First Report of Root Rot Caused by Bipolaris zeicola on Maize in Hebei Province

Maize (Zea mays L.) is one of the most important cereal crops in China, and the planting area reached 41.3 million hectares in 2019. Root rot is a widespread disease that occurs at the seedling stage of maize, resulting in leaf wilting, root rot and even plant death, and consequently yield and quality losses. During an investigation of spring maize in 2020, seedlings with wilted leaves and dark brown necrotic spots on root were observed in the fields in Kuancheng Manchu Autonomous County, Hebei Province, China. Symptomatic plants were collected for pathogen isolation and identification. The soil on roots was washed off with running water. Then, 2-3 mm necrotic root segments were sampled and surface sterilized with 75% ethanol for 2 min, rinsed three times with sterile distilled water, air-dried on sterile filter paper, and plated on potato dextrose agar (PDA). Plates were incubated at 28℃ in darkness for 3 days. A nonsporulating, dematiaceous fungus growing from root segments was transferred to fresh PDA plates. The colonies were round or irregular round, black, villiform with dense grayish white mycelia. Water agar amended with wheat straw was used for sporulation. Conidiophores were single, light brown, multiseptate, geniculate. Conidia were 38.68 x 10.69 to 71.98 x 20.57 μm, brown, oval, slightly curved, with 2 to 8 septa, and an obviously flattened hilum on the basal cell. Conidia germinated from both poles. The causal agent was identified as Bipolaris zeicola (G.L. Stout) Shoemaker (teleomorph = Cochliobolus carbonum R. R. Nelson) based on its morphological features. For molecular identification, genomic DNA was extracted from fresh mycelia cultured on PDA plates. Partial sequences of ITS-rDNA region and Brn1 reductase melanin biosynthesis gene were amplified using primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al. 1990) and Brn01/ Brn02 (GCCAACATCGAGCAAACATGG/ GCAAGCAGCACCGTCAATACCAAT) (Shimizu et al. 1998), respectively. A DNA fragment of 532 bp was obtained from ITS-rDNA region and the sequence (GenBank Accession No. MW407046) was 100% identical to sequence of B. zeicola (GenBank Accession MH864760). The sequence of Brn1 gene was 816 bp (GenBank Accession No. MW415899) and was 99.75% identical to sequence of C. carbonum (GenBank Accession No. AB011658). The morphological and molecular evidence proved that the causal agent isolated from maize roots in Hebei province was B. zeicola. Pathogenicity assays were conducted with one week old (V1 stage) maize seedlings grown from the surface-sterilized seed of cv. Zhengdan 958. The mesocotyl and radicle of each plant (N=3) were inoculated with a 5 mm fungal disk of B. zeicola. Mock-inoculated plants (N=3) with sterile PDA disk served as the negative control. After 7 days, plants inoculated with B. zeicola were wilted with dark brown necrotic spots on mesocotyl and radicle. Meanwhile, the negative controls did not present any symptoms. Koch’s postulate was proved with successful re-isolation of the same fungus from the inoculated maize plants. These results confirmed the pathogenicity of B. zeicola on maize root. B. zeicola mainly causes an important foliar disease in many regions of the world, known as Northern corn leaf spot, in addition, it can also cause ear rot and stalk rot of maize (Liu et al. 2015). To our knowledge, this is the first report of root rot caused by B. zeicola on maize in China, which extends the known agents of maize root rot. Therefore, it is necessary to explore effective seed-applied fungicides for disease control. Also, more attention should be paid to develop hybrids with resistance to this disease.

