceratocystis paradoxa on Coconut in Taiwan

Plant Disease ◽

10.1094/pdis-94-4-0487c ◽

2010 ◽

Vol 94 (4) ◽

pp. 487-487 ◽

Cited By ~ 1

Author(s):

S. J. Tzeng ◽

E. J. Sun ◽

W. W. Hsiao

Keyword(s):

Sequence Similarity ◽

Cocos Nucifera ◽

Its Region ◽

Hyphal Growth ◽

Pathogenic Fungi ◽

Fruit Rot ◽

Commonwealth Mycological Institute ◽

First Report ◽

Cocos Nucifera L ◽

Ceratocystis Paradoxa

Since 2005, coconut fruits (Cocos nucifera L.) harvested from trees in southern Taiwan have shown symptoms of a fruit rot disease. The disease occurs only on harvested coconut fruits and is more serious during warmer seasons. Principal symptoms are blackening of the exocarps, mesocarps, and then the endocarps of coconut fruits from pedicel end or wounds on fruits. A fungus was consistently recovered from diseased fruits. Colonies on potato dextrose agar (PDA) were white, becoming black 1 to 2 days later, with a strong fruity aroma. The fungus produced two asexual spores, including phialospore-type conidia, which were hyaline to mid brown, cylindrical to somewhat oval and thick walled when mature, 8.5 to 16.0 × 4.7 to 6.7 μm, released from phialides measuring 80.0 to 155.0 × 5.0 to 7.8 μm, and chlamydospores, which were oval, black, 13.4 to 25.0 × 8.9 to 12.5 μm, and formed in short chains from specialized hyphal tips. Perithecia were produced after 2 months by mating isolates on coconut exocarp placed on PDA. Perithecia were brown, globose, 280 μm in diameter, with a 1,100-μm long neck. Ascospores generally were ellipsoid, but some were unequally bent, 12 × 3 μm. The temperature for hyphal growth of this fungus was 25 to 30°C, with a growth rate of 3.3 cm per day. It did not grow at temperatures lower than 10°C or higher than 35°C. On the basis of these characteristics, this fungus was identified as Ceratocystis paradoxa (Dade) C. Moreau (anamorph Thielaviopsis paradoxa (de Seynes) Höhn) (1). The internal transcribed spacer (ITS) region of mycelial DNA of two isolates was amplified with ITS5 and ITS4 primers and the PCR products were sequenced (GenBank Accession Nos. GU358207 and GU358206). BLAST analysis of both sequences showed 99% sequence similarity with C. paradoxa strain WIN(M) 925 (Accession No. DQ318203). Two of the isolates (BCRC 34425 and BCRC 34426) were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Twenty-four detached healthy coconut fruits were inoculated by placing spore suspensions (1 × 105 spores/ml) of eight wild type isolates onto wounds created by removing the calyx. Symptoms similar to those observed in the field developed on inoculated fruits after incubating at room temperature for 10 days, but did not develop on six fruits that were wounded but not inoculated. The same pathogen was reisolated from the inoculated fruits but not the control fruits. C. paradoxa has been reported as causing disease of coconut fruits in Brazil (2), but to our knowledge, this is the first report of the disease in Taiwan. References: (1) G. Morgan-Jones. No. 143 in: CMI Descriptions of Pathogenic Fungi and Bacteria. Commonwealth Mycological Institute, Surrey, England, 1967. (2) V. Rossetti. “Crostas Pretas” das folhas e “Podridão Basal” dos frutos de coqueiro. O Biológico 21:54, 1955.

Download Full-text

First Report of Leaf Spot Disease in Coconut Seedling Caused by Bipolaris setariae in China

Plant Disease ◽

10.1094/pdis-05-14-0522-pdn ◽

2014 ◽

Vol 98 (12) ◽

pp. 1742-1742 ◽

Cited By ~ 1

Author(s):

X.-Q. Niu ◽

F.-Y. Yu ◽

H. Zhu ◽

W.-Q. Qin

Keyword(s):

