Physiological Characteristics and Transcriptomic Dissection in Two Root Segments with Contrasting Net Fluxes of Ammonium and Nitrate of Poplar Under Low Nitrogen Availability

To investigate physiological and transcriptomic regulation mechanisms underlying the distinct net fluxes of NH4+ and NO3- in different root segments of Populus species under low nitrogen (N) conditions, we used saplings of P. × canescens supplied with either 500 (normal N) or 50 (low N) μM NH4NO3. The net fluxes of NH4+ and NO3-, and the concentrations of NH4+, amino acids, organic acids and the enzymatic activities of nitrite reductase (NiR) and glutamine synthetase (GS) in root segment II (SII, 35-70 mm to the apex) were lower than those in root segment I (SI, 0-35 mm to the apex). The net NH4+ influxes and the concentrations of organic acids were elevated, whereas the concentrations of NH4+ and NO3-, and the activities of NiR and GS were reduced in SI and SII in response to low N. A number of genes were significantly differentially expressed in SII vs SI and in both segments grown under low vs normal N conditions, and these genes were mainly involved in transport of NH4+ and NO3-, N metabolism, and adenosine triphosphate (ATP) synthesis. Moreover, the hub gene coexpression networks were dissected and correlated with N physiological processes in SI and SII under normal and low N conditions. These results suggest that the hub gene coexpression networks play pivotal roles in regulating N uptake and assimilation, amino acid metabolism as well as the levels of organic acids from TCA cycle in the two root segments of poplars in acclimation to low N availability.

Culture Media Based on Leaf Strips/Root Segments Create Compatible Host/Organ Setup for in vitro Cultivation of Plant Microbiota

Plant microbiota have co-evolved with their associated plants in the entire holobiont, and their assemblages support diversity and productivity on our planet. Of importance is in vitro cultivation and identification of their hub taxa for possible core microbiome modification. Recently, we introduced the in situ-similis culturing strategy, based on the use of plant leaves as a platform for in vitro growth of plant microbiota. Here, the strategy is further extended by exploring plant organ compatible cultivation of plant microbiota when grown on corresponding leaf/root-based culture media. Pooling the advantages of MPN enrichment methodology together with natural plant-only-based culture media, the introduced method efficiently constructed a nutritional milieu governed by vegan nutrients of plant origin, i.e., leaf strips/root segments, immersed in plain semi-solid water agar. MPN estimates exceeded log 7.0 and 4.0 g−1 of endo-rhizosphere and endo-phyllosphere, respectively, of maize and sunflower; being proportionate to those obtained for standard culture media. With sunflower, PCR-DGGE analyses indicated divergence in community composition of cultivable endophytes primarily attributed to culture media, signaling a certain degree of plant organ affinity/compatibility. Based on 16S rRNA gene sequencing of bacterial isolates, 20 genera comprising 32 potential species were enriched; belonged to Bacteroidetes, Firmicutes, and Alpha-/Gammaproteobacteria. The described cultivation strategy furnished diversified nutritive platform in terms of homologous/heterologous plant organ-based medium and ambient/limited oxygenic cultivation procedure. Duly, cultivability extended to > 8 genera: Bosea, Brevundimonas, Chitinophaga, Pseudoxanthomonas, Sphingobacterium Caulobacter, Scandinavium, and Starkeya; the latter three genera were not yet reported for Sunflower, and possible unknown species or even one new putative genus. Thus, both potential members of the major microbiome and rare isolates of satellite microbiomes can be isolated using the presented method. It is a feasible addition to traditional cultivation methods to explore new potential resources of PGPB for future biotechnological applications.