Download Full-text

First Report of Phytophthora Root Rot of Sugar Beet, Caused by Phytophthora cryptogea, in Greece

Plant Disease ◽

10.1094/pdis.2000.84.5.593b ◽

2000 ◽

Vol 84 (5) ◽

pp. 593-593 ◽

Cited By ~ 3

Author(s):

G. S. Karaoglanidis ◽

D. A. Karadimos ◽

K. Klonari

Keyword(s):

Sugar Beet ◽

Root Rot ◽

Soil Extract ◽

American Phytopathological Society ◽

Phytophthora Root Rot ◽

Phytophthora Cryptogea ◽

First Report ◽

Solid Media ◽

Necrotic Spots ◽

Extract Medium

A severe rot of sugar beet roots was observed in the Amyndeon area of Greece during summer 1998. Infected plants initially showed a temporary wilt, which became permanent, and finally died. Slightly diseased roots showed necrotic spots toward the base, whereas more heavily diseased roots showed a more extensive wet rot that extended upward. Feeder roots also were infected and reduced in number because of decay. Rotted tissue was brown with a distinguishing black margin. In most of the isolations, carried out on potato dextrose agar (PDA), the pathogen obtained was identified as Phytophthora cryptogea Pethybr. & Lafferty Mycelium consisted of fairly uniform, fine hyphae that showed a slightly floral growth pattern. In autoclaved soil-extract medium, chains or clusters of hyphal swellings (average 12 µm diameter) formed. Sporangia were not produced on solid media but were abundant in soil-extract medium. Sporangia were oval to obpyriform in shape, nonpapillate with rounded bases, and varied in size (39 to 80 × 24 to 40 µm). Oospores were plerotic, thick-walled, and averaged 25 µm in diameter. The isolated pathogen, cultured on PDA, could not grow at all at 36°C. The closely related species P. drechsleri Tucker has been reported to cause similar root rot symptoms on sugar beet (3). However, P. drechsleri grows well at 36°C, while P. cryptogea cannot grow at this temperature; this is the major distinguishing feature that separates the two species (1). To test the pathogenicity of the organism, surface-sterilized sugar beet roots (cv. Rizor) were inoculated with 5-mm-diameter PDA plugs containing actively growing mycelium. Sterile PDA plugs were used to inoculate control sugar beet roots. Inoculated roots were kept at 27°C in the dark for 10 days. Extensive decay of inoculated roots developed, similar to decay observed in the field, whereas control roots showed no decay. P. cryptogea was reisolated from rotted tissues. This pathogen has been recognized previously as a cause of root rot of sugar beet in Japan (1) and Wyoming (2). This is the first report of Phytophthora root rot of sugar beet in Greece. References: (1) D. C. Erwin and O. K. Ribeiro. 1996. Phytophthora Diseases Worldwide. The American Phytopathological Society, St. Paul, MN. (2) P. C. Vincelli et. al. Plant Dis. 74:614, 1990. (3) E. D. Whitnew and J. E. Duffus, eds. 1986. Compendium of Beet Diseases and Insects. The American Phytopathological Society, St. Paul, MN.

Download Full-text

Soybean Sudden Death Syndrome Causal Agent Fusarium brasiliense Present in Michigan

Plant Disease ◽

10.1094/pdis-08-18-1332-re ◽

2019 ◽

Vol 103 (6) ◽

pp. 1234-1243 ◽

Cited By ~ 5

Author(s):

Jie Wang ◽

Hyunkyu Sang ◽

Janette L. Jacobs ◽

Kjersten A. Oudman ◽

Linda E. Hanson ◽

...

Keyword(s):