Leaf Spot ◽

Sequence Similarity ◽

Cocos Nucifera ◽

Morphological Characteristics ◽

Aerial Mycelium ◽

Its Region ◽

Leaf Spot Disease ◽

First Report ◽

Spot Disease ◽

Cocos Nucifera L

Coconut (Cocos nucifera L.), an important oilseed as well as a multipurpose perennial plantation crop, is distributed and planted in humid tropical areas. In October 2012, a new leaf spot disease was observed on 3-year-old coconut seedlings in Wenchang, Hainan Province, China. The symptom first appeared as spindly or elliptical and brown flecks with water-soaked lesions that became yellow with the progress of the disease. In the later stage of the disease, the lesions merged together, gradually expanding to the leaf apex. In recent years, the disease has been prevalent in all the nursery gardens surveyed. Once young leaves got infected and nearly all the leaves of the tree showed diseased symptoms, the coconut eventually became defoliated. The pathogen was isolated from the lesion margin, surface sterilized with 75% ethanol and 0.1% mercury bichloride, washed by sterile distilled water, and then placed excising pieces of leaves from the leision margin onto potato dextrose agar (PDA). Plates were incubated at 25°C for 4 days. After 7 days, the colony was grayish black and produced black pigment in the medium. Aerial mycelium was fluffy, septate, and branched, the conidiophores were slightly flexuous or straight, 5 to 11 μm thick, and produced curved, spindle-shaped, or fusiform, septate conidia with 4 to 10 septa, measuring 39 to 86 × 9 to 16 μm, with a slightly protuberant hilum, truncated. Based on the symptoms and mycelial and conidial characters above, the fungus was identified as Bipolaris setariae (1). The pathogenicity was established and repeated for six times by following Koch's postulates. Two 1-year-old coconut seedlings were washed with sterilized water and six leaves were wounded with a sterile needle and then inoculated by spraying them with a suspension of conidia of the isolate. The seedlings were kept in two incubators at 25°C for 12 days. Inoculated leaves showed typical symptoms similar to those described above. The pathogen was re-isolated from inoculated leaves. Morphological characteristics were identical to the original isolated fungus. In contrast, the control leaves did not show any symptoms. The genomic DNA of this fungus was extracted, amplification of the internal transcribed spacer (ITS) region was performed with primer ITS1 and ITS4, and the purified PCR product was sequenced (GenBank Accession No. KJ605157). BLASTn analysis revealed 99% sequence similarity with four B. setariae isolates (HE792936.1, JX462256, GU073108.1, and FJ606786.1). Morphologic characters and sequence analysis of the ITS rDNA confirmed that the pathogen was B. setariae. Bipolaris incurvata has been reported causing disease on coconut (2), but B. setariae was not previously reported on coconut. So far, this is the first report of B. setariae caused coconut seedling leaf spot disease in Hainan, China. References: (1) K. C. da Cunha et al. J. Clin. Microbiol. 50:4061, 2012. (2) A. Kamalakannan et al. New Dis. Rep. 12:18, 2005.

Download Full-text

Molecular Detection of 16SrXI Group Phytoplasma Associated with Root (Wilt) Disease of Coconut (Cocos nucifera) in India

Plant Disease ◽

10.1094/pdis-94-5-0636b ◽

2010 ◽

Vol 94 (5) ◽

pp. 636-636 ◽

Cited By ~ 31

Author(s):

R. Manimekalai ◽

V. P. Soumya ◽

R. Sathish Kumar ◽

R. Selvarajan ◽

K. Reddy ◽

...

Keyword(s):