First Report of Root Rot Caused by Bipolaris zeicola on Maize in Hebei Province

Maize (Zea mays L.) is one of the most important cereal crops in China, and the planting area reached 41.3 million hectares in 2019. Root rot is a widespread disease that occurs at the seedling stage of maize, resulting in leaf wilting, root rot and even plant death, and consequently yield and quality losses. During an investigation of spring maize in 2020, seedlings with wilted leaves and dark brown necrotic spots on root were observed in the fields in Kuancheng Manchu Autonomous County, Hebei Province, China. Symptomatic plants were collected for pathogen isolation and identification. The soil on roots was washed off with running water. Then, 2-3 mm necrotic root segments were sampled and surface sterilized with 75% ethanol for 2 min, rinsed three times with sterile distilled water, air-dried on sterile filter paper, and plated on potato dextrose agar (PDA). Plates were incubated at 28℃ in darkness for 3 days. A nonsporulating, dematiaceous fungus growing from root segments was transferred to fresh PDA plates. The colonies were round or irregular round, black, villiform with dense grayish white mycelia. Water agar amended with wheat straw was used for sporulation. Conidiophores were single, light brown, multiseptate, geniculate. Conidia were 38.68 x 10.69 to 71.98 x 20.57 μm, brown, oval, slightly curved, with 2 to 8 septa, and an obviously flattened hilum on the basal cell. Conidia germinated from both poles. The causal agent was identified as Bipolaris zeicola (G.L. Stout) Shoemaker (teleomorph = Cochliobolus carbonum R. R. Nelson) based on its morphological features. For molecular identification, genomic DNA was extracted from fresh mycelia cultured on PDA plates. Partial sequences of ITS-rDNA region and Brn1 reductase melanin biosynthesis gene were amplified using primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al. 1990) and Brn01/ Brn02 (GCCAACATCGAGCAAACATGG/ GCAAGCAGCACCGTCAATACCAAT) (Shimizu et al. 1998), respectively. A DNA fragment of 532 bp was obtained from ITS-rDNA region and the sequence (GenBank Accession No. MW407046) was 100% identical to sequence of B. zeicola (GenBank Accession MH864760). The sequence of Brn1 gene was 816 bp (GenBank Accession No. MW415899) and was 99.75% identical to sequence of C. carbonum (GenBank Accession No. AB011658). The morphological and molecular evidence proved that the causal agent isolated from maize roots in Hebei province was B. zeicola. Pathogenicity assays were conducted with one week old (V1 stage) maize seedlings grown from the surface-sterilized seed of cv. Zhengdan 958. The mesocotyl and radicle of each plant (N=3) were inoculated with a 5 mm fungal disk of B. zeicola. Mock-inoculated plants (N=3) with sterile PDA disk served as the negative control. After 7 days, plants inoculated with B. zeicola were wilted with dark brown necrotic spots on mesocotyl and radicle. Meanwhile, the negative controls did not present any symptoms. Koch’s postulate was proved with successful re-isolation of the same fungus from the inoculated maize plants. These results confirmed the pathogenicity of B. zeicola on maize root. B. zeicola mainly causes an important foliar disease in many regions of the world, known as Northern corn leaf spot, in addition, it can also cause ear rot and stalk rot of maize (Liu et al. 2015). To our knowledge, this is the first report of root rot caused by B. zeicola on maize in China, which extends the known agents of maize root rot. Therefore, it is necessary to explore effective seed-applied fungicides for disease control. Also, more attention should be paid to develop hybrids with resistance to this disease.

Towards the consideration of soil-root resistances in root water uptake models with macroscopic representations of hydraulic root architecture

<p>Plant water uptake from soil is an important component of terrestrial water cycle with strong links to the carbon cycle and the land surface energy budget. To simulate the relation between soil water content, root distribution, and root water uptake, models should represent the hydraulics of the soil-root system and describe the flow from the soil towards root segments and within the 3D root system architecture according to hydraulic principles. We have recently demonstrated how macroscopic relations that describe the lumped water uptake by all root segments in a certain soil volume, e.g. in a thin horizontal soil layer in which soil water potentials are uniform, can be derived from the hydraulic properties of the 3D root architecture. The flow equations within the root system can be scaled up exactly and the total root water uptake from a soil volume depends on only two macroscopic characteristics of the root system: the root system conductance, K<sub>rs</sub>, and the uptake distribution from the soil when soil water potentials in the soil are uniform, <strong>SUF</strong>. When a simple root hydraulic architecture was assumed, these two characteristics were sufficient to describe root water uptake from profiles with a non-uniform water distribution. This simplification gave accurate results when root characteristics were calculated directly from the root hydraulic architecture. In a next step, we investigate how the resistance to flow in the soil surrounding the root can be considered in a macroscopic root water uptake model. We specifically investigate whether the macroscopic representation of the flow in the root architecture, which predicts an effective xylem water potential at a certain soil depth, can be coupled with a model that describes the transfer from the soil to the root using a simplified representation of the root distribution in a certain soil layer, i.e. assuming a uniform root distribution.</p>

Bacterial Community Structure Dynamics in Meloidogyne incognita-Infected Roots and Its Role in Worm-Microbiome Interactions

ABSTRACT Plant parasitic nematodes such as Meloidogyne incognita have a complex life cycle, occurring sequentially in various niches of the root and rhizosphere. They are known to form a range of interactions with bacteria and other microorganisms that can affect their densities and virulence. High-throughput sequencing can reveal these interactions in high temporal and geographic resolutions, although thus far we have only scratched the surface. In this study, we have carried out a longitudinal sampling scheme, repeatedly collecting rhizosphere soil, roots, galls, and second-stage juveniles from 20 plants to provide a high-resolution view of bacterial succession in these niches, using 16S rRNA metabarcoding. Our findings indicate that a structured community develops in the root, in which gall communities diverge from root segments lacking a gall, and that this structure is maintained throughout the crop season. We describe the successional process leading toward this structure, which is driven by interactions with the nematode and later by an increase in bacteria often found in hypoxic and anaerobic environments. We present evidence that this structure may play a role in the nematode’s chemotaxis toward uninfected root segments. Finally, we describe the J2 epibiotic microenvironment as ecologically deterministic, in part, due to the active bacterial attraction of second-stage juveniles. IMPORTANCE The study of high-resolution successional processes within tightly linked microniches is rare. Using the power and relatively low cost of metabarcoding, we describe the bacterial succession and community structure in roots infected with root-knot nematodes and in the nematodes themselves. We reveal separate successional processes in galls and adjacent non-gall root sections, which are driven by the nematode’s life cycle and the progression of the crop season. With their relatively low genetic diversity, large geographic range, spatially complex life cycle, and the simplified agricultural ecosystems they occupy, root-knot nematodes can serve as a model organism for terrestrial holobiont ecology. This perspective can improve our understanding of the temporal and spatial aspects of biological control efficacy.

