Endophytic Bacteria from the Sahara Desert Protect Tomato Plants Against Botrytis cinerea Under Different Experimental Conditions

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Download Full-text

Secondary metabolites produced by endophytic bacteria against the Root-Knot Nematode (Meloidogyne sp.)

Biodiversitas Journal of Biological Diversity ◽

10.13057/biodiv/d211130 ◽

2020 ◽

Vol 21 (11) ◽

Author(s):

Vina Maulidia ◽

Loekas Soesanto ◽

Syamsuddin Syamsuddin ◽

Khairan Khairan ◽

Takahiro Hamaguchi ◽

...

Keyword(s):

Secondary Metabolites ◽

Endophytic Bacteria ◽

Psidium Guajava ◽

Plant Tissues ◽

Root Number ◽

Root Knot Nematode ◽

Plant Host ◽

Tomato Plants ◽

Theobroma Cacao L ◽

Meloidogyne Sp

Abstract. Maulidia V, Soesanto L, Syamsuddin, Khairan K, Hamaguchi T, Hasegawa K, Sriwati R. 2020. Secondary metabolites produced by endophytic bacteria against the Root-Knot Nematode (Meloidogyne sp.). Biodiversitas 21: 5270-5275. Endophytic bacteria live and colonize in plant tissues without causing disease to their plant host. Among several processes, these bacteria can produce secondary metabolites that can help in the defense of plant host against pathogens. This study aimed to identify endophytic bacteria as biocontrol agents against Meloidogyne sp. in tomato plants. Six endophytic bacteria candidates from the genus Pseudomonas, Arthrobacter, Bacillus, and Serratia were isolated from Solanum Lycopersicum, Psidium guajava, Pinus merkusii, Dendrocalamus asper, Albizia chinensis, and Theobroma cacao L, respectively. The average mortality of Meloidogyne sp. by endophytic bacteria was 70,27% to 95,46%. From these, B. thuringiensis AK08 produced compounds of the secondary metabolites such as flavonoid, phenol, tannins, terpenoids, steroids, saponins, and alkaloids. The best result of the average incubation period, number of galls in the root, number of nematodes at the root, and the number of nematodes in the soil on tomato plant were shown by B. thuringiensis. The major compounds in GC-MS analysis of B. thuringiensis were cholest-5-en-3-ol (3.beta.)-carbonochloridate (25.35%). Bacillus thuringiensis not only has rules as bio-insecticide but also has nematicidal effect.

Download Full-text

Comparison of defence responses to Botrytis cinerea infection in tomato plants propagated in vitro and grown in vivo

Acta Agrobotanica ◽

10.5586/aa.1996.012 ◽

2013 ◽

Vol 49 (1-2) ◽

pp. 115-121 ◽

Cited By ~ 1

Author(s):

Jacek Patykowski ◽

Elżbieta Kuźniak ◽

Henryk Urbaniak

Keyword(s):

Superoxide Dismutase ◽

Botrytis Cinerea ◽

Ascorbate Peroxidase ◽

Guaiacol Peroxidase ◽

Activity Increase ◽

Tomato Plants ◽

Defence Responses ◽

Defence Reactions

Defence reactions: O2 - generation, superoxide dismutase, catalase, guaiacol peroxidase and ascorbate peroxidase activities after B. cinerea infection in tomato plants propagated in vitro and grown in vivo have been compared. Infection resulted in rapid O2 - generation. Superoxide dismutase activity increase was slower than O2 - response. In plants propagated in vitro catalase and guaiacol peroxidase activities after infection were induced less strongly than in plants grown in vivo. K2HPO4 pretreatment of plants grown in vitro enhanced significantly the activities of catalase and guaiacol peroxidase after infection. Slight restriction of B. cinerea infection development in in vitro propagated plants pretreated with K2HP04 was observed.

Download Full-text