Cocos Nucifera ◽

Control Sample ◽

Positive Control ◽

Wilt Disease ◽

Universal Primers ◽

Rrna Gene ◽

Polymorphism Analysis ◽

Representative Sequence ◽

White Leaf ◽

Cocos Nucifera L

Coconut palm (Cocos nucifera L.), a versatile tree crop with multifarious uses, is important for the livelihood security of millions of people in India. Root (wilt) disease (RWD) is a major production constraint causing an estimated yield loss of 968 million nuts in southern India. Affected palms show bending of leaflets (flaccidity), foliar yellowing, and marginal necrosis. Phytoplasmas have been observed to be associated with this disease by electron microscopy (EM) and transmission (3) but not characterized. Attempts made in the past decade to detect a phytoplasma associated with RWD through PCR using universal primers had inconsistent results so we designed two primer sets (1F7 [AGTGCTTAACACTGTCCTGCTA]/7R3 [TTGTAGCCCAGATCATAAGGGGCA], 3Fwd [ACCTGCCTTTAAGACGAGGA]/3Rev [AAAGGAGGTGATCCATCCCCACCT]) and seminested primer pair 1F7/7R2 (GACAAGGGTTGCGCTCGTTTT), 3Fwd/5Rev (ACCCCGAGAACGTATTCACCGCGA) from sequencing of a 1.8-kb fragment (GenBank No. FJ794816) amplified by primers P1/P7 from a diseased sample. These new primer pairs were used for the detection of phytoplasma from five symptomatic and five asymptomatic palms from Kasaragod (where disease is not endemic), 14 symptomatic palms from Kayamkulam (endemic area), and 10 palms from disease-free areas (Kidu, Karnataka) using PCR. DNA was extracted from 3 g of spindle leaf (two to three leaflets) midrib tissues using a modified phytoplasma enrichment protocol in which an addition of 5% polyvinylpolypyrrolidone (MW of 40,000) during tissue grinding was essential. PCR was performed for 35 cycles with an annealing temperature of 63°C to avoid nonspecific amplification. A 1.3-kb amplicon was seen in two of the five samples and the positive control sample (sugarcane grassy shoot DNA) using the seminested primer pair 3Fwd/3Rev–3Fwd/5Rev. The amplicons were cloned and sequenced and a representative sequence was deposited in GenBank (GQ850122). With the 1F7/7R3-1F7/7R2 seminested primers, a 493-bp product was obtained from 13 of 14 palms from Kayamkulam and all five diseased palms from Kasaragod. No amplification was seen from healthy palms. A BLAST search showed that the RWD phytoplasma 16S rRNA gene sequence has >96% nt identity with 16SrXI and 16SrXIV group phytoplasmas and 99% identity with sugarcane white leaf phytoplasma (AB052874), On the basis of the identity of the 16Sr RNA gene 3Fwd/5Rev region, RWD phytoplasma belongs to the 16SrXI group. A phylogenetic tree (neighbor-joining method) also revealed clustering of the coconut phytoplasma with the 16SrXI group phytoplasmas and virtual restriction fragment length polymorphism analysis (4) also placed it into group 16SrXI. Other phytoplasmas infecting coconut are found in groups 16SrIV (1) and 16SrXIV (2). Our RWD phytoplasma sequence does not match an earlier reported Kerala (wilt) coconut phytoplasma sequence (AY158660) and the latter sequence does not have similarity with any known phytoplasma sequences in the database. To our knowledge, this is first report of the association of 16SrXI group phytoplasma with the root wilt disease of coconut in India. These findings could be used for the early detection of root wilt disease phytoplasma in breeding materials and to develop a DNA-based diagnostic kit. References: (1) N. A. Harrison et al. Ann. Appl. Biol. 153:85, 2008. (2) N. Nejat et al. Am. J. Appl. Sci. 6:1331, 2009. (3) M. Sasikala et al. Eur. J. Plant Pathol. 94:191, 2005. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2007.

Download Full-text

Growth of Dracaena marginata and Spathiphyllum ‘Petite’ in Sphagnum Peat- and Coconut Coir Dust-based Growing Media

Journal of Environmental Horticulture ◽

10.24266/0738-2898-17.1.49 ◽

1999 ◽

Vol 17 (1) ◽

pp. 49-52 ◽

Cited By ~ 4

Author(s):

Robert H. Stamps ◽

Michael R. Evans

Keyword(s):

