Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.
Key factors to inoculate Botrytis cinerea in tomato plants
