First Report of Root Rot Caused by Bipolaris zeicola on Maize in Hebei Province

Maize (Zea mays L.) is one of the most important cereal crops in China, and the planting area reached 41.3 million hectares in 2019. Root rot is a widespread disease that occurs at the seedling stage of maize, resulting in leaf wilting, root rot and even plant death, and consequently yield and quality losses. During an investigation of spring maize in 2020, seedlings with wilted leaves and dark brown necrotic spots on root were observed in the fields in Kuancheng Manchu Autonomous County, Hebei Province, China. Symptomatic plants were collected for pathogen isolation and identification. The soil on roots was washed off with running water. Then, 2-3 mm necrotic root segments were sampled and surface sterilized with 75% ethanol for 2 min, rinsed three times with sterile distilled water, air-dried on sterile filter paper, and plated on potato dextrose agar (PDA). Plates were incubated at 28℃ in darkness for 3 days. A nonsporulating, dematiaceous fungus growing from root segments was transferred to fresh PDA plates. The colonies were round or irregular round, black, villiform with dense grayish white mycelia. Water agar amended with wheat straw was used for sporulation. Conidiophores were single, light brown, multiseptate, geniculate. Conidia were 38.68 x 10.69 to 71.98 x 20.57 μm, brown, oval, slightly curved, with 2 to 8 septa, and an obviously flattened hilum on the basal cell. Conidia germinated from both poles. The causal agent was identified as Bipolaris zeicola (G.L. Stout) Shoemaker (teleomorph = Cochliobolus carbonum R. R. Nelson) based on its morphological features. For molecular identification, genomic DNA was extracted from fresh mycelia cultured on PDA plates. Partial sequences of ITS-rDNA region and Brn1 reductase melanin biosynthesis gene were amplified using primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al. 1990) and Brn01/ Brn02 (GCCAACATCGAGCAAACATGG/ GCAAGCAGCACCGTCAATACCAAT) (Shimizu et al. 1998), respectively. A DNA fragment of 532 bp was obtained from ITS-rDNA region and the sequence (GenBank Accession No. MW407046) was 100% identical to sequence of B. zeicola (GenBank Accession MH864760). The sequence of Brn1 gene was 816 bp (GenBank Accession No. MW415899) and was 99.75% identical to sequence of C. carbonum (GenBank Accession No. AB011658). The morphological and molecular evidence proved that the causal agent isolated from maize roots in Hebei province was B. zeicola. Pathogenicity assays were conducted with one week old (V1 stage) maize seedlings grown from the surface-sterilized seed of cv. Zhengdan 958. The mesocotyl and radicle of each plant (N=3) were inoculated with a 5 mm fungal disk of B. zeicola. Mock-inoculated plants (N=3) with sterile PDA disk served as the negative control. After 7 days, plants inoculated with B. zeicola were wilted with dark brown necrotic spots on mesocotyl and radicle. Meanwhile, the negative controls did not present any symptoms. Koch’s postulate was proved with successful re-isolation of the same fungus from the inoculated maize plants. These results confirmed the pathogenicity of B. zeicola on maize root. B. zeicola mainly causes an important foliar disease in many regions of the world, known as Northern corn leaf spot, in addition, it can also cause ear rot and stalk rot of maize (Liu et al. 2015). To our knowledge, this is the first report of root rot caused by B. zeicola on maize in China, which extends the known agents of maize root rot. Therefore, it is necessary to explore effective seed-applied fungicides for disease control. Also, more attention should be paid to develop hybrids with resistance to this disease.

First Report of Race 3 of Bipolaris zeicola on Corn in China

In Meixian County of Shaanxi Province, China, during the summer of 2002, mature corn plants in a field plot showed severe leaf spot symptoms. The lesions were narrow (3.5 to 18 mm long and 0.4 to 1.5 mm wide), grayish tan, and surrounded by a light- to dark-pigmented border. Leaves wilted when lesions coalesced. From 2002 to 2005, the disease was observed in other Shaanxi Province counties, including Yangling, Wugong, Qianxian, Longxian, and Qianyang, although in most cases, symptom development was less severe than it was in Meixian. Seven isolates from four counties were obtained by isolation from host tissue on potato dextrose agar (PDA), followed by single-spore culturing and incubation on PDA at 25°C in the dark for 7 days. Conidial suspensions were prepared from a single-spored culture on PDA plates. Pathogenicity tests were performed by spraying five corn seedlings (cv. Yuyu 22) at the three- to four-leaf stage in separate 10-cm-diameter pots with 10 ml of a conidial suspension (106 spores per ml) per plant. Each of three isolates was used in separate inoculations that were performed in different weeks. Controls were sprayed with sterile distilled water only. Plants were covered with plastic bags for 48 h and incubated at 23 to 25°C in a chamber. One week after inoculation, leaves on all inoculated plants developed characteristic lesions, whereas untreated controls had no symptoms. The pathogen was reisolated from diseased leaves on PDA after surface sterilization with 2% NaOCl. On PDA, proliferation of conidia usually occurred on all sides of the conidiophore. Conidiophores were cylindrical, simple, smooth, septate, and straight to flexuous. Conidia were 49 to 89 μm long and 11 to 17 μm wide, with 3 to 10 distosepta, straight or moderately curved, dark or olivaceous brown, and the cells on the ends sometimes appeared paler than those in the middle. These characteristics match those of Bipolaris zeicola (Stout) Shoemaker. On the basis of the arbitrary primers selected by Jones et al. (1), random amplified polymorphic DNA (RAPD) analysis was used for species and physiological race determination. A single DNA fragment approximately 1.2 kb, which is characteristic of B. zeicola, was amplified from all seven isolates with arbitrary primer A20 (5′CTTGGATTC3′). Analysis of PCR products obtained with arbitrary primer A03 (5′AGTCAGCCAC3′) showed that all seven isolates lacked 2,700- and 2,300-base bands, and therefore, sorted into B. zeicola race 3. On the basis of pathogenicity, morphology, and RAPD band patterns of primer A20, the fungus was confirmed as B. zeicola. The shape of leaf lesions and RAPD band patterns using primer A03 showed further that the pathogen was race 3 of B. zeicola. Bai et al. (2) reported race 1 and race 2 of B. zeicola in China, but to our knowledge, this is the first report of race 3 in China. References: (1) M. J. Jones and L. D. Dunkle. Phytopathology 83:366, 1993. (2) J. K. Bai et al. Acta Phytopathol. Sin. 12:61, 1982.