Sudden Death ◽

Rna Polymerase Ii ◽

Root Rot ◽

The United States ◽

Causal Agent ◽

Sudden Death Syndrome ◽

Nuclear Ribosomal Dna ◽

First Report ◽

Fusarium Sp ◽

Pathogenicity Assay

Sudden death syndrome (SDS), caused by members of Fusarium solani species complex (FSSC) clade 2, is a major and economically important disease in soybean worldwide. The primary causal agent of SDS isolated to date in North America has been F. virguliforme. In 2014 and 2016, SDS symptoms were found in two soybean fields located on the same farm in Michigan. Seventy Fusarium strains were isolated from roots of the SDS-symptomatic soybeans in two fields. Phylogenetic analysis of partial sequences of elongation factor-1α, the nuclear ribosomal DNA intergenic spacer region, and the RNA polymerase II beta subunit revealed that the primary FSSC species isolated was F. brasiliense (58 and 36% in each field) and the remaining Fusarium strains were identified as F. cuneirostrum, F. phaseoli, an undescribed Fusarium sp. from FSSC clade 2, and strains in FSSC clade 5 and FSSC clade 11. Molecular identification was supported with morphological analysis and a pathogenicity assay. The soybean seedling pathogenicity assay indicated that F. brasiliense was capable of causing typical foliar SDS symptoms. Both root rot and foliar disease severity were variable by strain, just as they are in F. virguliforme. Both FSSC 5 and FSSC 11 strains were also capable of causing root rot, but SDS foliar symptoms were not detected. To our knowledge, this is the first report of F. brasiliense causing SDS in soybean in the United States and the first report of F. cuneirostrum, F. phaseoli, an as-yet-unnamed Fusarium sp., and strains in FSSC clade 5 and FSSC clade 11 associated with or causing root rot of soybean in Michigan.

Download Full-text

First Report of Pythium myriotylum as a Causal Agent of Crown and Root Rot in Soilless Green Bean Cultivation in Italy

Plant Disease ◽

10.1094/pdis-07-17-0942-pdn ◽

2018 ◽

Vol 102 (3) ◽

pp. 688-688

Author(s):

S. Vitale ◽

L. Luongo ◽

E. Marinelli ◽

A. Belisario

Keyword(s):

Root Rot ◽

Causal Agent ◽

Green Bean ◽

Pythium Myriotylum ◽

First Report ◽

Crown And Root Rot

Download Full-text

First Report of Armillaria Root Rot Caused by Armillaria mellea Infecting Carrizo Citrange and Sour Orange Rootstocks in Turkey

Plant Disease ◽

10.1094/pdis-05-14-0463-pdn ◽

2014 ◽

Vol 98 (10) ◽

pp. 1439-1439 ◽

Cited By ~ 1

Author(s):

F. Baysal-Gurel ◽

A. Cinar

Keyword(s):

Root Rot ◽

Root Systems ◽

Causal Agent ◽

Poncirus Trifoliata ◽

Sour Orange ◽

Potato Dextrose Broth ◽

First Report ◽

Armillaria Mellea ◽

Carrizo Citrange ◽

Armillaria Root Rot

Citrus rootstocks, Carrizo citrange (Citrus sinensis [L.] Osb. × Poncirus trifoliata [L.] Raf.) and sour orange (C. aurantium L.) grown in containers filled with 5 liters of potting mix of 40% peat and 60% volcanic tuff declined in a 0.2-ha commercial nursery in Adana, Turkey, between 2004 and 2007. Seedlings with symptoms of root rot were found with an average disease incidence of 20% among 1,000 Carrizo citrange seedlings and 10% among 15,000 sour orange seedlings. The potting mixture preparation unit was located next to an oak tree (Quercus sp.) showing symptoms of Armillaria root rot. Six- to 12-month-old seedlings of both rootstocks were stunted and the crowns were necrotic with the presence of white mycelium. Mycelial fans were observed beneath the bark of infected roots and they expanded into the crown. The root systems and nearby potting mix contained rhizomorphs. Thus, Armillaria spp. was suspected as a possible causal agent. Three diseased crowns and three rhizomorphs were surface-sterilized with 1% NaClO for 1 min and cultured on benomyl-dichloran-streptomycin containing selective medium (3) at 25°C in the dark for 1 week. Six isolates transferred to 1.5% malt extract agar at 33°C in the dark for 7 weeks consistently yielded abundant aerial hyphae and mean diameter growth range was 4 to 21 mm and the mycelium margin was regular (1). To confirm pathogen identity, total DNA was extracted using the PowerSoil DNA Isolation Kit (MO BIO Laboratories, Inc., CA) directly from 7-day-old cultures grown in potato dextrose broth (PDB). The ribosomal DNA internal transcribed spacer (ITS) region was amplified by PCR using the primer pair ITS1 and ITS4 (5) and sequenced. The sequences were 99% identical to that of Armillaria mellea isolates from Japan (AB510880) and China (KF032535). This confirmed the identity of the causal agent as A. mellea (Vahl.) P. Kumm. Ten 3-month-old seedlings of Carrizo citrange and sour orange were transplanted into steam-sterilized potting mix and inoculated with wood pieces of oak (Quercus sp.) colonized by the fungus (two pieces for each container) (2). The oak wood pieces were sterilized prior to the colonization by the pathogen. Plants were maintained in a greenhouse (23 to 25°C) until symptoms appeared. Ten non-inoculated seedlings from each rootstock served as controls and were maintained in the same environment. After 4 months, the crowns of the seedlings developed necrotic areas and root systems contained rhizomorphs on all inoculated seedlings and fungus was re-isolated from crowns and rhizomorphs. All control plants remained disease-free and no fungus was re-isolated. A. mellea was reported to infect citrus rootstocks in Spain in 1999 (4). To our knowledge, this is the first report of Armillaria root rot caused by A. mellea infecting Carrizo citrange and sour orange rootstocks in Turkey. This indicates that citrus rootstocks could be at risk for infection and sterilization of the potting mix and good sanitation practices in nurseries are very important. References: (1) J. N. Bruhn et al. Mycopathologia 142:89, 1998. (2) F. M. Grasso et al. Plant Dis. 91:1517, 2007. (3) T. C. Harrington et al. Page 81 in: Methods for Research on Soilborne Phytopathogenic Fungi. APS Press, St. Paul, MN, 1992. (4) J. J. Tuset et al. Bol. San. Veg. Plagas 25: 491, 1999. (5) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First Report of Root Rot of Cocoyam Caused by Pythium myriotylum in Sri Lanka