Growth Parameters ◽

Cocos Nucifera ◽

Greenhouse Production ◽

Growing Media ◽

Sphagnum Peat ◽

Affected Plant ◽

Coir Dust ◽

Media Component ◽

The Media ◽

Cocos Nucifera L

Abstract A comparison was made of Canadian sphagnum peat (SP) and Philippine coconut (Cocos nucifera L.) coir dust (CD) as growing media components for greenhouse production of Dracaena marginata Bak. and Spathiphyllum Schott ‘Petite’. Three soilless foliage plant growing mixes (Cornell, Hybrid, University of Florida #2 [UF-2]) were prepared using either SP or CD and pine bark (PB), vermiculite (V), and/or perlite (P) in the following ratios (% by vol): Cornell = 50 CD or SP:25 V:25 P, Hybrid = 40 CD or SP:30 V:30 PB, UF-2 = 50 CD or SP: 50 PB. Dracaena root growth was not affected by treatments but there were significant mix × media component interactions that affected plant top growth parameters. In general, the growth and quality of D. marginata were reduced by using CD in Cornell, had no effect in Hybrid, and increased in UF-2. S. ‘Petite’ grew equally well in all growing mixes regardless of whether CD or SP was used; however, plants grew more in Cornell and Hybrid than in UF-2. S. ‘Petite’ roots, which were infested with Cylindrocladium spathiphylli, had higher grades when grown in CD than when the media contained SP.

Download Full-text

Etude anatomique des faisceaux pétiolaires de Cocos nucifera L.

Bulletin mensuel de la Société linnéenne de Lyon ◽

10.3406/linly.1959.8028 ◽

1959 ◽

Vol 28 (1) ◽

pp. 4-8

Author(s):

Christian Ginieis

Keyword(s):

Cocos Nucifera ◽

Cocos Nucifera L

Download Full-text

Diversity in Mohachao Narel, a Sweet Endosperm Coconut (Cocos nucifera L.) Population from Maharashtra, India

National Academy Science Letters ◽

10.1007/s40009-013-0128-0 ◽

2013 ◽

Vol 36 (3) ◽

pp. 319-330 ◽

Cited By ~ 2

Author(s):

K. Samsudeen ◽

M. K. Rajesh ◽

D. D. Nagwaker ◽

Raghavan Reshmi ◽

P. Ajith Kumar ◽

...

Keyword(s):

Cocos Nucifera ◽

Cocos Nucifera L

Download Full-text

Cocos nucifera L. oil alleviates lead acetate-induced reproductive toxicity in sexually-matured male Wistar rats

Journal of Basic and Clinical Physiology and Pharmacology ◽

10.1515/jbcpp-2020-0281 ◽

2021 ◽

Vol 0 (0) ◽

Author(s):

Olugbemi T. Olaniyan ◽

Olakunle A. Ojewale ◽

Ayobami Dare ◽

Olufemi Adebayo ◽

Joseph E. Enyojo ◽

...

Keyword(s):

Luteinizing Hormone ◽

Lead Acetate ◽

Wistar Rats ◽

Histological Analysis ◽

Cocos Nucifera ◽

Reproductive Toxicity ◽

Positive Control ◽

Negative Control ◽

Male Wistar Rats ◽

Cocos Nucifera L

Abstract Objectives Lead primarily affects male reproductive functions via hormonal imbalance and morphological damage to the testicular tissue with significant alteration in sperm profile and oxidative markers. Though, different studies have reported that Cocos nucifera L. oil has a wide range of biological effects, this study aimed at investigating the effect of Cocos nucifera L. oil on lead acetate-induced reproductive toxicity in male Wistar rats. Methods Twenty (20) sexually matured male Wistar rats (55–65 days) were randomly distributed into four groups (n=5). Group I (negative control)—distilled water orally for 56 days, Group II (positive control)—5 mg/kg bwt lead acetate intraperitoneally (i.p.) for 14 days, Group III—6.7 mL/kg bwt Cocos nucifera L. oil orally for 56 days and Group IV—lead acetate intraperitoneally (i.p.) for 14 days and Cocos nucifera L. oil for orally for 56 days. Rats were sacrificed by diethyl ether, after which the serum, testis and epididymis were collected and used for semen analysis, biochemical and histological analysis. Results The lead acetate significantly increases (p<0.05) testicular and epididymal malondialdehyde (MDA) levels, while a significant reduction (p<0.05) in sperm parameters, organ weight, testosterone and luteinizing hormone was observed when compared with the negative control. The coadministration of Cocos nucifera oil with lead acetate significantly increases (p<0.05) testosterone, luteinizing hormone, sperm parameters and organ weight, with a significant decrease (p<0.05) in MDA levels compared with positive control. Histological analysis showed that lead acetate distorts testicular cytoarchitecture and germ cell integrity while this was normalized in the cotreated group. Conclusions Cocos nucifera oil attenuates the deleterious effects of lead acetate in male Wistar rats, which could be attributed to its polyphenol content and antioxidant properties.

Download Full-text