A functional–structural model of upland rice root systems reveals the importance of laterals and growing root tips for phosphate uptake from wet and dry soils

Background and Aims Upland rice is often grown where water and phosphorus (P) are limited. To better understand the interaction between water and P availability, functional–structural models that mechanistically represent small-scale nutrient gradients and water dynamics in the rhizosphere are needed. Methods Rice was grown in large columns using a P-deficient soil at three P supplies in the topsoil (deficient, sub-optimal and non-limiting) in combination with two water regimes (field capacity vs. drying periods). Root system characteristics, such as nodal root number, lateral types, interbranch distance, root diameters and the distribution of biomass with depth, as well as water and P uptake, were measured. Based on the observed root data, 3-D root systems were reconstructed by calibrating the structural architecure model CRootBox for each scenario. Water flow and P transport in the soil to each of the individual root segments of the generated 3-D root architectures were simulated using a multiscale flow and transport model. Total water and P uptake were then computed by adding up the uptake by all the root segments. Key Results Measurements showed that root architecture was significantly affected by the treatments. The moist, high P scenario had 2.8 times the root mass, double the number of nodal roots and more S-type laterals than the dry, low P scenario. Likewise, measured plant P uptake increased >3-fold by increasing P and water supply. However, drying periods reduced P uptake at high but not at low P supply. Simulation results adequately predicted P uptake in all scenarios when the Michaelis–Menten constant (Km) was corrected for diffusion limitation. They showed that the key drivers for P uptake are the different types of laterals (i.e. S- and L-type) and growing root tips. The L-type laterals become more important for overall water and P uptake than the S-type laterals in the dry scenarios. This is true across all the P treatments, but the effect is more pronounced as the P availability decreases. Conclusions This functional–structural model can predict the function of specific rice roots in terms of P and water uptake under different P and water supplies, when the structure of the root system is known. A future challenge is to predict how the structure root systems responds to nutrient and water availability.

Root xylem in three woody angiosperm species is not more vulnerable to embolism than stem xylem

AimsSince plants are compartmentalised organisms, failure of their hydraulic transport system could differ between organs. We test here whether xylem tissue of stems and roots differ in their drought-induced embolism resistance, and whether intact roots are equally resistant to embolism than root segments.MethodsEmbolism resistance of stem and root xylem was measured based on the pneumatic technique for Acer campestre, A. pseudoplatanus and Corylus avellana, comparing also intact roots and root segments of C. avellana. Moreover, we compared anatomical features such as interconduit pit membrane between roots and stems.ResultsWe found a higher embolism resistance for roots than stems, although a significant difference was only found for A. pseudoplatanus. Interconduit pit membrane thickness was similar for both organs of the two Acer species, but pit membranes were thicker in roots than stems of C. avellana. Also, embolism resistance of an intact root network was similar to thick root segments for C. avellana.ConclusionOur observations show that root xylem is not more vulnerable to embolism than stem xylem, although more species need to be studied to test if this finding can be generalised. We also demonstrated that the pneumatic method can be applied to non-terminal plant samples.

The bacterial community structure dynamics in Meloidogyne incognita infected roots and its role in worm-microbiome interactions

BackgroundPlant parasitic nematodes such as Meloidogyne incognita have a complex life cycle, occurring sequentially in various niches of the root and rhizosphere. They are known to form a range of interactions with bacteria and other microorganisms, that can affect their densities and virulence. High throughput sequencing can reveal these interactions in high temporal, and geographic resolutions, although thus far we have only scratched the surface. We have carried out a longitudinal sampling scheme, repeatedly collecting rhizosphere soil, roots, galls and second stage juveniles from 20 plants to provide a high resolution view of bacterial succession in these niches, using 16S rRNA metabarcoding.ResultsWe find that a structured community develops in the root, in which gall communities diverge from root segments lacking a gall, and that this structure is maintained throughout the crop season. We detail the successional process leading toward this structure, which is driven by interactions with the nematode and later by an increase in bacteria often found in hypoxic and anaerobic environments. We show evidence that this structure may play a role in the nematode’s chemotaxis towards uninfected root segments. Finally, we describe the J2 epibiotic microenvironment as ecologically deterministic, in part, due to active bacterial attraction of second stage juveniles.ConclusionsHigh density sampling, both temporally and across adjacent microniches, coupled with the power and relative low cost of metabarcoding, has provided us with a high resolution description of our study system. Such an approach can advance our understanding of holobiont ecology. Meloidogyne spp., with their relatively low genetic diversity, large geographic range and the simplified agricultural ecosystems they occupy, can serve as a model organism. Additionally, the perspective this approach provides could promote the efforts toward biological control efficacy.