Plant Disease ◽

10.1094/pd-89-1132c ◽

2005 ◽

Vol 89 (10) ◽

pp. 1132-1132 ◽

Cited By ~ 2

Author(s):

M. Tojo ◽

H. Ono ◽

C. Nakashima ◽

S. Yoneyama ◽

J. A. S. Jayakody

Keyword(s):

Sri Lanka ◽

Root Rot ◽

Continuous Light ◽

Rdna Sequence ◽

Its Rdna ◽

Molecular Characteristics ◽

Root Tips ◽

Pythium Myriotylum ◽

First Report ◽

Initial Symptoms

Root rot of cocoyam (Xanthosoma sagittifolium L. Schott) caused by Pythium myriotylum Drechsler is a major disease of this crop in Africa (1,2) but is unreported from other regions of the world. During September 1999, commercially grown cocoyam (cv. Ratu-kiri-ala) in Gampaha (7°05′N, 80°00′E), Sri Lanka suffered from severe root rot. Initial symptoms were water-soaked lesions at the root tips that gradually enlarged to rot the entire root system and tuber. Wilting and yellowing of leaves were observed in advanced stages of disease. A Pythium sp. was regularly isolated from the affected roots and an isolate, SC5, was identified as P. myriotylum on the basis of morphology and the internal transcribed spacer (ITS) rDNA sequence. Characteristics of isolate SC5, grown on a grass-leaf water culture (3) were main hyphae up to 8.5 μm wide, oogonia terminal or intercalary (22.5 to 33.8 μm in diameter), antheridia diclinous occasionally monoclinous, one to eight per oogonium, stalks branched, often more or less loosely enveloping the oogonium, antheridium clavate or crook-necked, making apical contact with the oogonium, breadth of antheridium 2.5 to 7.0 μm, oospores aplerotic (17.0 to 22.5 μm in diameter), oospore wall 0.8 to 2.0 μm in thickness, sporangia terminal or intercalary, filamentous, inflated lobulate, and digitate, of variable length, breadth of sporangia 7.0 to 17.5 μm, formed in water; zoospores formed at 25°C, and diameter of encysted zoospores 10.0 to 12.5 μm. Cardinal temperatures on potato carrot agar 8°C minimum, 34°C optimum, and 37°C maximum with daily radial growth rate for 34°C at 32.8 mm. The ITS rDNA sequence of the isolate matched the sequences of P. myriotylum in GenBank (Accession Nos. AB095051 and AF452156) and isolate CBS254.70 used for the species description by van der Plaats-Niterink (3). The sequence of SC5 has been deposited in GenBank, Accession No. DQ102701. Pathogenicity tests used potted cocoyam plants (20 cm high), planted in an autoclaved potting mix. Four agar disks (8 mm in diameter) of isolate SC5 grown at 25°C for 48 h on potato dextrose agar was mashed and injected at a depth of 2 to 3 cm in the soil around the roots. Inoculated plants were placed in transparent plastic bags and kept for 7 days in a growth chamber maintained at 24 to 26°C with continuous light (52 to 98 μmol m-2·s-1). The experiment was carried out twice with three replications for each test. Dark brown rotting on roots and wilting of leaves were observed in 7 days after the inoculation. P. myriotylum was reisolated from diseased tissues and found to be morphologically identical to the original isolate SC5. Noninoculated control plants remained healthy. On the basis of the symptoms, morphological and molecular characteristics and confirmation of pathogenicity, P. myriotylum is the causal agent of root rot of cocoyam. To our knowledge, this is the first report of P. myriotylum causing root rot of cocoyam in Sri Lanka. References: (1) S. Nzietchueng. L'agronomie Tropicale 38:321, 1983. (2) R. P. Pacumbaba et al. J. Phytopathol. 135:265, 1992. (3) A. J. Van Der Plaats-Niterink. Stud. Mycol. 21:1, 1981.

Download Full-text

First Report of Pythium spinosum as a Causal Agent of Crown and Root Rot in Greenhouse Cucumber Cultivation in Italy

Plant Disease ◽

10.1094/pdis-02-20-0305-pdn ◽

2020 ◽

Vol 104 (12) ◽

pp. 3269

Author(s):

L. Sigillo ◽

C. Pane ◽

I. Garaguso ◽

L. Luongo ◽

M. Galli ◽

...

Keyword(s):

Root Rot ◽

Causal Agent ◽

First Report ◽

Greenhouse Cucumber ◽

Crown And Root Rot

Download Full-text

First Report of Aphanomyces Root Rot of Sugar Beet in Nebraska and Wyoming

Plant Disease ◽

10.1094/pdis.2000.84.5.596b ◽

2000 ◽

Vol 84 (5) ◽

pp. 596-596 ◽

Cited By ~ 3

Author(s):

R. M. Harveson

Keyword(s):

Sugar Beet ◽

Beta Vulgaris ◽

Root Rot ◽

Causal Agent ◽

High Plains ◽

Sugar Beets ◽

Koch’S Postulates ◽

First Report ◽

Aphanomyces Cochlioides ◽

Central High

Sugar beet (Beta vulgaris L.) plants exhibiting dull green and chlorotic foliage were first observed in a field near Dalton, NE, in late July 1999. Root symptoms included distal tip rot with internal, yellow-brown, water-soaked tissues. Isolations on MBV medium (1) consistently yielded Aphanomyces cochlioides Drechs. Water cultures produced primary zoospores that encysted at the tips of sporangiophores, followed by release of secondary zoospores within 12 h. Seedlings inoculated with zoospores began to die 2 weeks after emergence in a greenhouse. Symptoms on hypocotyls began as water-soaked lesions that turned black and thread-like. The causal agent was reisolated from infected seedlings, completing Koch's postulates. The disease was subsequently found in more than 15 separate fields, representing 5 of 11 sugar beet-growing counties in Nebraska and 1 county in Wyoming. In October, plants from the same fields were observed with stunted, distorted roots and superficial, scabby lesions associated with latent A. cochlioides infection. The pathogen could not be isolated from this stage but was confirmed by observing mature oospores within thin, stained sections under a microscope. The sections were additionally mixed with sterile potting soil and planted in the greenhouse with sugar beets. Several weeks after emergence, seedlings began to die, and the pathogen was reisolated. This represents the first report of Aphanomyces root rot and its spread in the Central High Plains. It also confirms that the described latent symptoms on sugar beet are caused by A. cochlioides. Reference: (1). W. F. Pfender et al. Plant Dis. 68:845, 1984.

Download Full-text